PREFIX obo:
PREFIX rdf:
PREFIX rdfs:
PREFIX xsd:
obo:ENVO_01000472 a rdfs:Class ;
rdfs:label "building roof" ;
rdfs:comment "A roof is the covering on the uppermost part of a building which provides protection from animals and weather, notably rain, but also heat, wind and sunlight. A roof is also the framing or structure which supports the covering" ;
rdfs:subClassOf obo:ENVO_01000420 .
obo:RO_0002353 a rdf:Property ;
rdfs:label "output of"@en ;
rdfs:comment "inverse of has output" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0002328 , obo:RO_0000056 .
obo:RO_0002450 a rdf:Property ;
rdfs:label "directly positively regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that positively regulates an activity performed by B.
For example, A and B may be gene products and binding of B by A positively regulates the kinase activity of B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002448 .
obo:RO_0002448 a rdf:Property ;
rdfs:label "directly regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that regulates an activity performed by B. For example, A and B may be gene products and binding of B by A regulates the kinase activity of B.
A and B can be physically interacting but not necessarily. Immediately upstream means there are no intermediate entity between A and B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0011002 , obo:RO_0002436 .
obo:RO_0002220 a rdf:Property ;
rdfs:label "adjacent to"@en ;
rdfs:comment "x adjacent to y if and only if x and y share a boundary." ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000004 ;
rdfs:subPropertyOf obo:RO_0002163 .
obo:RO_0001025 a rdf:Property ;
rdfs:label "located in"@en ;
rdfs:comment "a relation between two independent continuants, the target and the location, in which the target is entirely within the location"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range .
obo:RO_0002506 a rdf:Property ;
rdfs:label "causal relation between entities" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0001018 a rdf:Property ;
rdfs:label "contained in"@en ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000004 .
obo:RO_0002202 a rdf:Property ;
rdfs:label "develops from"@en ;
rdfs:comment "x develops from y if and only if either (a) x directly develops from y or (b) there exists some z such that x directly develops from z and z develops from y" ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000004 ;
rdfs:subPropertyOf obo:RO_0002258 .
obo:RO_0011002 a rdf:Property ;
rdfs:label "regulates activity of" ;
rdfs:comment "The entity A has an activity that regulates an activity of the entity B. For example, A and B are gene products where the catalytic activity of A regulates the kinase activity of B." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002566 .
obo:RO_0002566 a rdf:Property ;
rdfs:label "causally influences" ;
rdfs:comment "The entity or characteristic A is causally upstream of the entity or characteristic B, A having an effect on B. An entity corresponds to any biological type of entity as long as a mass is measurable. A characteristic corresponds to a particular specificity of an entity (e.g., phenotype, shape, size)." ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002506 .
obo:RO_0000087 a rdf:Property ;
rdfs:label "has role" ;
rdfs:comment "a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000023 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0002215 a rdf:Property ;
rdfs:label "capable of"@en ;
rdfs:comment "A relation between a material entity (such as a cell) and a process, in which the material entity has the ability to carry out the process." ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002216 .
obo:RO_0003001 a rdf:Property ;
rdfs:label "produced by"@en ;
rdfs:comment "a produced_by b iff some process that occurs_in b has_output a." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 .
obo:OBIB_0000735 a rdf:Property ;
rdfs:label "is owned by"@en ;
rdfs:comment "a is owned by b if b has complete power over a. All rights and obligations of ownership are grounded in this (primitive) relation. The claims and obligations of ownership can be partially transferred to a third party by the owner, b."@en ;
rdfs:range xsd:string .
obo:RO_0000085 a rdf:Property ;
rdfs:label "has function"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a function, in which the function specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000034 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0003000 a rdf:Property ;
rdfs:label "produces"@en ;
rdfs:comment "a produces b if some process that occurs_in a has_output b, where a and b are material entities. Examples: hybridoma cell line produces monoclonal antibody reagent; chondroblast produces avascular GAG-rich matrix." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 .
obo:RO_0002449 a rdf:Property ;
rdfs:label "directly negatively regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that negatively regulates an activity performed by B.
For example, A and B may be gene products and binding of B by A negatively regulates the kinase activity of B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002448 .
obo:RO_0002595 a rdf:Property ;
rdfs:label "causal relation between material entity and a process" ;
rdfs:comment "A relationship that holds between a material entity and a process in which causality is involved, with either the material entity or some part of the material entity exerting some influence over the process, or the process influencing some aspect of the material entity." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:BFO_0000050 a rdf:Property ;
rdfs:label "part of" ;
rdfs:comment "For continuants: C part_of C' if and only if: given any c that instantiates C at a time t, there is some c' such that c' instantiates C' at time t, and c *part_of* c' at t. For processes: P part_of P' if and only if: given any p that instantiates P at a time t, there is some p' such that p' instantiates P' at time t, and p *part_of* p' at t. (Here *part_of* is the instance-level part-relation.)" ;
rdfs:seeAlso , , , ;
rdfs:range obo:BFO_0000004 , obo:BFO_0000031 , obo:BFO_0000003 , obo:BFO_0000020 , obo:BFO_0000017 , obo:BFO_0000002 , , obo:BFO_0000019 ;
rdfs:subPropertyOf obo:RO_0002131 .
obo:RO_0002473 a rdf:Property ;
rdfs:label "composed primarily of" ;
rdfs:comment "x composed_primarily_of y if and only if more than half of the mass of x is made from y or units of the same type as y." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:RO_0001000 a rdf:Property ;
rdfs:label "derives from" ;
rdfs:comment "a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000004 ;
rdfs:subPropertyOf obo:ENVO_01003004 .
obo:RO_0002258 a rdf:Property ;
rdfs:label "developmentally preceded by"@en ;
rdfs:comment "Candidate definition: x developmentally related to y if and only if there exists some developmental process (GO:0032502) p such that x and y both participates in p, and x is the output of p and y is the input of p" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002324 .
obo:RO_0000091 a rdf:Property ;
rdfs:label "has disposition"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000016 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0000056 a rdf:Property ;
rdfs:label "participates in" ;
rdfs:comment "a relation between a continuant and a process, in which the continuant is somehow involved in the process" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000003 .
obo:RO_0002434 a rdf:Property ;
rdfs:label "interacts with" ;
rdfs:comment "A relationship that holds between two entities in which the processes executed by the two entities are causally connected." ;
rdfs:seeAlso ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 .
obo:SDDO_1000002 a rdfs:Class ;
rdfs:label "spase:DisplayData"@en ;
rdfs:comment "A graphical representation of data wherein the underlying numeric values are not (readily) accessible for analysis." ;
rdfs:subClassOf obo:SDDO_3000051 .
obo:OBI_0000312 a rdf:Property ;
rdfs:label "is_specified_output_of"@en ;
rdfs:comment "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of."@en ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:OBI_0000011 , obo:OBIB_0000710 ;
rdfs:subPropertyOf obo:RO_0000056 .
obo:OBI_0001938 a rdf:Property ;
rdfs:label "has value specification" ;
rdfs:comment "A relation between an information content entity and a value specification that specifies its value." ;
rdfs:domain obo:IAO_0000030 ;
rdfs:range obo:OBI_0001933 ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:RO_0000058 a rdf:Property ;
rdfs:label "is concretized as"@en ;
rdfs:comment "A relationship between a generically dependent continuant and a specifically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants."@en ;
rdfs:domain obo:BFO_0000031 ;
rdfs:range obo:BFO_0000020 .
obo:IAO_0000136 a rdf:Property ;
rdfs:label "is about" ;
rdfs:comment "is_about is a (currently) primitive relation that relates an information artifact to an entity." ;
rdfs:domain obo:IAO_0000030 ;
rdfs:range .
obo:RBO_00000124 a rdfs:Class ;
rdfs:label "cellular process" ;
rdfs:subClassOf obo:RBO_00000123 .
obo:BFO_0000062 a rdf:Property ;
rdfs:label "preceded by"@en ;
rdfs:comment "x is preceded by y if and only if the time point at which y ends is before or equivalent to the time point at which x starts. Formally: x preceded by y iff ω(y) <= α(x), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point."@en ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002086 .
obo:BFO_0000063 a rdf:Property ;
rdfs:label "precedes"@en ;
rdfs:comment "x precedes y if and only if the time point at which x ends is before or equivalent to the time point at which y starts. Formally: x precedes y iff ω(x) <= α(y), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point."@en ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002222 .
obo:BFO_0000066 a rdf:Property ;
rdfs:label "occurs in"@en ;
rdfs:comment "b occurs_in c =def b is a process and c is a material entity or immaterial entity& there exists a spatiotemporal region r and b occupies_spatiotemporal_region r.& forall(t) if b exists_at t then c exists_at t & there exist spatial regions s and s’ where & b spatially_projects_onto s at t& c is occupies_spatial_region s’ at t& s is a proper_continuant_part_of s’ at t"@en ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000004 .
obo:RO_0002501 a rdf:Property ;
rdfs:label "causal relation between processes" ;
rdfs:comment "p is causally related to q if and only if p or any part of p and q or any part of q are linked by a chain of events where each event pair is one where the execution of p influences the execution of q. p may be upstream, downstream, part of, or a container of q." ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0002232 a rdf:Property ;
rdfs:label "has end location"@en ;
rdfs:comment "x 'has end location' y if and only if there exists some process z such that x 'ends with' z and z 'occurs in' y" ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000004 ;
rdfs:subPropertyOf obo:RO_0002479 .
obo:RO_0019000 a rdf:Property ;
rdfs:label "regulates characteristic" ;
rdfs:comment "A relationship that holds between a process and a characteristic in which process (P) regulates characteristic (C) iff: P results in the existence of C OR affects the intensity or magnitude of C." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:PATO_0000001 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0002233 a rdf:Property ;
rdfs:label "has input"@en ;
rdfs:comment "p has input c iff: p is a process, c is a material entity, c is a participant in p, c is present at the start of p, and the state of c is modified during p." ;
rdfs:seeAlso ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:RO_0002211 a rdf:Property ;
rdfs:label "regulates (processual)" ;
rdfs:comment "p regulates q iff p is causally upstream of q, the execution of p is not constant and varies according to specific conditions, and p influences the rate or magnitude of execution of q due to an effect either on some enabler of q or some enabler of a part of q." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002411 .
obo:RO_0002018 a rdf:Property ;
rdfs:label "has component process" ;
rdfs:comment "w 'has process component' p if p and w are processes, w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002180 .
obo:RO_0002479 a rdf:Property ;
rdfs:label "has part that occurs in" ;
rdfs:comment "p has part that occurs in c if and only if there exists some p1, such that p has_part p1, and p1 occurs in c." ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000004 .
obo:BFO_0000055 a rdf:Property ;
rdfs:label "realizes"@en ;
rdfs:comment "Paraphrase of elucidation: a relation between a process and a realizable entity, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000017 .
obo:RO_0000057 a rdf:Property ;
rdfs:label "has participant" ;
rdfs:comment "a relation between a process and a continuant, in which the continuant is somehow involved in the process" ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000002 .
obo:RO_0002222 a rdf:Property ;
rdfs:label "temporally related to"@en ;
rdfs:comment "A relation that holds between two occurrents. This is a grouping relation that collects together all the Allen relations." ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 .
obo:RO_0002334 a rdf:Property ;
rdfs:label "regulated by"@en ;
rdfs:comment "inverse of regulates" ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002427 .
obo:ENVO_2000038 a rdfs:Class ;
rdfs:label "coal power plant" ;
rdfs:subClassOf obo:ENVO_00002214 , obo:ENVO_2000037 .
obo:BFO_0000051 a rdf:Property ;
rdfs:label "has part" ;
rdfs:comment "a core relation that holds between a whole and its part"@en ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0002131 .
obo:ENVO_2000036 a rdf:Property ;
rdfs:label "generates" ;
rdfs:comment "A relation between a process and a disposition such that the existence of the disposition is caused by the execution of the process." ;
rdfs:range .
obo:UBERON_0000465 a rdfs:Class ;
rdfs:label "material anatomical entity" ;
rdfs:comment "Anatomical entity that has mass." ;
rdfs:subClassOf obo:BFO_0000040 , obo:UBERON_0001062 .
obo:IAO_0000009 a rdfs:Class ;
rdfs:label "datum label"@en ;
rdfs:comment "A label is a symbol that is part of some other datum and is used to either partially define the denotation of that datum or to provide a means for identifying the datum as a member of the set of data with the same label"@en ;
rdfs:subClassOf obo:IAO_0000030 .
obo:ENVO_01000869 a rdfs:Class ;
rdfs:label "area of scrub"@en ;
rdfs:comment "An area of a planet's surface which is primarily covered by a shrubs, young trees, or stunted trees.. The surfaces of this area are in contact with an atmospheric column extending from the planetary boundary layer to the planet's exosphere with little to no physical obstruction." ;
rdfs:subClassOf obo:ENVO_01001293 .
obo:UO_0000273 a rdfs:Class ;
rdfs:label "milligram per liter" ;
rdfs:comment "\"A mass unit density which is equal to mass of an object in milligrams divided by the volume in liters.\" [UOC:GVG]" ;
rdfs:subClassOf obo:UO_1000175 .
obo:has_prefix a rdf:Property ;
rdfs:range .
obo:GENO_0000481 a rdfs:Class ;
rdfs:label "genomic feature"@en ;
rdfs:comment "A sequence feature (continuous extent of biological sequence) that is of genomic origin (i.e. carries sequence from the genome of a cell or organism)" ;
rdfs:subClassOf obo:GENO_0000897 , obo:SO_0000110 .
obo:RO_0002162 a rdf:Property ;
rdfs:label "in taxon"@en ;
rdfs:comment "x is in taxon y if an only if y is an organism, and the relationship between x and y is one of: part of (reflexive), developmentally preceded by, derives from, secreted by, expressed." ;
rdfs:range .
obo:GENO_0000239 a rdf:Property ;
rdfs:label "has_sequence" ;
rdfs:comment "A relationship between an entity that carries a sequence (e.g. a sequence feature or collection), and the sequence it bears." ;
rdfs:range obo:GENO_0000702 .
obo:GENO_0000903 a rdf:Property ;
rdfs:label "has_location"@en ;
rdfs:comment "A relation linking a sequence feature to the location it occupies on some reference sequence." ;
rdfs:domain obo:SO_0000110 ;
rdfs:range obo:GENO_0000815 .
obo:ENVO_01001581 a rdfs:Class ;
rdfs:label "sea surface layer"@en ;
rdfs:comment "A surface layer which is part of an ocean or sea."@en ;
rdfs:subClassOf obo:ENVO_01001554 .
obo:RO_0000086 a rdf:Property ;
rdfs:label "has quality"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence"@en ;
rdfs:range obo:BFO_0000019 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:BFO_0000067 a rdf:Property ;
rdfs:label "contains process"@en ;
rdfs:comment "[copied from inverse property 'occurs in'] b occurs_in c =def b is a process and c is a material entity or immaterial entity& there exists a spatiotemporal region r and b occupies_spatiotemporal_region r.& forall(t) if b exists_at t then c exists_at t & there exist spatial regions s and s’ where & b spatially_projects_onto s at t& c is occupies_spatial_region s’ at t& s is a proper_continuant_part_of s’ at t"@en ;
rdfs:range .
obo:RBO_00015004 a rdfs:Class ;
rdfs:label "alpha decay" ;
rdfs:comment "Nuclear decay in which an alpha particle is emitted." ;
rdfs:subClassOf obo:RBO_00002118 .
obo:OBI_0000417 a rdf:Property ;
rdfs:label "achieves_planned_objective" ;
rdfs:comment "This relation obtains between a planned process and a objective specification when the criteria specified in the objective specification are met at the end of the planned process." ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:IAO_0000005 .
obo:OBI_0000293 a rdf:Property ;
rdfs:label "has_specified_input"@en ;
rdfs:comment "The inverse property of is_specified_input_of"@en ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:BFO_0000002 , obo:BFO_0000040 , obo:IAO_0000027 , obo:OBI_0000648 ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:OBI_0000299 a rdf:Property ;
rdfs:label "has_specified_output"@en ;
rdfs:comment "The inverse property of is_specified_output_of"@en ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:UO_1010015 a rdfs:Class ;
rdfs:label "chain based unit" ;
rdfs:subClassOf obo:UO_0000001 .
obo:NCBITaxon_376913 a rdfs:Class ;
rdfs:label "Haplorrhini" ;
rdfs:subClassOf obo:NCBITaxon_9443 .
obo:RBO_00015018 a rdfs:Class ;
rdfs:label "external radiation exposure" ;
rdfs:comment "Exposure to an external source of radiation of any origin or type." ;
rdfs:subClassOf obo:RBO_00002000 .
obo:RBO_00000010 a rdfs:Class ;
rdfs:label "light ion" ;
rdfs:comment "An atomic nucleus, fully stripped of its orbital electrons, and containing 2, 3, 4, 5, or 6 protons." ;
rdfs:subClassOf obo:CHEBI_33252 , obo:RBO_00005003 .
obo:RO_0002493 a rdf:Property ;
rdfs:range .
obo:RBO_00000077 a rdfs:Class ;
rdfs:label "astronaut" ;
rdfs:subClassOf obo:RBO_00000111 .
a rdfs:Class ;
rdfs:label "Resource Identifier Encoding Schemes"@en-US ;
rdfs:comment "A set of resource identifier encoding schemes and/or formats"@en-US .
obo:PATO_0000689 a rdfs:Class ;
rdfs:label "continuous" ;
rdfs:comment "A quality of a single process inhering in a bearer by virtue of the bearer's being uninterrupted in time, sequence, substance, or extent." ;
rdfs:subClassOf obo:PATO_0000057 .
obo:RO_0000059 a rdf:Property ;
rdfs:label "concretizes"@en ;
rdfs:comment "A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant."@en ;
rdfs:domain obo:BFO_0000020 ;
rdfs:range obo:BFO_0000031 .
obo:NCBITaxon_117571 a rdfs:Class ;
rdfs:label "Euteleostomi" ;
rdfs:subClassOf obo:NCBITaxon_117570 .
obo:UO_0000048 a rdfs:Class ;
rdfs:label "acceleration unit" ;
rdfs:comment "\"A unit which is a standard measure of the rate of change of velocity in either speed or direction.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000000 .
obo:ENVO_01001245 a rdfs:Class ;
rdfs:label "woodland ecosystem"@en ;
rdfs:comment "An ecosystem which is determined by communities of plants with a tree growth form and in which members of those communities are spaced sufficiently far apart to allow sunlight to illuminate the understory." ;
rdfs:subClassOf obo:ENVO_01001790 .
obo:RO_0002509 a rdf:Property ;
rdfs:label "determined by part of" ;
rdfs:comment "s 'determined by part of' w if and only if there exists some f such that (1) s 'determined by' f and (2) f part_of w, or f=w." ;
rdfs:domain obo:RO_0002577 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002506 , obo:RO_0002131 .
obo:OBI_0000094 a rdfs:Class ;
rdfs:label "material processing"@en ;
rdfs:comment "A planned process which results in physical changes in a specified input material"@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:PO_0025025 a rdfs:Class ;
rdfs:label "root system" ;
rdfs:comment "A collective plant organ structure (PO:0025007) that produces root meristems (PO:0006085), the plant structures (PO:0009011) that arise from them and the parts thereof." ;
rdfs:subClassOf obo:PO_0025007 .
obo:RO_0002160 a rdf:Property ;
rdfs:range .
obo:RBO_00000021 a rdfs:Class ;
rdfs:label "fractionated radiation exposure" ;
rdfs:comment "A radiation dose administered in two or more exposures at specified time intervals" ;
rdfs:subClassOf obo:RBO_00002000 .
obo:UO_1000014 a rdfs:Class ;
rdfs:label "candela based unit" ;
rdfs:subClassOf obo:UO_0000007 .
obo:ENVO_01001526 a rdfs:Class ;
rdfs:label "frozen soil"@en ;
rdfs:comment "Soil which is below the freezing point of water." ;
rdfs:subClassOf obo:ENVO_00001998 .
obo:RBO_00000066 a rdfs:Class ;
rdfs:label "plutonium" ;
rdfs:comment "A naturally radioactive element of the actinide metals series. It has the atomic symbol Pu, and atomic number 94. Plutonium is used as a nuclear fuel, to produce radioisotopes for research, in radionuclide batteries for pacemakers, and as the agent of fission in nuclear weapons." ;
rdfs:subClassOf obo:RBO_00000061 .
obo:BFO_0000034 a rdfs:Class ;
rdfs:label "function"@en ;
rdfs:subClassOf obo:BFO_0000016 .
obo:RO_0004028 a rdf:Property ;
rdfs:label "realized in response to stimulus" ;
rdfs:comment "A relationship between a realizable entity R (e.g. function or disposition) and a material entity M where R is realized in response to a process that has an input stimulus of M." ;
rdfs:domain obo:BFO_0000017 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0000079 a rdf:Property ;
rdfs:label "function of"@en ;
rdfs:comment "a relation between a function and an independent continuant (the bearer), in which the function specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000034 ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0000052 .
obo:BFO_0000054 a rdf:Property ;
rdfs:label "realized in"@en ;
rdfs:comment "Paraphrase of elucidation: a relation between a realizable entity and a process, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ;
rdfs:domain obo:BFO_0000017 ;
rdfs:range obo:BFO_0000015 , obo:OBI_0000011 , obo:OBI_0000066 , obo:OBI_0000457 .
obo:RO_0009501 a rdf:Property ;
rdfs:label "realized in response to"@en ;
rdfs:comment "r 'realized in response to' s iff, r is a realizable (e.g. a plant trait such as responsivity to drought), s is an environmental stimulus (a process), and s directly causes the realization of r." ;
rdfs:seeAlso ;
rdfs:domain obo:BFO_0000017 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:UO_0000050 a rdfs:Class ;
rdfs:label "angular acceleration unit" ;
rdfs:comment "\"A unit which is a standard measure of the rate of change of angular velocity.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000000 .
obo:CHEBI_33318 a rdfs:Class ;
rdfs:label "main group element atom" ;
rdfs:comment "An atom belonging to one of the main groups (found in the s- and p- blocks) of the periodic table." ;
rdfs:subClassOf obo:CHEBI_33250 .
obo:RBO_00005007 a rdfs:Class ;
rdfs:label "Helium-4 nucleus" ;
rdfs:comment "An atomic nucleus with 2 protons and 2 neutrons " ;
rdfs:subClassOf obo:RBO_010012 .
obo:RBO_00002044 a rdfs:Class ;
rdfs:label "situation awareness and decision support study" ;
rdfs:comment "Studies concerning the optimisation of situation awareness through gathering and analysing information, and methodologies for making decisions on that awareness, such as estimating the path of a radioactive fallout with respect to weather and population density and making a decision to evacuate a population." ;
rdfs:subClassOf obo:RBO_00002016 .
obo:RBO_00005001 a rdfs:Class ;
rdfs:label "heavy ion radiation" ;
rdfs:comment "Atomic nuclei, with atomic number 2 or greater and kinetic energy imparted by natural or artificial means" ;
rdfs:subClassOf obo:RBO_00000117 .
obo:RBO_2001 a rdf:Property ;
rdfs:label "mass number" ;
rdfs:domain obo:RBO_00005001 ;
rdfs:range xsd:nonNegativeInteger .
obo:PATO_0002303 a rdfs:Class ;
rdfs:label "decreased object quality" ;
rdfs:comment "A quality of an object that has a value that is decreased compared to normal or average." ;
rdfs:subClassOf obo:PATO_0001241 , obo:PATO_0002301 .
obo:OBI_0000947 a rdfs:Class ;
rdfs:label "service provider role" ;
rdfs:comment "is a role which inheres in a person or organization and is realized in in a planned process which provides access to training, materials or execution of protocols for an organization or person" ;
rdfs:subClassOf obo:OMRSE_00000048 .
obo:RO_0000052 a rdf:Property ;
rdfs:label "inheres in"@en ;
rdfs:comment "a relation between a specifically dependent continuant (the characteristic) and any other entity (the bearer), in which the characteristic depends on the bearer for its existence."@en ;
rdfs:range obo:BFO_0000040 , ;
rdfs:subPropertyOf obo:RO_0002314 .
obo:BFO_0000017 a rdfs:Class ;
rdfs:label "realizable entity"@en ;
rdfs:comment "A specifically dependent continuant that inheres in continuant entities and are not exhibited in full at every time in which it inheres in an entity or group of entities. The exhibition or actualization of a realizable entity is a particular manifestation, functioning or process that occurs under certain circumstances."@en ;
rdfs:subClassOf obo:BFO_0000020 .
obo:UO_1000163 a rdfs:Class ;
rdfs:label "mass percentage based unit" ;
rdfs:subClassOf obo:UO_0000051 , obo:UO_0000187 .
obo:PATO_0001412 a rdfs:Class ;
rdfs:label "unstructured" ;
rdfs:comment "A structural quality inhering in a bearer by virtue of the bearer's lacking distinct structure." ;
rdfs:subClassOf obo:PATO_0000141 .
obo:PATO_0001688 a rdfs:Class ;
rdfs:label "increased elevation" ;
rdfs:comment "An elevation which is relatively high." ;
rdfs:subClassOf obo:PATO_0001475 , obo:PATO_0001687 .
obo:SDDO_3000095 a rdfs:Class ;
rdfs:label "metadata product"@en ;
rdfs:comment "An information product that contains structured metadata." ;
rdfs:subClassOf obo:SDDO_3000079 .
obo:NCBITaxon_6072 a rdfs:Class ;
rdfs:label "Eumetazoa" ;
rdfs:subClassOf obo:NCBITaxon_33208 .
obo:CHEBI_25701 a rdfs:Class ;
rdfs:label "organic oxide" ;
rdfs:subClassOf obo:CHEBI_25741 , obo:CHEBI_72695 .
obo:ENVO_00000097 a rdfs:Class ;
rdfs:label "desert area" ;
rdfs:comment "A region rendered barren or partially barren by environmental extremes, especially by low rainfall." ;
rdfs:subClassOf obo:ENVO_01000752 .
obo:ENVO_01000266 a rdfs:Class ;
rdfs:label "water vapour" ;
rdfs:comment "Water vapour is a vapour which is the gas phase of water." ;
rdfs:subClassOf obo:ENVO_01000797 .
obo:ENVO_01000246 a rdfs:Class ;
rdfs:label "village biome" ;
rdfs:comment "A village biome is an anthropogenic terrestrial biome which contains settlements such as villages, towns, and/or small cities and which is primarily used for agricultural activity." ;
rdfs:subClassOf obo:ENVO_00000428 , obo:ENVO_01000773 .
obo:RO_0002354 a rdf:Property ;
rdfs:label "formed as result of"@en ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0002353 .
obo:GENO_0000902 a rdfs:Class ;
rdfs:label "genomic feature location"@en ;
rdfs:comment "The location of a sequence feature in a genome, defined by its start and end position on some reference genomic coordinate system" ;
rdfs:subClassOf obo:GENO_0000815 .
obo:ENVO_01000048 a rdfs:Class ;
rdfs:label "ocean biome" ;
rdfs:comment "A marine biome which is determined by an ocean." ;
rdfs:subClassOf obo:ENVO_00000447 .
obo:UO_1000094 a rdfs:Class ;
rdfs:label "meter per second based unit" ;
rdfs:subClassOf obo:UO_0000060 .
obo:CHEBI_58942 a rdfs:Class ;
rdfs:label "cationic amino-acid residue" ;
rdfs:comment "An amino-acid residue protonated on nitrogen." ;
rdfs:subClassOf obo:CHEBI_64769 .
a rdf:Property ;
rdfs:label "is conjugate acid of" ;
rdfs:range .
obo:RBO_00015020 a rdfs:Class ;
rdfs:label "internal experimental radiation exposure" ;
rdfs:comment "Planned exposure of an entity to radiation of any type, for example as part of a medical or experimental procedure with the intention of exposing the entity to radiation energy internally by the ingestion, inhalation or implantation of a source of radiation." ;
rdfs:subClassOf obo:RBO_00002008 , obo:RBO_00015017 .
obo:RBO_00002073 a rdfs:Class ;
rdfs:label "ecological population modelling study" ;
rdfs:comment "The development and use of mathematical models and systems analysis for the description of naturally occurring non-human populations, and applications to measuring the effects of radiological contamination." ;
rdfs:subClassOf obo:RBO_00002022 .
obo:ENVO_01000385 a rdfs:Class ;
rdfs:label "temperate deciduous broadleaf forest" ;
rdfs:comment "A deciduous broadleaf forest which is subject to temperate climate patterns." ;
rdfs:subClassOf obo:ENVO_01001792 , obo:ENVO_01001805 .
obo:CHEBI_33680 a rdfs:Class ;
rdfs:label "elemental helium" ;
rdfs:subClassOf obo:CHEBI_33679 .
obo:ENVO_01000828 a rdfs:Class ;
rdfs:label "humid air"@en ;
rdfs:comment "Air which has increased levels of water vapour." ;
rdfs:subClassOf obo:ENVO_00002005 .
obo:ENVO_02000200 a rdf:Property ;
rdfs:label "has increased levels of" ;
rdfs:comment "A has part relationship between a whole and a part, where the number of parts present in the whole is higher than in comparable entities." ;
rdfs:seeAlso ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0002180 .
obo:RBO_00002101 a rdfs:Class ;
rdfs:label "public education study" ;
rdfs:comment "Study on the modality, efficacy and responses to communication of information or advice to populations on any aspect of radiation, conceived of as an educational programme, and including a wider scope than just safety and risk. For example basic nuclear physics, emergency action advice." ;
rdfs:subClassOf obo:RBO_00002026 .
obo:UO_1000194 a rdfs:Class ;
rdfs:label "confluence percentage based unit" ;
rdfs:subClassOf obo:UO_0000187 .
obo:RBO_00000023 a rdfs:Class ;
rdfs:label "equivalent dose" ;
rdfs:comment "The product of the mean absorbed dose in an organ or tissue and the radiation weighting factor (w_R )of the radiation type of interest" ;
rdfs:subClassOf obo:RBO_010016 .
obo:ENVO_01000309 a rdfs:Class ;
rdfs:label "cold environment" ;
rdfs:comment "An environment which has a lower temperature than some local or global average." ;
rdfs:subClassOf obo:ENVO_01000254 .
obo:RBO_00005009 a rdfs:Class ;
rdfs:label "space flight" ;
rdfs:comment "Activity carried out by crewed or robotic vehicles outside the Earth's atmmosphere." ;
rdfs:subClassOf obo:SLSO_0000055 .
obo:UO_0000190 a rdfs:Class ;
rdfs:label "ratio unit" ;
rdfs:comment "\"A dimensionless unit which denotes an amount or magnitude of one quantity relative to another.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000186 .
obo:ENVO_01000295 a rdfs:Class ;
rdfs:label "marine layer" ;
rdfs:comment "A layer that is part of a marine water body." ;
rdfs:subClassOf obo:ENVO_01000325 , obo:ENVO_01001308 .
a rdfs:Class ;
rdfs:label "Met"@en ;
rdfs:subClassOf .
obo:ENVO_01001805 a rdfs:Class ;
rdfs:label "temperate forest"@en ;
rdfs:comment "A forest ecosystem which is subject to temperate climate conditions." ;
rdfs:subClassOf obo:ENVO_01001243 , obo:ENVO_01001705 .
obo:PATO_0000407 a rdfs:Class ;
rdfs:label "flat" ;
rdfs:comment "A quality inhering in a bearer by virtue of the bearer's having a horizontal surface without a slope, tilt, or curvature." ;
rdfs:subClassOf obo:PATO_0002254 .
obo:RBO_00015015 a rdfs:Class ;
rdfs:label "control specimen role" ;
rdfs:comment "A control specimen role of a biotic or abiotic sample or individual describes a specimen by its purpose, and therefore treatment, within a planned experimental process that tests hypotheses by isolating variables as dictated by the scientific method in order to make a conclusion about the effect of such variables. The quality of control inhering in the sample role exists as a result of the historical treatment of the sample. In a controlled experiment, two or more virtually identical experiments are conducted, but the factor being tested is varied in only one of them. This serves to isolate any causal phenomena. A control may have been subject to treatments during the experiment that might alter its state or behaviour and is therefore distinguishable from the sample as initial input into the experiment. However such treatments should in all cases but that of the variable under scrutiny, be the same as the experimental sample." ;
rdfs:subClassOf obo:OBI_0000112 .
obo:ENVO_04000010 a rdfs:Class ;
rdfs:label "soil surface layer"@en ;
rdfs:comment "A surface layer which is composed primarily of soil." ;
rdfs:subClassOf obo:ENVO_00000191 , obo:ENVO_01001311 , obo:ENVO_01001483 , obo:ENVO_06105266 .
obo:OBI_0000102 a rdfs:Class ;
rdfs:label "responsible party role"@en ;
rdfs:comment "a study personnel role played by a party who is accountable for the execution of a study component and can make decisions about the conduct of the study"@en ;
rdfs:subClassOf obo:OBI_0000202 .
obo:RBO_00002087 a rdfs:Class ;
rdfs:label "molecular genetic study" ;
rdfs:comment "Any study involving the manipulation, measurement, or characterisation of DNA or RNA in a cell or organism." ;
rdfs:subClassOf obo:RBO_00002024 .
obo:CHEBI_72695 a rdfs:Class ;
rdfs:label "organic molecule" ;
rdfs:comment "Any molecule that consists of at least one carbon atom as part of the electrically neutral entity." ;
rdfs:subClassOf obo:CHEBI_25367 , obo:CHEBI_50860 .
obo:UO_0000107 a rdfs:Class ;
rdfs:label "force unit" ;
rdfs:comment "\"A unit which is a standard measure of the force is applied when a mass is accelerated.\" [NIST:NIST]" ;
rdfs:subClassOf obo:UO_0000000 .
obo:ENVO_01000888 a rdfs:Class ;
rdfs:label "area of gramanoid or herbaceous vegetation"@en ;
rdfs:comment "An area of a planet's surface which is primarily covered by gramanoid or herbaceous vegetation and which is not subject to intensive management by humans. This area is in contact with an atmospheric column extending from the planetary boundary layer to the planet's exosphere with little to no physical obstruction." ;
rdfs:subClassOf obo:ENVO_00000106 .
obo:RO_0002131 a rdf:Property ;
rdfs:label "overlaps"@en ;
rdfs:comment "x overlaps y if and only if there exists some z such that x has part z and z part of y" ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0002323 .
a rdfs:Class ;
rdfs:label "Language Encoding Schemes"@en-US ;
rdfs:comment "A set of language encoding schemes and/or formats."@en-US .
obo:GO_0043170 a rdfs:Class ;
rdfs:label "macromolecule metabolic process" ;
rdfs:comment "The chemical reactions and pathways involving macromolecules, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass." ;
rdfs:subClassOf obo:GO_0071704 .
obo:RO_0002295 a rdf:Property ;
rdfs:label "results in developmental progression of"@en ;
rdfs:comment "p results in the developmental progression of s iff p is a developmental process and s is an anatomical entity and p causes s to undergo a change in state at some point along its natural developmental cycle (this cycle starts with its formation, through the mature structure, and ends with its loss)." ;
rdfs:seeAlso ;
rdfs:domain obo:GO_0008150 ;
rdfs:range obo:CARO_0000000 ;
rdfs:subPropertyOf obo:RO_0002324 .
obo:RBO_00002106 a rdfs:Class ;
rdfs:label "population behaviour study" ;
rdfs:comment "A study concerned with human or animal activity, in terms of motivation, direction, result, emotion, perception, or etiology within substantial populations of individuals. Likely to be carried out by mass observation or indirect inference." ;
rdfs:subClassOf obo:RBO_00002030 .
obo:SDDO_3000079 a rdfs:Class ;
rdfs:label "information product"@en ;
rdfs:comment "A product that describes some entity." ;
rdfs:subClassOf obo:SDDO_3000066 .
obo:RBO_010014 a rdfs:Class ;
rdfs:label "organ dose" ;
rdfs:comment "The mean absorbed radiation dose in a specified tissue or organ of the human body." ;
rdfs:subClassOf obo:RBO_010016 .
obo:RBO_00005072 a rdfs:Class ;
rdfs:label "space flight" ;
rdfs:comment "Travel beyond the Earth's atmosphere" ;
rdfs:subClassOf obo:PATO_0002062 .
a rdfs:Class ;
rdfs:label "RadiationTherapy"@en ;
rdfs:comment "A process of care using radiation aimed at improving a health condition."@en .
obo:NCBITaxon_1338369 a rdfs:Class ;
rdfs:label "Dipnotetrapodomorpha" ;
rdfs:subClassOf obo:NCBITaxon_8287 .
obo:CHEBI_26714 a rdfs:Class ;
rdfs:label "sodium salt" ;
rdfs:subClassOf obo:CHEBI_26712 , obo:CHEBI_35479 .
obo:ENVO_01000833 a rdfs:Class ;
rdfs:label "water droplet"@en ;
rdfs:comment "A droplet of water" ;
rdfs:subClassOf obo:ENVO_01000831 .
obo:UO_1000088 a rdfs:Class ;
rdfs:label "gram per mole based unit" ;
rdfs:subClassOf obo:UO_0000055 .
obo:UO_0000154 a rdfs:Class ;
rdfs:label "irradiance unit" ;
rdfs:comment "\"A unit which is a standard measure of the power of electromagnetic radiation at a surface, per unit area.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000157 .
obo:CHEBI_30212 a rdfs:Class ;
rdfs:label "photon" ;
rdfs:comment "Particle of zero charge, zero rest mass, spin quantum number 1, energy hnu and momentum hnu/c (h is the Planck constant, nu the frequency of radiation and c the speed of light), carrier of electromagnetic force." ;
rdfs:subClassOf obo:CHEBI_36341 .
obo:UBERON_0002384 a rdfs:Class ;
rdfs:label "connective tissue" ;
rdfs:comment "Tissue with cells that deposit non-polarized extracellular matrix including connective tissue fibers and ground substance." ;
rdfs:subClassOf obo:UBERON_0000479 .
obo:ENVO_01000230 a rdfs:Class ;
rdfs:label "arid" ;
rdfs:comment "An environmental condition in which annual precipitation is less than half of annual potential evapotranspiration." ;
rdfs:subClassOf obo:ENVO_01000203 .
obo:ENVO_01000215 a rdfs:Class ;
rdfs:label "temperate shrubland biome" ;
rdfs:comment "A shrubland biome which is subject to temperate climate patterns."@en ;
rdfs:subClassOf obo:ENVO_01000176 , obo:ENVO_01001831 .
obo:ENVO_01000202 a rdfs:Class ;
rdfs:label "temperate broadleaf forest biome" ;
rdfs:comment "A broadleaf forest which is subject to temperate climate patterns." ;
rdfs:subClassOf obo:ENVO_01000197 , obo:ENVO_01001794 , obo:ENVO_01001831 .
a rdfs:Class ;
rdfs:label "Physician"@en ;
rdfs:comment "A doctor's office."@en .
a rdf:Property ;
rdfs:label "hospitalAffiliation"@en ;
rdfs:comment "A hospital with which the physician or office is affiliated."@en ;
rdfs:range .
obo:RBO_00000078 a rdfs:Class ;
rdfs:label "military" ;
rdfs:subClassOf obo:RBO_00000111 .
obo:OBI_0200172 a rdfs:Class ;
rdfs:label "partitioning objective"@en ;
rdfs:comment "A partitioning objective is a data transformation objective where the aim is to generate a collection of disjoint non-empty subsets whose union equals a non-empty input set."@en ;
rdfs:subClassOf obo:OBI_0200166 .
obo:OBI_0000833 a rdf:Property ;
rdfs:label "objective_achieved_by" ;
rdfs:comment "This relation obtains between an objective specification and a planned process when the criteria specified in the objective specification are met at the end of the planned process." ;
rdfs:domain obo:IAO_0000005 ;
rdfs:range obo:OBI_0000011 .
obo:RBO_00002113 a rdfs:Class ;
rdfs:label "environmental study_panbiota (all)" ;
rdfs:comment "Study which may include human and non-human biota in the environment." ;
rdfs:subClassOf obo:RBO_00002072 .
obo:OBI_0001933 a rdfs:Class ;
rdfs:label "value specification" ;
rdfs:comment "An information content entity that specifies a value within a classification scheme or on a quantitative scale." ;
rdfs:subClassOf obo:IAO_0000030 .
obo:OBI_0002135 a rdf:Property ;
rdfs:label "has specified value"@en ;
rdfs:comment "A relation between a value specification and a literal." ;
rdfs:domain obo:OBI_0001933 ;
rdfs:range .
obo:OBI_0001937 a rdf:Property ;
rdfs:label "has specified numeric value" ;
rdfs:comment "A relation between a value specification and a number that quantifies it." ;
rdfs:domain obo:OBI_0001933 ;
rdfs:range ;
rdfs:subPropertyOf obo:OBI_0002135 .
obo:CHEBI_50047 a rdfs:Class ;
rdfs:label "organic amino compound" ;
rdfs:comment "A compound formally derived from ammonia by replacing one, two or three hydrogen atoms by organyl groups." ;
rdfs:subClassOf obo:CHEBI_35352 .
a rdf:Property ;
rdfs:label "has parent hydride" ;
rdfs:range .
obo:SDDO_3000084 a rdfs:Class ;
rdfs:label "software"@en ;
rdfs:comment "An information content entity that 1) contains a set of machine-readable instructions (most often in the form of a computer program) that 2) conform to a given syntax (sometimes referred to as a language) that 3) is interpretable by a given processor and that 4) directs a computer's processor to perform specific operations." ;
rdfs:subClassOf .
obo:ENVO_01000814 a rdfs:Class ;
rdfs:label "solid environmental material"@en ;
rdfs:comment "An environmental material which is in a solid state." ;
rdfs:subClassOf obo:ENVO_00010483 .
obo:ENVO_01001155 a rdfs:Class ;
rdfs:label "astrogeological gas"@en ;
rdfs:comment "An astrogeological volatile which is composed primarily of chemical compounds with boiling points around those of hydrogen and helium." ;
rdfs:subClassOf obo:ENVO_01001154 .
obo:NCBITaxon_7711 a rdfs:Class ;
rdfs:label "Chordata" ;
rdfs:subClassOf obo:NCBITaxon_33511 .
obo:RBO_00000001 a rdfs:Class ;
rdfs:label "ionizing radiation categorized by source" ;
rdfs:comment "Ionizing radiation classified by the material entity which generates or emits it." ;
rdfs:subClassOf obo:RBO_00000116 .
obo:UBERON_0000476 a rdfs:Class ;
rdfs:label "acellular anatomical structure" ;
rdfs:comment "Anatomical structure that consists of cell parts and cell substances and together does not constitute a cell or a tissue." ;
rdfs:subClassOf obo:UBERON_0000061 .
obo:PATO_0070060 a rdfs:Class ;
rdfs:label "quality of interaction of a substance with electromagnetic radiation" ;
rdfs:comment "A quality of a substance on which or through which electromagnetic radiation impinges or traverses with respect to radiation. This substance quality changes the quality of the incident radiation with respect to any of: intensity, direction, scatter and wavelength." ;
rdfs:subClassOf obo:PATO_0002198 .
obo:UO_1000196 a rdfs:Class ;
rdfs:label "pH based unit" ;
rdfs:subClassOf obo:UO_0000051 , obo:UO_0000186 .
obo:UBERON_0000922 a rdfs:Class ;
rdfs:label "embryo" ;
rdfs:comment "Anatomical entity that comprises the organism in the early stages of growth and differentiation that are characterized by cleavage, the laying down of fundamental tissues, and the formation of primitive organs and organ systems. For example, for mammals, the process would begin with zygote formation and end with birth. For insects, the process would begin at zygote formation and end with larval hatching. For plant zygotic embryos, this would be from zygote formation to the end of seed dormancy. For plant vegetative embryos, this would be from the initial determination of the cell or group of cells to form an embryo until the point when the embryo becomes independent of the parent plant." ;
rdfs:subClassOf obo:UBERON_0000468 .
obo:RBO_00000091 a rdfs:Class ;
rdfs:label "external exposure study" ;
rdfs:comment "A study of the effects of external irradiation on an organism." ;
rdfs:subClassOf obo:RBO_00000082 .
obo:ENVO_01000703 a rdfs:Class ;
rdfs:label "hydrological precipitation process"@en ;
rdfs:comment "Hydrological precipitation is a process during which any product of the condensation of atmospheric water vapour is pulled to the planetary surface by gravity." ;
rdfs:subClassOf obo:ENVO_01000875 .
obo:ENVO_09200012 a rdfs:Class ;
rdfs:label "temperature of soil" ;
rdfs:comment "The temperature of some soil." ;
rdfs:subClassOf obo:ENVO_09200000 , obo:PATO_0000146 .
obo:ENVO_01000303 a rdfs:Class ;
rdfs:label "endolithic environment" ;
rdfs:comment "An endolithic environment is an environment that exists within solid rock." ;
rdfs:subClassOf obo:ENVO_01000254 .
obo:RO_0002219 a rdf:Property ;
rdfs:label "surrounded by" ;
rdfs:comment "x surrounded_by y if and only if (1) x is adjacent to y and for every region r that is adjacent to x, r overlaps y (2) the shared boundary between x and y occupies the majority of the outermost boundary of x" ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000004 ;
rdfs:subPropertyOf obo:RO_0002220 .
obo:ENVO_01000638 a rdfs:Class ;
rdfs:label "planetary crust"@en ;
rdfs:comment "A planetary crust is the outermost solid shell of a rocky planet or natural satellite, which is chemically distinct from the underlying mantle." ;
rdfs:subClassOf obo:ENVO_01000639 .
obo:OBI_0000663 a rdfs:Class ;
rdfs:label "class prediction data transformation"@en ;
rdfs:comment "A class prediction data transformation (sometimes called supervised classification) is a data transformation that has objective class prediction."@en ;
rdfs:subClassOf obo:OBI_0200000 .
obo:ENVO_02500002 a rdfs:Class ;
rdfs:label "flooding"@en ;
rdfs:comment "A general and temporary condition of partial or complete inundation of normally dry land areas from the overflow of inland and/or tidal waters, and/or the unusual and rapid accumulation or runoff of surface waters from any source. A great flow along a watercourse or a flow causing inundation of lands not normally covered by water." ;
rdfs:subClassOf obo:ENVO_01000982 .
obo:RBO_00000017 a rdfs:Class ;
rdfs:label "earth surface" ;
rdfs:comment "That part of the Earth exposed to the Earth atmosphere." ;
rdfs:subClassOf obo:RBO_00000016 .
obo:RBO_00002017 a rdfs:Class ;
rdfs:label "clinical study" ;
rdfs:comment "Studies in which research is conducted with human subjects or on material of human origin in which the investigator directly interacts with human subjects, including the dveelopment of new technologies, understanding of the mechanisms of disease, therapy, clinical trials, epidemiology behaviousrand health services research." ;
rdfs:subClassOf obo:RBO_00000082 .
obo:RBO_00002112 a rdfs:Class ;
rdfs:label "environmental study_biota ( non human)" ;
rdfs:comment "Study of non-human biota in the natural environment." ;
rdfs:subClassOf obo:RBO_00002072 .
obo:RBO_00002055 a rdfs:Class ;
rdfs:label "radiation legislation study" ;
rdfs:comment "Study of legal and statutory instruments and legislation designed to regulate the safety, use and transport of radioactive materials, release of such materials into the environment, or external radiation." ;
rdfs:subClassOf obo:RBO_00002018 .
obo:RBO_00015026 a rdfs:Class ;
rdfs:label "mixed ion and photon sequential irradiation study" ;
rdfs:comment "A mixed ion and photon sequential irradiation study typically involves sequentially exposing a sample or system to a combination of these types of radiation. This could include exposure to various forms of ionizing radiation, such as gamma rays, X-rays, and particle radiation. Exposure might be from anthropogenic or natural sources of radiation. The goal is to understand how the different types of radiation interact with each other and their combined effects on the material or biological system under investigation." ;
rdfs:subClassOf obo:RBO_00015024 .
obo:ENVO_01000022 a rdfs:Class ;
rdfs:label "marine salt marsh biome" ;
rdfs:comment "The marine salt marsh biome comprises marshes that are transitional intertidals between land and salty or brackish marine water (e.g.: sloughs, bays, estuaries). It is dominated by halophytic (salt tolerant) herbaceous plants. The daily tidal surges bring in nutrients, which tend to settle in roots of the plants within the salt marsh. The natural chemical activity of salty (or brackish) water and the tendency of algae to bloom in the shallow unshaded water also allow for great biodiversity." ;
rdfs:subClassOf obo:ENVO_00000447 .
obo:ENVO_01001548 a rdfs:Class ;
rdfs:label "freezing"@en ;
rdfs:comment "A material congelation process during which a liquid turns into a solid when its temperature is lowered below its melting point." ;
rdfs:subClassOf obo:ENVO_01001510 .
obo:RO_0002234 a rdf:Property ;
rdfs:label "has output"@en ;
rdfs:comment "p has output c iff c is a participant in p, c is present at the end of p, and c is not present in the same state at the beginning of p." ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:OBI_0200042 a rdfs:Class ;
rdfs:label "hierarchical clustering"@en ;
rdfs:comment "A hierarchical clustering is a data transformation which achieves a class discovery objective, which takes as input data item and builds a hierarchy of clusters. The traditional representation of this hierarchy is a tree (visualized by a dendrogram), with the individual input objects at one end (leaves) and a single cluster containing every object at the other (root)."@en ;
rdfs:subClassOf obo:APOLLO_SV_00000796 , obo:OBI_0200175 .
obo:NCBITaxon_131567 a rdfs:Class ;
rdfs:label "cellular organisms" ;
rdfs:subClassOf obo:NCBITaxon_1 .
a rdfs:Class ;
rdfs:label "Location"@en ;
rdfs:comment "An object representing a named geographical place"@en ;
rdfs:subClassOf , .
a rdf:Property ;
rdfs:label "formatted name"@en ;
rdfs:comment "The formatted text corresponding to the name of the object"@en ;
rdfs:range xsd:string .
a rdfs:Class ;
rdfs:label "software license" ;
rdfs:comment "A licence is a legal instrument (usually by way of contract law, with or without printed material) governing the use or redistribution of the resource containing the licence." ;
rdfs:subClassOf obo:IAO_0000030 .
obo:ENVO_01001607 a rdfs:Class ;
rdfs:label "water current"@en ;
rdfs:comment "A hydroform which is maintained by a continuous, directed movement of water, generated by disequilibria in a water mass." ;
rdfs:subClassOf obo:ENVO_01001308 .
obo:UO_1000185 a rdfs:Class ;
rdfs:label "degree based unit" ;
rdfs:subClassOf obo:UO_0000122 .
obo:RBO_00002062 a rdfs:Class ;
rdfs:label "interview study" ;
rdfs:comment "Study conducted by means of structured or unstructured interviews of persons of interest." ;
rdfs:subClassOf obo:RBO_00002021 .
obo:ENVO_2000016 a rdfs:Class ;
rdfs:label "potential energy" ;
rdfs:comment "Energy possessed by an object because of its position relative to other objects, stresses within itself, its electric charge, or other factors."@en ;
rdfs:subClassOf obo:ENVO_2000015 .
obo:ENVO_2000035 a rdfs:Class ;
rdfs:label "stellar radiation energy" ;
rdfs:subClassOf obo:ENVO_2000030 .
obo:UO_1000116 a rdfs:Class ;
rdfs:label "lux based unit" ;
rdfs:subClassOf obo:UO_0000115 .
obo:PATO_0015009 a rdfs:Class ;
rdfs:label "humidity" ;
rdfs:comment "A quality inhering in air by virtue of the partial pressure exerted by the bearer's water vapour content." ;
rdfs:subClassOf obo:PATO_0001547 .
obo:RBO_00000051 a rdfs:Class ;
rdfs:label "cesium-137 gamma radiation" ;
rdfs:comment "High energy photons emitted during nuclear decay of the Cesium-137 isotope." ;
rdfs:subClassOf obo:RBO_00000120 .
obo:CHEBI_36340 a rdfs:Class ;
rdfs:label "fermion" ;
rdfs:comment "Particle of half-integer spin quantum number following Fermi-Dirac statistics. Fermions are named after Enrico Fermi." ;
rdfs:subClassOf obo:CHEBI_36342 .
obo:ENVO_01000325 a rdfs:Class ;
rdfs:label "aquatic layer" ;
rdfs:comment "A layer in a water mass, itself composed primarily of water." ;
rdfs:subClassOf obo:ENVO_01001273 .
obo:ENVO_01001654 a rdfs:Class ;
rdfs:label "aerosol formation process"@en ;
rdfs:comment "A material transformation process during which solid or liquid particles form and are suspended in a mass of air, thus creating an aerosol." ;
rdfs:subClassOf obo:ENVO_03000043 .
obo:ENVO_01000418 a rdfs:Class ;
rdfs:label "human house" ;
rdfs:comment "A human house is a house which provides a dwelling-place for humans." ;
rdfs:subClassOf obo:ENVO_01000417 , obo:ENVO_01001480 .
obo:PO_0009008 a rdfs:Class ;
rdfs:label "plant organ" ;
rdfs:comment "A multi-tissue plant structure (PO:0025496) that is a functional unit, is a proper part of a whole plant (PO:0000003), and includes portions of plant tissue (PO:0009007) of at least two different types that derive from a common developmental path." ;
rdfs:subClassOf obo:PO_0025496 .
obo:ENVO_01000952 a rdfs:Class ;
rdfs:label "anthropisation"@en ;
rdfs:comment "A process during which a natural environmental system is altered by human action." ;
rdfs:subClassOf obo:ENVO_01001434 .
obo:RO_0002608 a rdf:Property ;
rdfs:label "process has causal agent" ;
rdfs:comment "Inverse of 'causal agent in process'" ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:OBI_0000792 a rdfs:Class ;
rdfs:label "statistical model validation" ;
rdfs:comment "A data transformation which assesses how the results of a statistical analysis will generalize to an independent data set." ;
rdfs:subClassOf obo:OBI_0200171 .
obo:UO_1010024 a rdfs:Class ;
rdfs:label "rood based unit" ;
rdfs:subClassOf obo:UO_0000047 .
obo:PATO_0001546 a rdfs:Class ;
rdfs:label "quality of a solid" ;
rdfs:comment "A physical quality inhering in a bearer by virtue of the bearer's exhibiting the physical characteristics of an entity characterized by particles arranged such that their shape and volume are relatively stable." ;
rdfs:subClassOf obo:PATO_0002198 .
obo:ENVO_01000342 a rdfs:Class ;
rdfs:label "montane" ;
rdfs:comment "An altitudinal condition which inheres in a bearer by virtue of the bearer being located at an altitude between mid-altitude forests and the tree line." ;
rdfs:subClassOf obo:ENVO_01000343 .
obo:UO_1010019 a rdfs:Class ;
rdfs:label "maritime length unit based unit" ;
rdfs:subClassOf obo:UO_0000001 .
obo:ENVO_09200034 a rdfs:Class ;
rdfs:label "porosity of snow" ;
rdfs:comment "The porosity of some snow." ;
rdfs:subClassOf obo:PATO_0000973 .
a rdfs:Class ;
rdfs:label "Parcel"@en ;
rdfs:comment "This class is deprecated"@en ;
rdfs:subClassOf .
obo:CHEBI_33558 a rdfs:Class ;
rdfs:label "alpha-amino-acid anion" ;
rdfs:comment "An amino-acid anion obtained by deprotonation of any alpha-amino acid." ;
rdfs:subClassOf obo:CHEBI_37022 .
a rdf:Property ;
rdfs:label "is conjugate base of" ;
rdfs:range .
obo:GO_0033554 a rdfs:Class ;
rdfs:label "cellular response to stress" ;
rdfs:comment "Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating the organism is under stress. The stress is usually, but not necessarily, exogenous (e.g. temperature, humidity, ionizing radiation)." ;
rdfs:subClassOf obo:GO_0006950 , obo:GO_0051716 .
obo:PATO_0001985 a rdfs:Class ;
rdfs:label "frozen" ;
rdfs:comment "A quality inhering in a bearer by virtue of the bearer's being kept below its freezing point." ;
rdfs:subClassOf obo:PATO_0000146 .
obo:RBO_00002098 a rdfs:Class ;
rdfs:label "authority trust study" ;
rdfs:comment "Study of social and individual trust in the position and activities of legal or other competent advisory or regulatory authorities." ;
rdfs:subClassOf obo:RBO_00002025 .
obo:RBO_00002040 a rdfs:Class ;
rdfs:label "prospective study" ;
rdfs:comment "A type of study in which participants are enrolled into the study before they develop the disease or outcome in question." ;
rdfs:subClassOf obo:RBO_00000083 .
obo:UO_0000212 a rdfs:Class ;
rdfs:label "colony forming unit per volume" ;
rdfs:comment "A concentration unit which a measure of viable bacterial numbers in a given volume." ;
rdfs:subClassOf obo:UO_0000051 .
obo:IAO_0000183 a rdfs:Class ;
rdfs:label "dendrogram"@en ;
rdfs:comment """A dendrogram is a report graph which is a tree diagram
frequently used to illustrate the arrangement of the clusters produced by a
clustering algorithm."""@en ;
rdfs:subClassOf obo:IAO_0000038 .
obo:OBI_0500000 a rdfs:Class ;
rdfs:label "study design"@en ;
rdfs:comment "A plan specification comprised of protocols (which may specify how and what kinds of data will be gathered) that are executed as part of an investigation and is realized during a study design execution." ;
rdfs:subClassOf obo:IAO_0000104 .
obo:UO_0000280 a rdfs:Class ;
rdfs:label "rate unit" ;
rdfs:comment "\"A unit which represents a standard measurement occurrence of a process per unit time.\" [UOC:GVG]" ;
rdfs:subClassOf obo:IAO_0000003 , obo:UO_0000000 .
a rdfs:Class ;
rdfs:label "Other"@en ;
rdfs:subClassOf .
a rdfs:Class ;
rdfs:label "Relation Type"@en ;
rdfs:comment "Used for relation type codes. The URI of the relation type code must be used as the value for the Relation Type."@en .
obo:RBO_00015023 a rdfs:Class ;
rdfs:label "mixed irradiation study" ;
rdfs:comment "A mixed irradiation study typically involves exposing a sample or system to a combination of different types of radiation. This could include exposure to various forms of ionizing radiation, such as gamma rays, X-rays, and particle radiation. Exposure might be simultaneous or sequential and from anthropogenic or natural sources of radiation. The goal is to understand how the different types of radiation interact with each other and their combined effects on the material or biological system under investigation." ;
rdfs:subClassOf obo:RBO_00000082 .
obo:ENVO_01001122 a rdfs:Class ;
rdfs:label "gas planet"@en ;
rdfs:comment "A planet which is primarily composed of hydrogen and helium." ;
rdfs:subClassOf obo:ENVO_01000800 , obo:ENVO_01001686 .
a rdfs:Class ;
rdfs:label "Resource Type Encoding Schemes"@en-US ;
rdfs:comment "A set of resource type encoding schemes and/or formats"@en-US .
obo:SLSO_0000050 a rdfs:Class ;
rdfs:label "age (at launch/start)" ;
rdfs:comment "How long something or someone has existed; measured at launch/start" ;
rdfs:subClassOf obo:ExO_0000102 .
obo:RBO_00015012 a rdfs:Class ;
rdfs:label "ionization cluster" ;
rdfs:comment "A group of ionization events closely related in time and space, occurring in a specified target volume and originating from a single primary ionizing particle." ;
rdfs:subClassOf obo:UBERON_0000000 .
obo:CHEBI_33703 a rdfs:Class ;
rdfs:label "amino-acid cation" ;
rdfs:subClassOf obo:CHEBI_25697 , obo:CHEBI_33702 .
obo:UO_1000112 a rdfs:Class ;
rdfs:label "joule based unit" ;
rdfs:subClassOf obo:UO_0000111 .
obo:ENVO_00005748 a rdfs:Class ;
rdfs:label "dry soil" ;
rdfs:comment "Soil which has little to no water content and in which minerals and other soluble chemical entities have either bonded or become adsorbed to sold particles due to insufficient water availability." ;
rdfs:subClassOf obo:ENVO_00001998 .
obo:CHEBI_36080 a rdfs:Class ;
rdfs:label "protein" ;
rdfs:comment "A biological macromolecule minimally consisting of one polypeptide chain synthesized at the ribosome." ;
rdfs:subClassOf obo:CHEBI_33695 .
obo:PATO_0000169 a rdfs:Class ;
rdfs:label "viability" ;
rdfs:comment "An organismal quality inhering in a bearer or a population by virtue of the bearer's disposition to survive and develop normally or the number of surviving individuals in a given population." ;
rdfs:subClassOf obo:PATO_0001995 .
obo:UO_0000006 a rdfs:Class ;
rdfs:label "substance unit" ;
rdfs:comment "\"A unit which is a standardised quantity of an element or compound with uniform composition.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:IAO_0000003 , obo:UO_0000000 .
obo:ENVO_01001618 a rdfs:Class ;
rdfs:label "ice accumulation process"@en ;
rdfs:comment "A material accumulation process during which ice forms in an environmental material or an existing accumulation of ice increases in mass." ;
rdfs:subClassOf obo:ENVO_02500031 , obo:ENVO_03000009 .
obo:RBO_00000067 a rdfs:Class ;
rdfs:label "thorium" ;
rdfs:comment "A radioactive element of the actinide series of metals. It has an atomic symbol Th, atomic number 90, and atomic weight 232.04. It is used as fuel in nuclear reactors to produce fissionable uranium isotopes. Because of its radioopacity, various thorium compounds are used to facilitate visualization in roentgenography." ;
rdfs:subClassOf obo:RBO_00000061 .
obo:ENVO_01001170 a rdfs:Class ;
rdfs:label "active ecosystem management process"@en ;
rdfs:comment "A process during which an ecosystem, its parts, or the processes it participates in are modified by human intervention to accomplish an objective." ;
rdfs:subClassOf obo:ENVO_02500026 , obo:ENVO_02500027 .
obo:RBO_00000073 a rdfs:Class ;
rdfs:label "radiation response modifier" ;
rdfs:comment "Radiation response modifiers are agents that alter tumor or normal tissue response to radiation, such as radiation sensitizers and radiation protectors. " ;
rdfs:subClassOf obo:CHEBI_24432 .
obo:ENVO_01000433 a rdfs:Class ;
rdfs:label "needleleaf forest" ;
rdfs:comment "A class created to group GFM 2000 terms by the dominant vegetation type. Definitions pending." ;
rdfs:subClassOf obo:ENVO_01001243 .
obo:BFO_0000030 a rdfs:Class ;
rdfs:label "object"@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:ENVO_01000314 a rdfs:Class ;
rdfs:label "high osmolarity environment" ;
rdfs:comment "A high osmolarity environment is an environment in which entities are exposed to high concentrations of solutes." ;
rdfs:subClassOf obo:ENVO_01000997 .
obo:ENVO_01000515 a rdfs:Class ;
rdfs:label "tiled building roof" ;
rdfs:comment "A tile building roof is a building roof that is built using tiles." ;
rdfs:subClassOf obo:ENVO_01000472 .
obo:RBO_00002008 a rdfs:Class ;
rdfs:label "planned anthropogenic radiation exposure" ;
rdfs:comment "Planned exposure to radiation generated through a device or exposure to a source emitting ionising radiation" ;
rdfs:subClassOf obo:OBI_0000011 , obo:RBO_00002007 .
obo:UO_0000061 a rdfs:Class ;
rdfs:label "unit of molarity" ;
rdfs:comment "\"A concentration unit which is a standard measure of the number of moles of a given substance per liter of solution.\" [UOC:GVG]" ;
rdfs:subClassOf obo:UO_0000051 .
obo:CHEBI_30217 a rdfs:Class ;
rdfs:label "helium atom" ;
rdfs:subClassOf obo:CHEBI_33309 , obo:CHEBI_33559 .
obo:CHEBI_24833 a rdfs:Class ;
rdfs:label "oxoacid" ;
rdfs:comment "A compound which contains oxygen, at least one other element, and at least one hydrogen bound to oxygen, and which produces a conjugate base by loss of positive hydrogen ion(s) (hydrons)." ;
rdfs:subClassOf obo:CHEBI_24651 .
obo:RBO_00002124 a rdfs:Class ;
rdfs:label "anthropogenic environment monitoring" ;
rdfs:comment "Monitoring within a man-made or constructed environment" ;
rdfs:subClassOf obo:ENVO_02500041 .
obo:SDDO_3000047 a rdfs:Class ;
rdfs:label "assay"@en ;
rdfs:comment "An assay is an investigative (analytic) procedure for qualitatively assessing or quantitatively measuring the presence, amount, or functional activity of a target entity." .
obo:SDDO_3000017 a rdf:Property ;
rdfs:label "createdBy"@en ;
rdfs:range .
obo:SDDO_3000024 a rdf:Property ;
rdfs:label "capableOfIdentifying"@en ;
rdfs:range .
obo:SDDO_3000026 a rdf:Property ;
rdfs:label "capableOfDetecting"@en ;
rdfs:range .
obo:NCBITaxon_314146 a rdfs:Class ;
rdfs:label "Euarchontoglires" ;
rdfs:subClassOf obo:NCBITaxon_1437010 .
obo:ENVO_00002008 a rdfs:Class ;
rdfs:label "dust" ;
rdfs:comment "Particulate environmental material with diameters less than 500 micrometers."@en ;
rdfs:subClassOf obo:ENVO_01000060 , obo:ENVO_01000814 .
obo:ENVO_09000027 a rdfs:Class ;
rdfs:label "concentration of salt in soil" ;
rdfs:comment "The concentration of a salt when measured in soil." ;
rdfs:subClassOf obo:PATO_0000033 .
obo:GO_0006974 a rdfs:Class ;
rdfs:label "DNA damage response" ;
rdfs:comment "Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism." ;
rdfs:subClassOf obo:GO_0033554 .
obo:UO_0000262 a rdfs:Class ;
rdfs:label "electrical conduction unit" ;
rdfs:comment "\"A unit which represents a standard measurement of the movement of electrically charged particles through a transmission medium (electrical conductor).\" [UOC:GVG]" ;
rdfs:subClassOf obo:UO_0000261 .
obo:ENVO_03000110 a rdfs:Class ;
rdfs:label "cryoform"@en ;
rdfs:comment "A solid astronomical body part which is primarily composed of a continuous mass of snow and/or ice." ;
rdfs:subClassOf obo:ENVO_00000191 .
obo:RBO_00005056 a rdfs:Class ;
rdfs:label "Titanium-48 nucleus" ;
rdfs:comment "An atomic nucleus with 22 protons and 26 neutrons " ;
rdfs:subClassOf obo:RBO_010012 .
obo:UO_1000228 a rdfs:Class ;
rdfs:label "tesla based unit" ;
rdfs:subClassOf obo:UO_0000227 .
obo:UBERON_0000000 a rdfs:Class ;
rdfs:subClassOf obo:BFO_0000003 .
obo:RBO_00005016 a rdfs:Class ;
rdfs:label "radiation fractionation protocol" ;
rdfs:comment "A protocol for administering a total radiation dose in two or more increments separated by a specified time interval" ;
rdfs:subClassOf obo:IAO_0000104 .
obo:ENVO_01000804 a rdfs:Class ;
rdfs:label "astronomical object"@en ;
rdfs:comment "An object which is composed of one or more gravitationally bound structures that are associated with a position in space." ;
rdfs:subClassOf obo:BFO_0000030 .
obo:ENVO_01000541 a rdfs:Class ;
rdfs:label "thermosphere" ;
rdfs:comment "The thermosphere is a part of the earth's atmosphere that begins at about 50 miles (80 kilometers) above the earth's surface, extends to outer space, and is characterized by steadily increasing temperature with height" ;
rdfs:subClassOf obo:ENVO_01000543 .
obo:RBO_00000129 a rdfs:Class ;
rdfs:label "Nb-93 ion radiation" ;
rdfs:comment "Atomic nuclei, each with 41 protons and 52 neutrons with kinetic energy imparted by natural or artificial means such as by a particle accelerator" ;
rdfs:subClassOf obo:RBO_00005001 .
obo:RBO_00005018 a rdfs:Class ;
rdfs:label "lunar orbit" ;
rdfs:comment "A region of space defined by a regular, repeating path of a specified object about Earth's moon" ;
rdfs:subClassOf obo:RBO_00000016 .
obo:ENVO_01001305 a rdfs:Class ;
rdfs:label "vegetated area" ;
rdfs:comment "A vegetated area is a geographic feature which has ground cover dominated by plant communities." ;
rdfs:subClassOf obo:ENVO_01001199 .
obo:CHEBI_51422 a rdfs:Class ;
rdfs:label "organodiyl group" ;
rdfs:comment "Any organic substituent group, regardless of functional type, having two free valences at carbon atom(s)." ;
rdfs:subClassOf obo:CHEBI_51446 .
obo:SLSO_0000055 a rdfs:Class ;
rdfs:label "space flight" ;
rdfs:comment "Activity carried out by crewed or robotic vehicles outside the Earth's atmmosphere." .
obo:CHEBI_36587 a rdfs:Class ;
rdfs:label "organic oxo compound" ;
rdfs:comment "Organic compounds containing an oxygen atom, =O, doubly bonded to carbon or another element." ;
rdfs:subClassOf obo:CHEBI_72695 .
obo:UO_1000036 a rdfs:Class ;
rdfs:label "year based unit" ;
rdfs:subClassOf obo:UO_0000003 .
obo:CHEBI_25362 a rdfs:Class ;
rdfs:label "elemental molecule" ;
rdfs:comment "A molecule all atoms of which have the same atomic number." ;
rdfs:subClassOf obo:CHEBI_25367 , obo:CHEBI_33259 .
obo:RBO_00002065 a rdfs:Class ;
rdfs:label "mathematical modelling study" ;
rdfs:comment "Study concerned with the construction, analysis, evaluation, refinement etc. of mathematical or statistical models of the properties or behaviour of a set of entities, such as molecules, physiological processes, environmental processes such as nuclide transfer, such that functions are developed to reliably predict the behaviour of those entities." ;
rdfs:subClassOf obo:RBO_00002021 .
obo:BFO_0000182 a rdfs:Class ;
rdfs:label "history"@en ;
rdfs:subClassOf obo:BFO_0000015 .
obo:ENVO_01001048 a rdfs:Class ;
rdfs:label "sediment environment"@en ;
rdfs:comment "An environmental system which has its properties and dynamics determined by sediment." ;
rdfs:subClassOf obo:ENVO_01000997 , obo:ENVO_01000998 .
obo:RBO_00005005 a rdfs:Class ;
rdfs:label "Silicon-28 nucleus" ;
rdfs:comment "An atomic nucleus with 14 protons and 14 neutrons " ;
rdfs:subClassOf obo:RBO_010012 .
obo:CHEBI_33695 a rdfs:Class ;
rdfs:label "information biomacromolecule" ;
rdfs:subClassOf obo:CHEBI_33694 .
obo:CHEBI_37176 a rdfs:Class ;
rdfs:label "mononuclear parent hydride" ;
rdfs:subClassOf obo:CHEBI_33692 .
obo:RBO_00002109 a rdfs:Class ;
rdfs:label "building radiological safety study" ;
rdfs:comment "Studies on radiological safety within buildings. Primary purpose os for buildings not specifially designed to hold radioactive materials but anaylyis and mitigation of risks from radioactive exposure from the local environment or materials." ;
rdfs:subClassOf obo:RBO_00002071 .
obo:OBI_0000023 a rdfs:Class ;
rdfs:label "classified data set"@en ;
rdfs:comment "A data set that is produced as the output of a class prediction data transformation and consists of a data set with assigned class labels."@en ;
rdfs:subClassOf obo:IAO_0000100 .
obo:RBO_00000012 a rdfs:Class ;
rdfs:label "passive dosimeter" ;
rdfs:comment "A radiation measuring device which integrates the amount of radiation to which it is exposed. Passive detectors are interrogated at a later time to determine the dose." ;
rdfs:subClassOf obo:RBO_00000115 .
obo:UO_1010035 a rdfs:Class ;
rdfs:label "stone based unit" ;
rdfs:subClassOf obo:UO_0000002 .
obo:ENVO_01001687 a rdfs:Class ;
rdfs:label "mass of solid material"@en ;
rdfs:comment "An mass of environmental material which is composed primarily of a solid environmental material"@en ;
rdfs:subClassOf obo:ENVO_01001686 .
obo:ENVO_03000143 a rdfs:Class ;
rdfs:label "cryosphere"@en ;
rdfs:comment "An astronomical body part which is composed primarily of environmental materials in their frozen form."@en ;
rdfs:subClassOf obo:ENVO_01000813 .
obo:PO_0025029 a rdfs:Class ;
rdfs:label "shoot axis" ;
rdfs:comment "A plant axis (PO:0025004) that is part of a shoot system (PO:0009006)." ;
rdfs:subClassOf obo:PO_0025004 .
obo:PATO_0000117 a rdfs:Class ;
rdfs:label "size" ;
rdfs:comment "A morphology quality inhering in a bearer by virtue of the bearer's physical magnitude." ;
rdfs:subClassOf obo:PATO_0000051 .
obo:ENVO_00000191 a rdfs:Class ;
rdfs:label "solid astronomical body part" ;
rdfs:comment "A part of an astronomical body which is primarily composed of solid material."@en ;
rdfs:subClassOf obo:ENVO_01000813 , obo:ENVO_01001784 .
obo:BFO_0000006 a rdfs:Class ;
rdfs:label "spatial region"@en ;
rdfs:subClassOf obo:BFO_0000141 .
obo:RBO_00005034 a rdfs:Class ;
rdfs:label "high altitude research aircraft" ;
rdfs:comment "An aircraft which flies at altitudes greater than commercial aircraft altitudes for research purposes." ;
rdfs:subClassOf obo:ENVO_01001488 .
obo:ExO_0000038 a rdfs:Class ;
rdfs:label "health status" ;
rdfs:comment "The condition of an organism in all aspects (e.g., functional or metabolic efficiency)." ;
rdfs:subClassOf obo:ExO_0000089 .
a rdfs:Class ;
rdfs:label "Rolle"@da , "Role"@cs , "Role"@en , "Ruolo"@it , "Rol"@es ;
rdfs:comment "En rolle er den funktion en ressource eller aktør har i forhold til en anden ressource, i forbindelse med ressourcekreditering eller ressourcerelationer."@da , "Role je funkce zdroje či agenta ve vztahu k jinému zdroji, v kontextu přiřazení zdrojů či vztahů mezi zdroji."@cs , "A role is the function of a resource or agent with respect to another resource, in the context of resource attribution or resource relationships."@en , "Un ruolo è la funzione di una risorsa o di un agente rispetto ad un'altra risorsa, nel contesto dell'attribuzione delle risorse o delle relazioni tra risorse."@it , "Un rol es la función de un recurso o agente con respecto a otro recuros, en el contexto de atribución del recurso o de las relaciones entre recursos."@es ;
rdfs:seeAlso ;
rdfs:subClassOf .
obo:RBO_00015007 a rdfs:Class ;
rdfs:label "nanodosimetric measurement datum" ;
rdfs:comment "Measurement of the pattern (frequency and spatial distribution) of ionization events produced by energy deposition in time and space in a substance characterized by linear dimensions of the order of 1-100 nanometers" ;
rdfs:subClassOf obo:RBO_010016 .
obo:RBO_00000028 a rdfs:Class ;
rdfs:label "solar cosmic radiation" ;
rdfs:comment "Solar cosmic radiation is high-energy charged particles that originate from the sun." ;
rdfs:subClassOf obo:RBO_00000026 .
obo:OBI_0000457 a rdfs:Class ;
rdfs:label "manufacturing"@en ;
rdfs:comment "Manufacturing is a process with the intent to produce a processed material which will have a function for future use. A person or organization (having manufacturer role) is a participant in this process"@en ;
rdfs:subClassOf obo:OBI_0000094 .
obo:UO_0000129 a rdfs:Class ;
rdfs:label "absorbed dose unit" ;
rdfs:comment "\"A unit which is a standard measure of the energy imparted by ionizing radiation to unit mass of matter such as tissue.\" [DEFRA:DEFRA]" ;
rdfs:subClassOf obo:UO_0000127 .
obo:ENVO_01001788 a rdfs:Class ;
rdfs:label "marine ecosystem"@en ;
rdfs:subClassOf obo:ENVO_01000320 , obo:ENVO_01001787 .
obo:ENVO_01001827 a rdfs:Class ;
rdfs:label "climactic ecological succession"@en ;
rdfs:comment "An ecological succession process during which 1) organisms in ecological communities possess high adaptation to the conditions in the ecosystem, 2) participant communities largely fill available niches, 3) individual organisms are typically replaced by others of the same species, 4) a near equilibrium is maintained between gross primary production and total respiration and across biogeochemical cycles."@en ;
rdfs:subClassOf obo:ENVO_01001824 .
obo:RBO_00002051 a rdfs:Class ;
rdfs:label "radiation based diagnostics study" ;
rdfs:comment "Study on the efficacy, outcomes and adverse consequences of exposure to medical diagnostic procedures using internal or external irradiation." ;
rdfs:subClassOf obo:RBO_00002017 .
obo:UO_1000313 a rdfs:Class ;
rdfs:label "relative luminescence unit based unit" .
obo:RBO_00002117 a rdfs:Class ;
rdfs:label "irradiation" ;
rdfs:comment "An energy transfer process in which energy in the form of particles or waves is transferred from one entity to another" ;
rdfs:subClassOf obo:ENVO_01001852 .
obo:OBI_0000047 a rdfs:Class ;
rdfs:label "processed material"@en ;
rdfs:comment "Is a material entity that is created or changed during material processing."@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:ENVO_01001054 a rdfs:Class ;
rdfs:label "non-saline aerosol environment"@en ;
rdfs:comment "An environmental system which has its properties and dynamics determined by an aerosol with a low concentration of dissolved solutes." ;
rdfs:subClassOf obo:ENVO_01001052 .
obo:ENVO_01000798 a rdfs:Class ;
rdfs:label "plasma"@en ;
rdfs:comment "A material entity which is composed of a volume of unbound positive and negative particles in roughly equal numbers, conducts electricity, and possesses internal magnetic fields." ;
rdfs:subClassOf obo:ENVO_02000140 .
obo:ENVO_02000140 a rdfs:Class ;
rdfs:label "fluid environmental material"@en ;
rdfs:comment "An environmental material which is unable to resist shear forces and continuously deforms when subject to them."@en ;
rdfs:subClassOf obo:ENVO_00010483 .
obo:ENVO_02000097 a rdfs:Class ;
rdfs:label "gold ore" ;
rdfs:subClassOf obo:ENVO_02000094 .
obo:ENVO_01000358 a rdfs:Class ;
rdfs:label "acidic water" ;
rdfs:comment "A portion of acidic water is a portion of water with a pH less than 7." ;
rdfs:subClassOf obo:ENVO_00002006 .
obo:RBO_00015001 a rdfs:Class ;
rdfs:label "neutral particle radiation" ;
rdfs:comment "Uncharged particles with kinetic energy imparted by natural or artificial means (such as by a particle accelerator)" ;
rdfs:subClassOf obo:RBO_00015000 .
obo:RBO_00002076 a rdfs:Class ;
rdfs:label "radionuclide dispersal modelling study" ;
rdfs:comment "Mathematical modelling of radionuclide transfer and dispersal processes in water, earth or air, either directly or through the mediation of biota." ;
rdfs:subClassOf obo:RBO_00002022 .
obo:PATO_0001018 a rdfs:Class ;
rdfs:label "physical quality" ;
rdfs:comment "A quality of a physical entity that exists through action of continuants at the physical level of organisation in relation to other entities." ;
rdfs:subClassOf obo:PATO_0001241 .
obo:UO_1000106 a rdfs:Class ;
rdfs:label "hertz based unit" ;
rdfs:subClassOf obo:UO_0000105 .
a rdfs:Class ;
rdfs:label "Name"@en ;
rdfs:comment "To specify the components of the name of the object"@en .
obo:OBI_0000835 a rdfs:Class ;
rdfs:label "manufacturer" ;
rdfs:comment "A person or organization that has a manufacturer role" ;
rdfs:subClassOf obo:BFO_0000040 .
obo:RBO_00000095 a rdfs:Class ;
rdfs:label "chronic external exposure study" ;
rdfs:comment "A study of the effects of external irradiation on an organism where the dose is given over a protracted time period either continuously or in many fractions. Often these are lose dose studies." ;
rdfs:subClassOf obo:RBO_00000091 .
obo:ENVO_01001852 a rdfs:Class ;
rdfs:label "energy transfer process"@en ;
rdfs:comment "A process during which one entity loses energy to another entity." ;
rdfs:subClassOf obo:ENVO_02500000 .
obo:RBO_00000088 a rdfs:Class ;
rdfs:label "dna damage and repair study" ;
rdfs:comment "A study of the mechanism or effects of radiation on dna damage and its repair." ;
rdfs:subClassOf obo:RBO_00000082 .
a rdfs:Class ;
rdfs:label "EmployeeRole"@en ;
rdfs:comment "A subclass of OrganizationRole used to describe employee relationships."@en ;
rdfs:subClassOf .
a rdf:Property ;
rdfs:label "numberedPosition"@en ;
rdfs:comment "A number associated with a role in an organization, for example, the number on an athlete's jersey."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "namedPosition"@en ;
rdfs:comment "A position played, performed or filled by a person or organization, as part of an organization. For example, an athlete in a SportsTeam might play in the position named 'Quarterback'."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "roleName"@en ;
rdfs:comment "A role played, performed or filled by a person or organization. For example, the team of creators for a comic book might fill the roles named 'inker', 'penciller', and 'letterer'; or an athlete in a SportsTeam might play in the position named 'Quarterback'."@en ;
rdfs:range .
obo:ENVO_04000008 a rdfs:Class ;
rdfs:label "soil organic matter"@en ;
rdfs:comment "Organic material in soil, which consists of plant and animal residues at various stages of decomposition, cells and tissues of soil organisms, and substances synthesized by soil organisms." ;
rdfs:subClassOf obo:ENVO_01000155 , obo:ENVO_01000813 .
obo:UO_1000099 a rdfs:Class ;
rdfs:label "liter based unit" ;
rdfs:subClassOf obo:UO_0000095 .
obo:UBERON_0007376 a rdfs:Class ;
rdfs:label "outer epithelium" ;
rdfs:comment "The epidermis is the entire outer epithelial layer of an animal, it may be a single layer that produces an extracellular material (e.g. the cuticle of arthropods) or a complex stratified squamous epithelium, as in the case of many vertebrate species[GO]." ;
rdfs:subClassOf obo:UBERON_0003102 , obo:UBERON_0010371 .
obo:ENVO_01000858 a rdfs:Class ;
rdfs:label "marine upwelling biome"@en ;
rdfs:comment "A marine biome which contains communities adapted to living in an environment determined by an upwelling process." ;
rdfs:subClassOf obo:ENVO_00000447 .
obo:ENVO_01001192 a rdfs:Class ;
rdfs:label "sediment surface"@en ;
rdfs:comment "The surface layer of a mass of sediment." ;
rdfs:subClassOf obo:ENVO_00010504 .
obo:ENVO_01000958 a rdfs:Class ;
rdfs:label "terrestrial planet"@en ;
rdfs:comment "A planet that is composed primarily of silicate rocks or metals." ;
rdfs:subClassOf obo:ENVO_01000800 .
obo:ENVO_01000179 a rdfs:Class ;
rdfs:label "desert biome" ;
rdfs:comment "A desert ecosystem which is undergoing climactic ecological succession."@en ;
rdfs:subClassOf obo:ENVO_00000428 , obo:ENVO_01001780 .
obo:ENVO_01000417 a rdfs:Class ;
rdfs:label "house" ;
rdfs:comment "A house is a building that provides a dwelling-place for a living entity." ;
rdfs:subClassOf obo:ENVO_00000073 .
obo:UO_0000003 a rdfs:Class ;
rdfs:label "time unit" ;
rdfs:comment "A unit which is a standard measure of the dimension in which events occur in sequence." ;
rdfs:subClassOf obo:IAO_0000003 , obo:UO_0000000 .
obo:ENVO_2000013 a rdfs:Class ;
rdfs:label "generation of energy from coal" ;
rdfs:subClassOf obo:ENVO_2000012 .
obo:ENVO_01000624 a rdfs:Class ;
rdfs:label "hydrological condensation process"@en ;
rdfs:comment "Hydrological condensation is a process in which atmospheric water vapour undergoes a phase transition from the gas phase to the liquid phase." ;
rdfs:subClassOf obo:ENVO_01000724 , obo:ENVO_02500031 .
obo:ENVO_04000004 a rdfs:Class ;
rdfs:label "concentration of carbon dioxide in air"@en ;
rdfs:comment "The concentration of carbon dioxide when measured in air." ;
rdfs:subClassOf obo:PATO_0000033 .
obo:PATO_0000973 a rdfs:Class ;
rdfs:label "porosity" ;
rdfs:comment "A structure quality inhering in a bearer by virtue of the bearer's disposition to admit the passage of gas or liquid through pores or interstices." ;
rdfs:subClassOf obo:PATO_0000141 .
obo:UBERON_0005423 a rdfs:Class ;
rdfs:label "developing anatomical structure" ;
rdfs:subClassOf obo:UBERON_0000465 .
obo:CHEBI_33958 a rdfs:Class ;
rdfs:label "halide salt" ;
rdfs:subClassOf obo:CHEBI_24866 , obo:CHEBI_37578 .
obo:UO_1000245 a rdfs:Class ;
rdfs:label "kibibyte based unit" ;
rdfs:subClassOf obo:UO_0000231 .
obo:SLSO_0000021 a rdfs:Class ;
rdfs:label "space life sciences dataset" ;
rdfs:comment "A data product that is an aggregate of data items of the same type that have something in common. Averages and distributions can be determined for data sets." ;
rdfs:subClassOf obo:IAO_0000100 , obo:SDDO_3000051 , obo:T4FS_0000347 .
obo:SLSO_0000015 a rdf:Property ;
rdfs:label "owned by" ;
rdfs:range .
obo:SLSO_0001061 a rdf:Property ;
rdfs:label "dataset availability" ;
rdfs:comment "This value denotes whether a dataset is available for download on the public site. Datasets are either available for download on-line, or available off-line in hardcopy form." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001108 a rdf:Property ;
rdfs:label "review" ;
rdfs:comment "Programmatic, or data acquisition or data quality information regarding this dataset." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001118 a rdf:Property ;
rdfs:label "data collection site" ;
rdfs:comment "Physical location where the data was collected" ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001121 a rdf:Property ;
rdfs:label "hardware_name" ;
rdfs:comment "The mechanical equipment component used." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001049 a rdf:Property ;
rdfs:label "dataset catalog id" ;
rdfs:comment " This alphanumeric string is generated at data acquisition, and is used to uniquely identify the dataset." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001120 a rdf:Property ;
rdfs:label "processing level" ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001056 a rdf:Property ;
rdfs:label "release date" ;
rdfs:comment "Date when data are released (usually by the PI) to the archive, or released to go on the public Website." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001123 a rdf:Property ;
rdfs:label "dataset medium" ;
rdfs:comment "The physical or digital form in which the data are available." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001122 a rdf:Property ;
rdfs:label "data source" ;
rdfs:comment "Describes the information, in terms of the group responsible for collecting and/or providing the data." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001119 a rdf:Property ;
rdfs:label "protocol approach" ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:ENVO_01000773 a rdfs:Class ;
rdfs:label "village"@en ;
rdfs:comment "A village is a clustered human settlement or community, larger than a hamlet but smaller than a town, with a population ranging from a few hundred to a few thousand. Though often located in rural areas, the term urban village is also applied to certain urban neighbourhoods. Villages are normally permanent, with fixed dwellings; however, transient villages can occur. Further, the dwellings of a village are fairly close to one another, not scattered broadly over the landscape, as a dispersed settlement." ;
rdfs:subClassOf obo:ENVO_01001829 .
obo:GO_0016740 a rdfs:Class ;
rdfs:label "transferase activity" ;
rdfs:subClassOf obo:GO_0003824 .
obo:RBO_00000118 a rdfs:Class ;
rdfs:label "risk estimate" ;
rdfs:subClassOf obo:OBI_0001909 .
obo:OBI_0000124 a rdf:Property ;
rdfs:label "is_supported_by_data" ;
rdfs:comment "The relation between a data item and a conclusion where the conclusion is the output of a data interpreting process and the data item is used as an input to that process" ;
rdfs:domain obo:OBI_0001909 ;
rdfs:range obo:IAO_0000027 .
obo:CHEBI_33306 a rdfs:Class ;
rdfs:label "carbon group element atom" ;
rdfs:subClassOf obo:CHEBI_33560 .
obo:CHEBI_33583 a rdfs:Class ;
rdfs:label "noble gas molecular entity" ;
rdfs:comment "A main group molecular entity containing one or more atoms of any noble gas." ;
rdfs:subClassOf obo:CHEBI_33579 .
obo:RBO_00002084 a rdfs:Class ;
rdfs:label "mining study" ;
rdfs:comment "Study of the process, regulation and monitoring of mines where exposure to naturally occurring radiation presents an occupational hazard for workers or the process itself, for example run off water or spoil, constitutes an environmental hazard." ;
rdfs:subClassOf obo:RBO_00002023 .
obo:CHMO_0000993 a rdfs:Class ;
rdfs:label "portion of material" ;
rdfs:comment "An independent material continuant that is self-connected and retains its identity over time." ;
rdfs:subClassOf obo:BFO_0000040 .
obo:ENVO_01001451 a rdfs:Class ;
rdfs:label "usage of an environment for business"@en ;
rdfs:comment "A planned environmental usage process during which an environment supports facilities associated with commerce or the earning of a livelihood through means other than manufacturing or the provision of a public service." ;
rdfs:subClassOf obo:ENVO_01001436 .
obo:ENVO_01000793 a rdfs:Class ;
rdfs:label "atmospheric wind"@en ;
rdfs:subClassOf obo:ENVO_01000792 , obo:ENVO_02500003 .
obo:RO_0000053 a rdf:Property ;
rdfs:label "has characteristic"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence" ;
rdfs:range obo:BFO_0000020 .
obo:ENVO_01000247 a rdfs:Class ;
rdfs:label "rangeland biome" ;
rdfs:comment "A rangeland biome is an anthropogenic terrestrial biome which is primarily used for the rearing and grazing of livestock." ;
rdfs:subClassOf obo:ENVO_01000219 .
obo:ExO_0000033 a rdfs:Class ;
rdfs:label "human population" ;
rdfs:comment "An exposure_receptor that is a group of Homo sapiens inhabiting a given area." ;
rdfs:subClassOf obo:ExO_0000001 .
obo:CHEBI_60466 a rdfs:Class ;
rdfs:label "peptide zwitterion" ;
rdfs:comment "Zwitterionic form of any peptide where, in general, the amino terminus is positively charged and the carboxy terminus is negatively charged." ;
rdfs:subClassOf obo:CHEBI_27369 .
a rdf:Property ;
rdfs:label "is tautomer of" ;
rdfs:range .
obo:SLSO_0000039 a rdfs:Class ;
rdfs:label "publication document" ;
rdfs:comment "NCIt Definition: A printed or electronic work offered for distribution. MSH Definition: Copies of a work or document distributed to the public by sale, rental, lease, or lending. (From ALA Glossary of Library and Information Science, 1983, p181) CSP Definition: copy or copies of a document offered for distribution; includes the preparation of the documented material." ;
rdfs:subClassOf obo:SLSO_0000028 .
obo:SLSO_0001131 a rdf:Property ;
rdfs:label "s3 file GUID" ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001124 a rdf:Property ;
rdfs:label "creator" ;
rdfs:comment "An entity responsible for making the resource." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001067 a rdf:Property ;
rdfs:label "document title" ;
rdfs:comment "Typically, a Title will be a name by which the resource is formally known. cf IAO:0000305 document title as a class" ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001127 a rdf:Property ;
rdfs:label "publication date" ;
rdfs:comment "Date (often a range) that the resource will become or did become available." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001126 a rdf:Property ;
rdfs:label "location (archive/request)" ;
rdfs:comment "NASA center or other location where the document is archived; for hardcopy documents, this field also indicates where the document can be ordered" ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001129 a rdf:Property ;
rdfs:label "type" ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001094 a rdf:Property ;
rdfs:label "document description" ;
rdfs:comment "An account of the content of the resource." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001130 a rdf:Property ;
rdfs:label "document availability" ;
rdfs:comment "Access restrictions for ordering/receiving the archived document. " ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001132 a rdf:Property ;
rdfs:label "document filename" ;
rdfs:comment "File name for document available for online." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001054 a rdf:Property ;
rdfs:label "document number" ;
rdfs:comment "Original document number assigned by the JSC or ARC project, mission level offices, or headquarters level offices. For publication citations only, this is a number generated by the SQL database." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:PATO_0000992 a rdfs:Class ;
rdfs:label "viscosity" ;
rdfs:comment "A physical quality of a fluid inhering in a bearer by virtue of the bearer's disposition to internal resistance to flow." ;
rdfs:subClassOf obo:PATO_0001548 .
obo:PO_0009011 a rdfs:Class ;
rdfs:label "plant structure" ;
rdfs:comment "A plant anatomical entity (PO:0025131) that is, or was, part of a plant, or was derived from a part of a plant." ;
rdfs:subClassOf obo:PO_0025131 .
obo:ENVO_06105205 a rdfs:Class ;
rdfs:label "compacted soil"@en ;
rdfs:comment "A soil which has a high bulk density and/or a low porosity. A compacted soil has a reduced rate of both water infiltration and drainage"@en ;
rdfs:subClassOf obo:ENVO_00001998 .
obo:PATO_0002300 a rdfs:Class ;
rdfs:label "increased quality" ;
rdfs:comment "A quality that has a value that is increased compared to normal or average." ;
rdfs:subClassOf obo:PATO_0000069 .
obo:PATO_0000957 a rdfs:Class ;
rdfs:label "opacity" ;
rdfs:comment "An optical quality which obtains by virtue of the ability of the bearer to absorb visible light." ;
rdfs:subClassOf obo:PATO_0001300 .
obo:ENVO_00002116 a rdfs:Class ;
rdfs:label "contaminated soil" ;
rdfs:comment "A portion of contaminated soil is a portion of soil with elevated levels of some contaminant." ;
rdfs:subClassOf obo:ENVO_00003082 .
obo:SLSO_0000054 a rdfs:Class ;
rdfs:label "suborbital space flight vehicle" ;
rdfs:comment "A vehicle which traverses or is capable of traversing the boundary between the atmosphere and space without reaching low earth orbit." ;
rdfs:subClassOf obo:SLSO_0000032 .
obo:ENVO_01001620 a rdfs:Class ;
rdfs:label "mass of ice and snow"@en ;
rdfs:comment "A object which is composed primarily of water-based snow and ice." ;
rdfs:subClassOf obo:ENVO_01000293 , obo:ENVO_01001691 .
obo:ENVO_01001570 a rdfs:Class ;
rdfs:label "terrestrial ecoregion"@en ;
rdfs:comment "An ecoregion which is located on a landmass." ;
rdfs:subClassOf obo:ENVO_01000276 .
obo:ENVO_01001682 a rdfs:Class ;
rdfs:label "air mass"@en ;
rdfs:comment "An object which is composed of a continuous mass of air." ;
rdfs:subClassOf obo:ENVO_01001689 .
obo:OBI_0000968 a rdfs:Class ;
rdfs:label "device" ;
rdfs:comment "A material entity that is designed to perform a function in a scientific investigation, but is not a reagent." ;
rdfs:subClassOf obo:CHMO_0000993 , obo:ENVO_00003074 , obo:OBI_0000047 .
obo:NCBITaxon_8287 a rdfs:Class ;
rdfs:label "Sarcopterygii" ;
rdfs:subClassOf obo:NCBITaxon_117571 .
obo:PATO_0002253 a rdfs:Class ;
rdfs:label "platelike" ;
rdfs:comment "A quality inhering in a bearer by virtue of the bearer's being roundish, flattish shape, possibly with a slightly angled edge." ;
rdfs:subClassOf obo:PATO_0000407 .
obo:ENVO_09200035 a rdfs:Class ;
rdfs:label "porosity of water ice" ;
rdfs:comment "The porosity of some water ice." ;
rdfs:subClassOf obo:PATO_0000973 .
obo:UO_1000264 a rdfs:Class ;
rdfs:label "siemens based unit" ;
rdfs:subClassOf obo:UO_0000262 .
obo:RBO_010020 a rdfs:Class ;
rdfs:label "tissue equivalence" ;
rdfs:comment "Denotes a substance with absorbing and scattering properties for a given radiation that sufficiently match those of a particular biological tissue." ;
rdfs:subClassOf obo:PATO_0001018 .
obo:CARO_0000000 a rdfs:Class .
obo:RO_0002226 a rdf:Property ;
rdfs:label "develops in"@en ;
rdfs:comment "x develops_in y if x is located in y whilst x is developing" ;
rdfs:domain obo:CARO_0000000 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002258 .
obo:RO_0002254 a rdf:Property ;
rdfs:label "has developmental contribution from"@en ;
rdfs:comment "x has developmental contribution from y iff x has some part z such that z develops from y"@en ;
rdfs:domain obo:CARO_0000000 ;
rdfs:range obo:CARO_0000000 ;
rdfs:subPropertyOf obo:RO_0002258 .
obo:RO_0002384 a rdf:Property ;
rdfs:label "has developmental potential involving"@en ;
rdfs:comment "x has developmental potential involving y iff x is capable of a developmental process with output y. y may be the successor of x, or may be a different structure in the vicinity (as for example in the case of developmental induction)."@en ;
rdfs:domain obo:CARO_0000000 ;
rdfs:range obo:CARO_0000000 ;
rdfs:subPropertyOf obo:RO_0002324 .
obo:UO_1000027 a rdfs:Class ;
rdfs:label "degree Celsius based unit" ;
rdfs:subClassOf obo:UO_0000005 .
obo:CHEBI_36902 a rdfs:Class ;
rdfs:label "chalcogen hydride" ;
rdfs:subClassOf obo:CHEBI_33242 , obo:CHEBI_33304 .
obo:ENVO_00002169 a rdfs:Class ;
rdfs:label "coal mine" ;
rdfs:subClassOf obo:ENVO_00000076 .
obo:CHEBI_24471 a rdfs:Class ;
rdfs:label "halogen molecular entity" ;
rdfs:subClassOf obo:CHEBI_33675 .
obo:ENVO_00005755 a rdfs:Class ;
rdfs:label "field soil" ;
rdfs:comment "Soil which is part of an agricultural field."@en ;
rdfs:subClassOf obo:ENVO_00001998 .
obo:ENVO_01000996 a rdfs:Class ;
rdfs:label "human-directed construction process"@en ;
rdfs:comment "An process during which natural or manufactured materials and products are processed and arranged by humans or their technology into structures." ;
rdfs:subClassOf obo:ENVO_02500027 , obo:OBI_0000011 .
a rdfs:Class ;
rdfs:label "Me"@en ;
rdfs:subClassOf .
obo:ENVO_01001439 a rdfs:Class ;
rdfs:label "marine mining"@en ;
rdfs:comment "A mining process which occurs in a marine ecosystem." ;
rdfs:subClassOf obo:ENVO_01001437 .
obo:UO_1000155 a rdfs:Class ;
rdfs:label "watt per square meter based unit" ;
rdfs:subClassOf obo:UO_0000154 .
obo:CHEBI_15841 a rdfs:Class ;
rdfs:label "polypeptide" ;
rdfs:comment "A peptide containing ten or more amino acid residues." ;
rdfs:subClassOf obo:CHEBI_16670 , obo:CHEBI_33839 .
obo:UO_1010014 a rdfs:Class ;
rdfs:label "yard based unit" ;
rdfs:subClassOf obo:UO_0000001 .
obo:ENVO_01000408 a rdfs:Class ;
rdfs:label "environmental zone" ;
rdfs:comment "A site which has its extent determined by the presence or influence of one or more components of an environmental system or the processes occurring therein." ;
rdfs:subClassOf obo:BFO_0000024 .
obo:RBO_010015 a rdfs:Class ;
rdfs:label "quality factor" ;
rdfs:comment "Dimensionless factor developed for purposes of radiation protection and assessing health risks in general terms that accounts for the relative biological effectiveness of different radiations in producing stochastic effects and is used to relate absorbed" ;
rdfs:subClassOf obo:OBI_0001909 .
obo:CHEBI_36586 a rdfs:Class ;
rdfs:label "carbonyl compound" ;
rdfs:comment "Any compound containing the carbonyl group, C=O. The term is commonly used in the restricted sense of aldehydes and ketones, although it actually includes carboxylic acids and derivatives." ;
rdfs:subClassOf obo:CHEBI_36587 , obo:CHEBI_36963 .
obo:RBO_00005012 a rdfs:Class ;
rdfs:label "ionizing radiation energy" ;
rdfs:comment "The kinetic energy carried by a particle or photon of ionizing radiation." ;
rdfs:subClassOf obo:RBO_00000116 .
obo:ENVO_01001794 a rdfs:Class ;
rdfs:label "temperate broadleaf forest"@en ;
rdfs:comment "A broadleaf forest which is subject to temperate climate conditions." ;
rdfs:subClassOf obo:ENVO_01000430 , obo:ENVO_01001805 .
obo:ENVO_00000501 a rdfs:Class ;
rdfs:label "submerged bed" ;
rdfs:comment "The portion of the ground surface which lies below water." ;
rdfs:subClassOf obo:ENVO_00000191 , obo:ENVO_01001311 , obo:ENVO_01001483 .
obo:RBO_00002021 a rdfs:Class ;
rdfs:label "study modality" ;
rdfs:comment "The specific manner, characteristic, pattern of application, or the employment of any technology, approach or formal procedure to implement the study plan to generate a study type." ;
rdfs:subClassOf obo:PATO_0001236 .
obo:PATO_0001411 a rdfs:Class ;
rdfs:label "structured" ;
rdfs:comment "A structural quality inhering in a bearer by virtue of the bearer's having distinct structure." ;
rdfs:subClassOf obo:PATO_0000141 .
obo:ENVO_01000724 a rdfs:Class ;
rdfs:label "condensation process"@en ;
rdfs:comment "Condensation is a process during which a gas undergoes a phase transition into a liquid." ;
rdfs:subClassOf obo:ENVO_01001510 .
obo:RBO_00002000 a rdfs:Class ;
rdfs:label "radiation exposure" ;
rdfs:comment "The process by which an entity is exposed to electromagnetic or acoustic radiation radiation energy internally or externally." ;
rdfs:subClassOf obo:ENVO_01001852 .
obo:RBO_00005049 a rdfs:Class ;
rdfs:label "Silver-107 nucleus" ;
rdfs:comment "An atomic nucleus with 47 protons and 60 neutrons " ;
rdfs:subClassOf obo:RBO_010012 .
obo:OBI_0000684 a rdfs:Class ;
rdfs:label "specimen collection objective" ;
rdfs:comment "A objective specification to obtain a material entity for potential use as an input during an investigation." ;
rdfs:subClassOf obo:IAO_0000005 .
a rdfs:Class ;
rdfs:label "Car"@en ;
rdfs:comment "A car is a wheeled, self-powered motor vehicle used for transportation."@en ;
rdfs:subClassOf .
a rdf:Property ;
rdfs:label "wheelbase"@en ;
rdfs:comment """The distance between the centers of the front and rear wheels.
Typical unit code(s): CMT for centimeters, MTR for meters, INH for inches, FOT for foot/feet"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "roofLoad"@en ;
rdfs:comment """The permitted total weight of cargo and installations (e.g. a roof rack) on top of the vehicle.
Typical unit code(s): KGM for kilogram, LBR for pound
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfAxles"@en ;
rdfs:comment """The number of axles.
Typical unit code(s): C62"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "fuelCapacity"@en ;
rdfs:comment """The capacity of the fuel tank or in the case of electric cars, the battery. If there are multiple components for storage, this should indicate the total of all storage of the same type.
Typical unit code(s): LTR for liters, GLL of US gallons, GLI for UK / imperial gallons, AMH for ampere-hours (for electrical vehicles)."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "modelDate"@en ;
rdfs:comment "The release date of a vehicle model (often used to differentiate versions of the same make and model)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleInteriorColor"@en ;
rdfs:comment "The color or color combination of the interior of the vehicle."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "fuelEfficiency"@en ;
rdfs:comment """The distance traveled per unit of fuel used; most commonly miles per gallon (mpg) or kilometers per liter (km/L).
- Note 1: There are unfortunately no standard unit codes for miles per gallon or kilometers per liter. Use unitText to indicate the unit of measurement, e.g. mpg or km/L.
- Note 2: There are two ways of indicating the fuel consumption, fuelConsumption (e.g. 8 liters per 100 km) and fuelEfficiency (e.g. 30 miles per gallon). They are reciprocal.
- Note 3: Often, the absolute value is useful only when related to driving speed (\"at 80 km/h\") or usage pattern (\"city traffic\"). You can use valueReference to link the value for the fuel economy to another value.
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleSeatingCapacity"@en ;
rdfs:comment """The number of passengers that can be seated in the vehicle, both in terms of the physical space available, and in terms of limitations set by law.
Typical unit code(s): C62 for persons."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "weightTotal"@en ;
rdfs:comment """The permitted total weight of the loaded vehicle, including passengers and cargo and the weight of the empty vehicle.
Typical unit code(s): KGM for kilogram, LBR for pound
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "bodyType"@en ;
rdfs:comment "Indicates the design and body style of the vehicle (e.g. station wagon, hatchback, etc.)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "payload"@en ;
rdfs:comment """The permitted weight of passengers and cargo, EXCLUDING the weight of the empty vehicle.
Typical unit code(s): KGM for kilogram, LBR for pound
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "mileageFromOdometer"@en ;
rdfs:comment """The total distance travelled by the particular vehicle since its initial production, as read from its odometer.
Typical unit code(s): KMT for kilometers, SMI for statute miles"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "seatingCapacity"@en ;
rdfs:comment """The number of persons that can be seated (e.g. in a vehicle), both in terms of the physical space available, and in terms of limitations set by law.
Typical unit code(s): C62 for persons"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleModelDate"@en ;
rdfs:comment "The release date of a vehicle model (often used to differentiate versions of the same make and model)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "fuelConsumption"@en ;
rdfs:comment """The amount of fuel consumed for traveling a particular distance or temporal duration with the given vehicle (e.g. liters per 100 km).
- Note 1: There are unfortunately no standard unit codes for liters per 100 km. Use unitText to indicate the unit of measurement, e.g. L/100 km.
- Note 2: There are two ways of indicating the fuel consumption, fuelConsumption (e.g. 8 liters per 100 km) and fuelEfficiency (e.g. 30 miles per gallon). They are reciprocal.
- Note 3: Often, the absolute value is useful only when related to driving speed (\"at 80 km/h\") or usage pattern (\"city traffic\"). You can use valueReference to link the value for the fuel consumption to another value.
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "meetsEmissionStandard"@en ;
rdfs:comment "Indicates that the vehicle meets the respective emission standard."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfForwardGears"@en ;
rdfs:comment """The total number of forward gears available for the transmission system of the vehicle.
Typical unit code(s): C62"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "steeringPosition"@en ;
rdfs:comment "The position of the steering wheel or similar device (mostly for cars)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "tongueWeight"@en ;
rdfs:comment """The permitted vertical load (TWR) of a trailer attached to the vehicle. Also referred to as Tongue Load Rating (TLR) or Vertical Load Rating (VLR).
Typical unit code(s): KGM for kilogram, LBR for pound
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "accelerationTime"@en ;
rdfs:comment """The time needed to accelerate the vehicle from a given start velocity to a given target velocity.
Typical unit code(s): SEC for seconds
- Note: There are unfortunately no standard unit codes for seconds/0..100 km/h or seconds/0..60 mph. Simply use \"SEC\" for seconds and indicate the velocities in the name of the QuantitativeValue, or use valueReference with a QuantitativeValue of 0..60 mph or 0..100 km/h to specify the reference speeds.
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "cargoVolume"@en ;
rdfs:comment """The available volume for cargo or luggage. For automobiles, this is usually the trunk volume.
Typical unit code(s): LTR for liters, FTQ for cubic foot/feet
Note: You can use minValue and maxValue to indicate ranges."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "dateVehicleFirstRegistered"@en ;
rdfs:comment "The date of the first registration of the vehicle with the respective public authorities."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "driveWheelConfiguration"@en ;
rdfs:comment "The drive wheel configuration, i.e. which roadwheels will receive torque from the vehicle's engine via the drivetrain."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleIdentificationNumber"@en ;
rdfs:comment "The Vehicle Identification Number (VIN) is a unique serial number used by the automotive industry to identify individual motor vehicles."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleEngine"@en ;
rdfs:comment "Information about the engine or engines of the vehicle."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleConfiguration"@en ;
rdfs:comment "A short text indicating the configuration of the vehicle, e.g. '5dr hatchback ST 2.5 MT 225 hp' or 'limited edition'."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "trailerWeight"@en ;
rdfs:comment """The permitted weight of a trailer attached to the vehicle.
Typical unit code(s): KGM for kilogram, LBR for pound
* Note 1: You can indicate additional information in the name of the QuantitativeValue node.
* Note 2: You may also link to a QualitativeValue node that provides additional information using valueReference.
* Note 3: Note that you can use minValue and maxValue to indicate ranges."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfAirbags"@en ;
rdfs:comment "The number or type of airbags in the vehicle."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfDoors"@en ;
rdfs:comment """The number of doors.
Typical unit code(s): C62"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleSpecialUsage"@en ;
rdfs:comment "Indicates whether the vehicle has been used for special purposes, like commercial rental, driving school, or as a taxi. The legislation in many countries requires this information to be revealed when offering a car for sale."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "acrissCode"@en ;
rdfs:comment "The ACRISS Car Classification Code is a code used by many car rental companies, for classifying vehicles. ACRISS stands for Association of Car Rental Industry Systems and Standards."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleTransmission"@en ;
rdfs:comment "The type of component used for transmitting the power from a rotating power source to the wheels or other relevant component(s) (\"gearbox\" for cars)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "knownVehicleDamages"@en ;
rdfs:comment "A textual description of known damages, both repaired and unrepaired."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfPreviousOwners"@en ;
rdfs:comment """The number of owners of the vehicle, including the current one.
Typical unit code(s): C62"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "speed"@en ;
rdfs:comment """The speed range of the vehicle. If the vehicle is powered by an engine, the upper limit of the speed range (indicated by maxValue) should be the maximum speed achievable under regular conditions.
Typical unit code(s): KMH for km/h, HM for mile per hour (0.447 04 m/s), KNT for knot
*Note 1: Use minValue and maxValue to indicate the range. Typically, the minimal value is zero.
* Note 2: There are many different ways of measuring the speed range. You can link to information about how the given value has been determined using the valueReference property."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "emissionsCO2"@en ;
rdfs:comment "The CO2 emissions in g/km. When used in combination with a QuantitativeValue, put \"g/km\" into the unitText property of that value, since there is no UN/CEFACT Common Code for \"g/km\"."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleInteriorType"@en ;
rdfs:comment "The type or material of the interior of the vehicle (e.g. synthetic fabric, leather, wood, etc.). While most interior types are characterized by the material used, an interior type can also be based on vehicle usage or target audience."@en ;
rdfs:range .
obo:RBO_00000089 a rdfs:Class ;
rdfs:label "physiological study" ;
rdfs:comment "A study of the effects of internal or external radiation on cellular or organismal physiology." ;
rdfs:subClassOf obo:RBO_00000082 .
obo:ENVO_00002005 a rdfs:Class ;
rdfs:label "air" ;
rdfs:comment "The mixture of gases (roughly (by molar content/volume: 78% nitrogen, 20.95% oxygen, 0.93% argon, 0.038% carbon dioxide, trace amounts of other gases, and a variable amount (average around 1%) of water vapor) that surrounds the planet Earth." ;
rdfs:subClassOf obo:ENVO_01000797 .
obo:PATO_0001824 a rdfs:Class ;
rdfs:label "dry" ;
rdfs:comment "A wetness quality inhering in a bearer by virtue of the bearer's not being covered by a liquid." ;
rdfs:subClassOf obo:PATO_0001822 .
obo:ENVO_02000110 a rdfs:Class ;
rdfs:label "open-pit mine" ;
rdfs:comment "A surface mine that utilizes a technique of extracting rock or minerals from the earth by their removal from an open pit or borrow." ;
rdfs:subClassOf obo:ENVO_00000076 .
obo:CHEBI_33575 a rdfs:Class ;
rdfs:label "carboxylic acid" ;
rdfs:comment "A carbon oxoacid acid carrying at least one -C(=O)OH group and having the structure RC(=O)OH, where R is any any monovalent functional group. Carboxylic acids are the most common type of organic acid." ;
rdfs:subClassOf obo:CHEBI_35605 , obo:CHEBI_36586 , obo:CHEBI_64709 .
obo:ENVO_01000191 a rdfs:Class ;
rdfs:label "subtropical grassland biome" ;
rdfs:comment "A subtropical grassland in which dominant ecological communities have reached their climax successional state." ;
rdfs:subClassOf obo:ENVO_01000177 , obo:ENVO_01001809 , obo:ENVO_01001832 .
obo:ENVO_01001479 a rdfs:Class ;
rdfs:label "fluid astronomical body part"@en ;
rdfs:comment "A part of an astronomical body which is primarily composed of fluid."@en ;
rdfs:subClassOf obo:ENVO_01000813 .
obo:UO_0000261 a rdfs:Class ;
rdfs:label "conduction unit" ;
rdfs:comment "\"A unit which represents a standard measurement of the transmission of an entity through a medium.\" [UOC:GVG]" ;
rdfs:subClassOf obo:UO_0000000 .
obo:ENVO_01000005 a rdfs:Class ;
rdfs:label "upwelling" ;
rdfs:comment """MERGED DEFINITION:
TARGET DEFINITION: An oceanographic feature that involves wind-driven motion of dense, cooler, and usually nutrient-rich water towards the ocean surface, replacing the warmer, usually nutrient-deplete surface water.
--------------------
SOURCE DEFINITION: A marine upwelling is a net flow of marine water to the surface of the water column from deeper regions. This is often a result of surface water displacement off continental coasts by wind action. Localised upwellings may also occur along divergent fronts around eddies and along some of the major oceanographic features. Deeper waters often have higher nutrient content; consequently blooms of primary producers, such as planktonic algae, are generally observed around upwelling zones.""" ;
rdfs:subClassOf obo:ENVO_00000147 .
obo:CHMO_0002797 a rdfs:Class ;
rdfs:label "dosimeter" ;
rdfs:comment "A sensor that is used to measure the dose of a substance taken by up an object." ;
rdfs:subClassOf obo:CHMO_0002793 .
obo:ENVO_00003963 a rdfs:Class ;
rdfs:label "warehouse" ;
rdfs:comment "A warehouse is a building which is used for the storage of goods." ;
rdfs:subClassOf obo:ENVO_01001222 .
obo:RBO_00002123 a rdfs:Class ;
rdfs:label "natural environment monitoring" ;
rdfs:comment "Monitoring within an environment which was not man-made." ;
rdfs:subClassOf obo:ENVO_02500041 .
a rdfs:Class ;
rdfs:label "Acquaintance"@en ;
rdfs:subClassOf .
obo:RBO_00002095 a rdfs:Class ;
rdfs:label "attitudinal study towards non-ionising radiation in the environment" ;
rdfs:comment "Studies of the status or origins of a mental position, feeling or emotion toward a fact or state with respect to information or experience concerning radiation, radiation safety or ecological integrity towards natural or anthropogenic non-ionising radiation in the natural environment." ;
rdfs:subClassOf obo:RBO_00002025 .
obo:ENVO_01001440 a rdfs:Class ;
rdfs:label "coal mining"@en ;
rdfs:comment "A mining process during which coal is extracted from the rocky portion of an astronomical body." ;
rdfs:subClassOf obo:ENVO_01001437 .
obo:RBO_00002092 a rdfs:Class ;
rdfs:label "mutagenesis study" ;
rdfs:comment "Study of the frequency of induction , nature and consequences of the production of genetic or epigenetic alterations by any technique, including chemicals, radiation, recombination, or other molecular biology methods." ;
rdfs:subClassOf obo:RBO_00002024 .
obo:ENVO_00002186 a rdfs:Class ;
rdfs:label "contaminated water" ;
rdfs:subClassOf obo:ENVO_00002006 .
obo:CHEBI_52625 a rdfs:Class ;
rdfs:label "inorganic hydroxy compound" ;
rdfs:subClassOf obo:CHEBI_24651 , obo:CHEBI_24835 .
obo:NCBITaxon_33208 a rdfs:Class ;
rdfs:label "Metazoa" ;
rdfs:subClassOf obo:NCBITaxon_33154 .
obo:UO_0000122 a rdfs:Class ;
rdfs:label "plane angle unit" ;
rdfs:comment "\"A unit which is a standard measure of the angle formed by two straight lines in the same plane.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000121 .
obo:RBO_00005038 a rdfs:Class ;
rdfs:label "average fractionated dose rate" ;
rdfs:comment "The total dose administered in a series of radiation fractions divided by the elapsed time between the beginning of the first exposure fraction and the end of the last exposure fraction" ;
rdfs:subClassOf obo:RBO_00000029 .
obo:GENO_0000702 a rdfs:Class ;
rdfs:label "biological sequence"@en ;
rdfs:comment "A linear ordering of units representing monomers of a biological macromolecule (e.g. nucleotides in DNA and RNA, amino acids in polypeptides)." ;
rdfs:subClassOf obo:GENO_0000921 .
obo:GENO_0000251 a rdf:Property ;
rdfs:label "is_sequence_of" ;
rdfs:domain obo:GENO_0000702 ;
rdfs:range .
obo:GENO_0000896 a rdf:Property ;
rdfs:label "has_string" ;
rdfs:comment "Property linking a biological sequence to a string representing the ordered units that comprise the sequence (e.g. 'atgcagctagctaccgtcgatcg')." ;
rdfs:domain obo:GENO_0000702 ;
rdfs:range xsd:string .
obo:ExO_0000002 a rdfs:Class ;
rdfs:label "exposure event" ;
rdfs:comment "An interaction between an exposure stressor and an exposure_receptor." ;
rdfs:subClassOf obo:BFO_0000015 .
a rdf:Property ;
rdfs:label "interacts_with_an_exposure_receptor_via" ;
rdfs:range .
a rdf:Property ;
rdfs:label "interacts_with_an_exposure stressor_via" ;
rdfs:range .
obo:ENVO_01001010 a rdfs:Class ;
rdfs:label "hydrometeor"@en ;
rdfs:comment "A meteor which is primarily composed of water." ;
rdfs:subClassOf obo:ENVO_01001008 .
obo:RBO_00002081 a rdfs:Class ;
rdfs:label "nuclear installation study" ;
rdfs:comment "Study concerning the safety, regulation, activities and engineering of nuclear installations including power stations, waste processing plant, radionuclide generation and purification plant, and military nuclear establishments. May include occupational health studies if broader than just occupationaal health in scope." ;
rdfs:subClassOf obo:RBO_00002023 .
obo:CHEBI_36348 a rdfs:Class ;
rdfs:label "pi meson" ;
rdfs:comment "The collective name for zero-spin mesons pi(+), pi(-) and pi(0)." ;
rdfs:subClassOf obo:CHEBI_36345 .
obo:GO_0006281 a rdfs:Class ;
rdfs:label "DNA repair" ;
rdfs:comment "The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway." ;
rdfs:subClassOf obo:GO_0006259 , obo:GO_0006974 .
obo:PATO_0001428 a rdfs:Class ;
rdfs:label "medium acidity" ;
rdfs:comment "A concentration quality inhering in a medium by virtue of the bearer's tendency to hydronate a specific reference base." ;
rdfs:subClassOf obo:PATO_0001842 .
obo:ENVO_01000743 a rdfs:Class ;
rdfs:label "land consumption process"@en ;
rdfs:comment "A process in which natural ecosystems present over an expanse of land are removed and replaced with anthropogenic ecosystems." ;
rdfs:subClassOf obo:ENVO_01000952 .
obo:RBO_00002032 a rdfs:Class ;
rdfs:label "social science and humanities study" ;
rdfs:comment "Studies involving fields of inquiry into human constructs and concerns as opposed to natural processes . These are traditionally the study of literature, philosophy, and religion. Included in this definition are sociological studies, especially those concerned with the social impact of the humanities." ;
rdfs:subClassOf obo:RBO_00002013 .
obo:ENVO_01001334 a rdfs:Class ;
rdfs:label "advective transport process"@en ;
rdfs:comment "A material transport process during which a volume of material is displaced due to a disequilibrium in physical forces and during which 1) the qualities that inhere in that volume and 2) the processes that are unfolding within it are largely unchanged."@en ;
rdfs:subClassOf obo:ENVO_03000010 .
obo:ENVO_3100011 a rdfs:Class ;
rdfs:label "concentration of dioxygen in liquid water" ;
rdfs:comment "The concentration of dioxygen when measured in liquid water." ;
rdfs:subClassOf obo:PATO_0000033 .
obo:UO_1000229 a rdfs:Class ;
rdfs:label "volt-hour based unit" ;
rdfs:subClassOf obo:UO_0000225 .
obo:CHEBI_33251 a rdfs:Class ;
rdfs:label "monoatomic hydrogen" ;
rdfs:subClassOf obo:CHEBI_33238 , obo:CHEBI_33260 .
obo:RBO_00000099 a rdfs:Class ;
rdfs:label "chronic mixed exposure route study" ;
rdfs:comment "A study of the effects of radiation exposure where the exposoure has an internal and external mode of application. Chronic exposure involves usually a continuous or highly fractionated exposure over a long period of time." ;
rdfs:subClassOf obo:RBO_00000093 .
obo:RBO_00000084 a rdfs:Class ;
rdfs:label "environmental study" ;
rdfs:comment "A study of the impact of radiation on the composition of or processes within the natural or anthropogenic environment." ;
rdfs:subClassOf obo:RBO_00000082 .
a rdfs:Class ;
rdfs:label "Resource Relation Encoding Schemes"@en-US ;
rdfs:comment "A set of resource relation encoding schemes and/or formats"@en-US .
obo:PATO_0000052 a rdfs:Class ;
rdfs:label "shape" ;
rdfs:comment "A morphological quality inhering in a bearer by virtue of the bearer's ratios of distances between its features (points, edges, surfaces and also holes etc)." ;
rdfs:subClassOf obo:PATO_0000051 .
obo:RBO_00000049 a rdfs:Class ;
rdfs:label "particle accelerator radiation" ;
rdfs:comment "Radiation produced by a particle accelerator." ;
rdfs:subClassOf obo:RBO_00000003 .
obo:UO_1000032 a rdfs:Class ;
rdfs:label "hour based unit" ;
rdfs:subClassOf obo:UO_0000003 .
obo:UO_1000021 a rdfs:Class ;
rdfs:label "gram based unit" ;
rdfs:subClassOf obo:UO_0000002 .
obo:ENVO_01000336 a rdfs:Class ;
rdfs:label "shrub layer" ;
rdfs:comment "A shrub layer is a layer of vegetation in a woodland or forest consisting of low, woody vegetation of frutescent form." ;
rdfs:subClassOf obo:ENVO_01000355 .
obo:ENVO_03000127 a rdfs:Class ;
rdfs:label "acid rainfall"@en ;
rdfs:comment "A water-based rainfall process during which water droplets with increased acidity fall towards a planetary surface." ;
rdfs:subClassOf obo:ENVO_01000830 , obo:ENVO_01000982 .
obo:RBO_00000104 a rdfs:Class ;
rdfs:label "survival study" ;
rdfs:comment "A study that uses survival as an endpoint. Generally applicable to animal studies rather than human studies which would use the \"lifespan\" measure (RBO:00000085)" ;
rdfs:subClassOf obo:RBO_00000082 .
obo:RBO_00005023 a rdfs:Class ;
rdfs:label "interplanetary space" ;
rdfs:comment "The region of space in the Solar System between planets" ;
rdfs:subClassOf obo:RBO_00000016 .
obo:ENVO_09000022 a rdfs:Class ;
rdfs:label "concentration of clay in soil" ;
rdfs:comment "The concentration of a clay when measured in soil." ;
rdfs:subClassOf obo:PATO_0000033 .
obo:UBERON_0002535 a rdfs:Class ;
rdfs:label "gill" ;
rdfs:comment "Anatomical surface structure found in many aquatic organisms. It is a respiration organ whose function is the extraction of oxygen from water and the excretion of carbon dioxide. The microscopic structure of a gill is such that it presents a very large surface area to the external environment. Gills usually consist of thin filaments of tissue, branches, or slender tufted processes which have a highly folded surface to increase surface area. A high surface area is crucial to the gas exchange of aquatic organisms as water contains only 1/20 parts dissolved Oxygen compared to air. With the exception of some aquatic insects, the filaments and lamellae (folds) contain blood or coelomic fluid, from which gases are exchanged through the thin walls. Oxygen is carried by the blood to other parts of the body. Carbon dioxide passes from the blood through the thin gill tissue into the water. Gills or gill-like organs, located in different parts of the body, are found in various groups of aquatic animals, including mollusks, crustaceans, insects, fish, and amphibians." ;
rdfs:subClassOf obo:UBERON_0000062 .
obo:ENVO_01001022 a rdfs:Class ;
rdfs:label "natural lake"@en ;
rdfs:comment "A lake which has formed as the result of processes that are not or are only minimally driven by human activity." ;
rdfs:subClassOf obo:ENVO_00000020 .
obo:ENVO_01001307 a rdf:Property ;
rdfs:label "partially_surrounded_by" ;
rdfs:comment "x partially_surrounded_by y if and only if (1) x is adjacent to y and for the region r that is adjacent to x, r partially overlaps y (2) the shared boundary between x and y occupies a non-trivial proportion of the outermost boundary of x" ;
rdfs:range .
obo:ENVO_01000204 a rdfs:Class ;
rdfs:label "tropical" ;
rdfs:comment "A tropical condition is an environmental condition in which an environmental system receives high yearly solar irradiance per unit area and, on Earth, the Sun reaches a subsolar point at least once during the solar year. This results in a hot and moist year-round climate at low elevations, which have a monthly average temperature above 18 degrees Celsius." ;
rdfs:subClassOf obo:ENVO_01000203 .
obo:CHEBI_24866 a rdfs:Class ;
rdfs:label "salt" ;
rdfs:comment "A salt is an assembly of cations and anions." ;
rdfs:subClassOf obo:CHEBI_37577 .
a rdfs:Class ;
rdfs:label "Friend"@en ;
rdfs:subClassOf .
obo:RBO_00002025 a rdfs:Class ;
rdfs:label "attitudinal study" ;
rdfs:comment "Study of the status or origins of a mental position, feeling or emotion toward a fact or state with respect to information or experience concerning radiation, radiation safety or ethicolegal constructs surrounding radiation and radiation safety and regulation." ;
rdfs:subClassOf obo:RBO_00002013 .
obo:ENVO_01001226 a rdfs:Class ;
rdfs:label "terrestrial natural environment"@en ;
rdfs:comment "A natural environment which is located on a land mass." ;
rdfs:subClassOf obo:ENVO_01000813 , obo:ENVO_01000951 .
obo:NCBITaxon_33511 a rdfs:Class ;
rdfs:label "Deuterostomia" ;
rdfs:subClassOf obo:NCBITaxon_33213 .
obo:UBERON_0000468 a rdfs:Class ;
rdfs:label "multicellular organism" ;
rdfs:comment "Anatomical structure that is an individual member of a species and consists of more than one cell." ;
rdfs:subClassOf obo:UBERON_0010000 .
obo:UO_1000118 a rdfs:Class ;
rdfs:label "lumen based unit" ;
rdfs:subClassOf obo:UO_0000117 .
obo:CHEBI_33677 a rdfs:Class ;
rdfs:label "f-block molecular entity" ;
rdfs:subClassOf obo:CHEBI_33497 .
obo:RBO_00002070 a rdfs:Class ;
rdfs:label "acoustic radiation study" ;
rdfs:comment "Study of the effects of acoustic radiation on cellular and organismal physiology and the effects of acoustic radiation emitted in response to exposure to ionising radiation." ;
rdfs:subClassOf obo:RBO_00002021 .
obo:ENVO_09200017 a rdfs:Class ;
rdfs:label "composition of water" ;
rdfs:comment "The composition of some water." ;
rdfs:subClassOf obo:PATO_0000025 .
obo:UO_1010049 a rdfs:Class ;
rdfs:label "gram per square meter based unit" ;
rdfs:subClassOf obo:UO_0000054 .
obo:ENVO_01003013 a rdfs:Class ;
rdfs:label "material diffusion process"@en ;
rdfs:comment "A material transport process during which material moves from a region of higher concentration to a region of lower concentration."@en ;
rdfs:subClassOf obo:ENVO_03000010 .
a rdfs:Class ;
rdfs:label "X400"@en ;
rdfs:comment "This class is deprecated"@en ;
rdfs:subClassOf .
obo:UO_1000010 a rdfs:Class ;
rdfs:label "second based unit" ;
rdfs:subClassOf obo:UO_0000003 .
obo:RBO_00000062 a rdfs:Class ;
rdfs:label "actinium" ;
rdfs:comment "A trivalent radioactive element and the prototypical member of the actinide family. It has the atomic symbol Ac, and atomic number 89. Its principal isotope is 227 and it decays primarily by beta-emission." ;
rdfs:subClassOf obo:RBO_00000061 .
obo:CHEBI_36963 a rdfs:Class ;
rdfs:label "organooxygen compound" ;
rdfs:comment "An organochalcogen compound containing at least one carbon-oxygen bond." ;
rdfs:subClassOf obo:CHEBI_25806 , obo:CHEBI_36962 .
obo:CHEBI_33273 a rdfs:Class ;
rdfs:label "polyatomic anion" ;
rdfs:comment "An anion consisting of more than one atom." ;
rdfs:subClassOf obo:CHEBI_22563 , obo:CHEBI_36358 .
obo:RBO_00015029 a rdfs:Class ;
rdfs:label "multiple ion sequential irradiation study" ;
rdfs:comment "A multiple ion sequential irradiation study involves exposing a sample or system to a combination of different ions. This could include exposure to various forms of particle radiation such as ion beams. Exposure might be from anthropogenic or natural sources of radiation. The goal is to understand how the different types of radiation interact with each other and their combined effects on the material or biological system under investigation." ;
rdfs:subClassOf obo:RBO_00015027 .
obo:ENVO_01001446 a rdfs:Class ;
rdfs:label "usage of an environment for residential activity"@en ;
rdfs:comment "A planned environmental usage process during which an environment supports the settlement and dwelling of a community of humans." ;
rdfs:subClassOf obo:ENVO_01001436 .
obo:UO_1000090 a rdfs:Class ;
rdfs:label "cubic centimeter per mole based unit" ;
rdfs:subClassOf obo:UO_0000056 .
obo:GO_0006139 a rdfs:Class ;
rdfs:label "nucleobase-containing compound metabolic process" ;
rdfs:comment "Any cellular metabolic process involving nucleobases, nucleosides, nucleotides and nucleic acids." ;
rdfs:subClassOf obo:GO_0044238 , obo:GO_1901360 .
obo:UO_0000059 a rdfs:Class ;
rdfs:label "specific volume unit" ;
rdfs:comment "\"A unit which is a standard measure of the volume of a given mass of substance (the reciprocal of density).\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000095 .
obo:UBERON_0001062 a rdfs:Class ;
rdfs:label "anatomical entity" ;
rdfs:comment "Biological entity that is either an individual member of a biological species or constitutes the structural organization of an individual member of a biological species." ;
rdfs:subClassOf obo:BFO_0000004 .
obo:ENVO_02000098 a rdfs:Class ;
rdfs:label "platinum ore" ;
rdfs:subClassOf obo:ENVO_02000094 .
obo:PATO_0001241 a rdfs:Class ;
rdfs:label "physical object quality" ;
rdfs:comment "A quality which inheres in a continuant." ;
rdfs:subClassOf obo:BFO_0000019 , obo:PATO_0000001 .
obo:GENO_0000713 a rdfs:Class ;
rdfs:label "qualified sequence feature or collection"@en ;
rdfs:comment "A sequence feature (or collection of features) whose identity is dependent on the context or state of its material bearer (in addition to its sequence an position). This context/state describes factors external to its inherent sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:CHEBI_46883 a rdfs:Class ;
rdfs:label "carboxy group" ;
rdfs:subClassOf obo:CHEBI_33249 .
obo:ENVO_01001860 a rdfs:Class ;
rdfs:label "wind gust"@en ;
rdfs:comment "An atmospheric wind which 1) has an increased rate relative to other winds in the same region and 2) is followed by a lull." ;
rdfs:subClassOf obo:ENVO_01000793 .
obo:ENVO_2000043 a rdfs:Class ;
rdfs:label "tidal power plant" ;
rdfs:subClassOf obo:ENVO_00002214 .
obo:ENVO_01003002 a rdfs:Class ;
rdfs:label "particle"@en ;
rdfs:comment "A mass of solid material which is either 1) a minute fragment of a larger mass or 2) one of a collection of small masses composing an aggregate." ;
rdfs:subClassOf obo:ENVO_01001687 .
obo:ENVO_01001406 a rdfs:Class ;
rdfs:label "laboratory facility" ;
rdfs:comment "A research facility in which systems of manufactured products control internal conditions and in which scientific or technological research, experiments, and measurement may be performed." ;
rdfs:subClassOf obo:ENVO_00000469 .
obo:CHEBI_64769 a rdfs:Class ;
rdfs:label "organic cationic group" ;
rdfs:comment "A cationic group that contains carbon." ;
rdfs:subClassOf obo:CHEBI_64766 .
obo:CHEBI_33465 a rdfs:Class ;
rdfs:label "elemental pnictogen" ;
rdfs:subClassOf obo:CHEBI_24835 , obo:CHEBI_33259 , obo:CHEBI_33302 .
obo:ENVO_01000989 a rdfs:Class ;
rdfs:label "plumbing fixture"@en ;
rdfs:comment "An exchangeable device which can be connected to a plumbing system to deliver and drain water." ;
rdfs:subClassOf obo:ENVO_00003074 .
obo:ENVO_01000462 a rdfs:Class ;
rdfs:label "masonry cement" ;
rdfs:comment "Masonry cement is a substance used in construction that has the disposition to set and harden and thus may be used to bind materials together." ;
rdfs:subClassOf obo:ENVO_0010001 .
obo:SLSO_0000032 a rdfs:Class ;
rdfs:label "spacecraft" ;
rdfs:comment "Devices, manned and unmanned, which are designed to be placed into an orbit about the Earth or into a trajectory to another celestial body." ;
rdfs:subClassOf obo:ENVO_01001813 , .
obo:ENVO_00000002 a rdfs:Class ;
rdfs:label "anthropogenic geographic feature" ;
rdfs:comment "An anthropogenic geographic feature is a geographic feature resulting from the influence of human beings on nature." ;
rdfs:subClassOf obo:ENVO_00000000 .
obo:ENVO_01001809 a rdfs:Class ;
rdfs:label "subtropical grassland"@en ;
rdfs:comment "A grassland which is subject to subtropical climatic conditions." ;
rdfs:subClassOf obo:ENVO_01001206 , obo:ENVO_01001702 .
obo:SDDO_1000009 a rdfs:Class ;
rdfs:label "discovery interface"@en ;
rdfs:comment "An interface that 1) presents users with discovery criteria and may 2) lead to an access interface." ;
rdfs:subClassOf .
obo:OBIB_0000710 a rdfs:Class ;
rdfs:label "survey execution"@en ;
rdfs:comment "A planned process that realizes the concretization of a survey to generate an output(survey data.)"@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:RBO_010019 a rdfs:Class ;
rdfs:label "relative biological effectiveness" ;
rdfs:comment "Factor used to compare the biological effectiveness of absorbed doses from different types of ionizing radiation, determined experimentally. RBE is the ratio of the absorbed dose of a reference radiation to the absorbed dose of the radiation in question r" ;
rdfs:subClassOf obo:IAO_0000109 .
obo:ENVO_01000668 a rdfs:Class ;
rdfs:label "geological fault"@en ;
rdfs:comment "A geological fault is a planar fracture or discontinuity in a volume of rock, across which there has been significant displacement as a result of rock mass movement." ;
rdfs:subClassOf obo:ENVO_01000667 .
a rdfs:Class ;
rdfs:label "Vehicle"@en ;
rdfs:comment "A vehicle is a device that is designed or used to transport people or cargo over land, water, air, or through space."@en .
obo:IAO_0000178 a rdfs:Class ;
rdfs:label "material information bearer"@en ;
rdfs:comment "A material entity in which a concretization of an information content entity inheres."@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:CHEBI_75771 a rdfs:Class ;
rdfs:label "mouse metabolite" ;
rdfs:comment "Any mammalian metabolite produced during a metabolic reaction in a mouse (Mus musculus)." ;
rdfs:subClassOf obo:CHEBI_75768 .
obo:ENVO_01001088 a rdfs:Class ;
rdfs:label "aerosolised liquids"@en ;
rdfs:comment "An aerosol which has non-gaseous parts that are primarily composed of liquid droplets." ;
rdfs:subClassOf obo:ENVO_00010505 , obo:ENVO_02000140 .
obo:ENVO_01001780 a rdfs:Class ;
rdfs:label "desert ecosystem"@en ;
rdfs:comment "An ecosystem in which the composition, structure, and function of resident ecological assemblages are primarily determined by a desert."@en ;
rdfs:subClassOf obo:ENVO_01000813 , obo:ENVO_01001110 .
obo:RBO_010000 a rdfs:Class ;
rdfs:label "as low as reasonably achievable" ;
rdfs:comment "A principle of radiation protection philosophy that requires that exposures to ionizing radiation be kept as low as reasonably achievable, economic and social factors being taken into account. The protection from radiation exposure is ALARA when the expen" ;
rdfs:subClassOf obo:IAO_0000104 .
obo:PATO_0001154 a rdfs:Class ;
rdfs:label "elongated" ;
rdfs:comment "A quality inhering in a bearer by virtue of the bearer's length being notably higher than its width." ;
rdfs:subClassOf obo:PATO_0000052 .
obo:ENVO_09200001 a rdfs:Class ;
rdfs:label "temperature of air" ;
rdfs:comment "The temperature of some air." ;
rdfs:subClassOf obo:ENVO_09200000 , obo:PATO_0000146 .
obo:ENVO_01001483 a rdfs:Class ;
rdfs:label "surface of an astronomical body"@en ;
rdfs:comment "A surface layer where the solid or liquid material of an astronomical body comes into contact with an atmosphere or outer space." ;
rdfs:subClassOf obo:ENVO_00010504 , obo:ENVO_01000813 .
obo:CHEBI_75763 a rdfs:Class ;
rdfs:label "eukaryotic metabolite" ;
rdfs:comment "Any metabolite produced during a metabolic reaction in eukaryotes, the taxon that include members of the fungi, plantae and animalia kingdoms." ;
rdfs:subClassOf obo:CHEBI_25212 .
a rdfs:Class ;
rdfs:label "Child"@en ;
rdfs:subClassOf .
obo:PO_0025007 a rdfs:Class ;
rdfs:label "collective plant organ structure" ;
rdfs:comment "A collective plant structure (PO:0025497) that is a proper part of a whole plant (PO:0000003), and is composed of two or more adjacent plant organs (PO:0009008) and the associated portions of plant tissue (PO:0009007)." ;
rdfs:subClassOf obo:PO_0025497 .
obo:RBO_00002043 a rdfs:Class ;
rdfs:label "incidence or prevalence study" ;
rdfs:comment "A study of the number of new cases of a given disease during a given period in a specified population. It also is used for the rate at which new events occur in a defined population. this class also includes PREVALENCE, which refers to all cases in the population at a given time." ;
rdfs:subClassOf obo:RBO_00000083 .
obo:CHEBI_33284 a rdfs:Class ;
rdfs:label "nutrient" ;
rdfs:comment "A nutrient is a food component that an organism uses to survive and grow." ;
rdfs:subClassOf obo:CHEBI_78295 .
obo:ENVO_01001069 a rdfs:Class ;
rdfs:label "metallic material"@en ;
rdfs:comment "A material which is composed primarily of one or more pure metals and which shows their properties." ;
rdfs:subClassOf obo:ENVO_00010483 .
a rdfs:Class .
obo:UBERON_0007383 a rdfs:Class ;
rdfs:label "enveloping layer of ectoderm" ;
rdfs:comment "Outermost layer of cells surrounding the embryo." ;
rdfs:subClassOf obo:UBERON_0000490 , obo:UBERON_0005291 , obo:UBERON_0010371 .
obo:ENVO_01001838 a rdfs:Class ;
rdfs:label "arid biome"@en ;
rdfs:comment "A biome which is subject to arid environmental conditions." ;
rdfs:subClassOf obo:ENVO_00000428 .
obo:ENVO_01000251 a rdfs:Class ;
rdfs:label "subpolar" ;
rdfs:comment "A subpolar condition is an environmental condition in which an environmental system receives low, yearly solar irradiance per unit area and is surrounded by large land masses. This results in very cold winters with temperatures potentially falling to around -40 degrees Celsius and summers which last no more than 3 months of the year with a 24-hour average temperature of at least 10 degrees Celsius." ;
rdfs:subClassOf obo:ENVO_01000203 .
obo:PO_0025606 a rdfs:Class ;
rdfs:label "native plant cell" ;
rdfs:comment "A plant cell (PO:0009002) that is either part of a multicellular whole plant (PO:0000003) 'in vivo' or a unicellular organism 'in natura' (i.e. part of a natural environment)." ;
rdfs:subClassOf obo:PO_0009002 .
obo:ENVO_01000635 a rdfs:Class ;
rdfs:label "planetary landmass"@en ;
rdfs:comment "A landmass which is part of a planet." ;
rdfs:subClassOf obo:ENVO_01000324 , obo:ENVO_01001782 .
obo:RBO_00002047 a rdfs:Class ;
rdfs:label "nuclear accident study" ;
rdfs:comment "Studies on plannig for or analysing a nuclear accident with release of airborn or waterborn contamination into the environment. Narrower than Disaster planning study but may be used to qualify an annotation to Disaster planning study if the source of contamination is a nuclear accident. A nuclear accident is not necessarily a disaster." ;
rdfs:subClassOf obo:RBO_00002016 .
obo:CHEBI_33316 a rdfs:Class ;
rdfs:label "helium(2+)" ;
rdfs:subClassOf obo:CHEBI_30412 , obo:CHEBI_33315 .
obo:SLSO_0000028 a rdfs:Class ;
rdfs:label "LSDA document" ;
rdfs:comment "NCIt Definition: A physical object, or electronic counterpart, that is characterized by containing writing which is meant to be human-readable." ;
rdfs:subClassOf obo:SDDO_3000109 .
obo:SLSO_0000043 a rdfs:Class ;
rdfs:label "scientific name" ;
rdfs:comment "The name applied to a plant, animal, or other organism, according to the Codes of Nomenclature, consisting of a Genus and species." ;
rdfs:subClassOf obo:SDDO_3000065 .
a rdfs:Class ;
rdfs:label "MotorizedBicycle"@en ;
rdfs:comment "A motorized bicycle is a bicycle with an attached motor used to power the vehicle, or to assist with pedaling."@en ;
rdfs:subClassOf .
obo:CHEBI_33744 a rdfs:Class ;
rdfs:label "iron group molecular entity" ;
rdfs:subClassOf obo:CHEBI_33676 .
obo:PO_0000003 a rdfs:Class ;
rdfs:label "whole plant" ;
rdfs:comment "A plant structure (PO:0005679) which is a whole organism." ;
rdfs:subClassOf obo:PO_0009011 .
obo:IAO_0000308 a rdfs:Class ;
rdfs:label "figure"@en ;
rdfs:comment "An information content entity consisting of a two dimensional arrangement of information content entities such that the arrangement itself is about something."@en ;
rdfs:subClassOf obo:IAO_0000030 .
obo:NCBITaxon_1437010 a rdfs:Class ;
rdfs:label "Boreoeutheria" ;
rdfs:subClassOf obo:NCBITaxon_9347 .
obo:CHEBI_33262 a rdfs:Class ;
rdfs:label "elemental oxygen" ;
rdfs:subClassOf obo:CHEBI_24835 , obo:CHEBI_25806 , obo:CHEBI_33259 .
obo:NCBITaxon_32525 a rdfs:Class ;
rdfs:label "Theria " ;
rdfs:subClassOf obo:NCBITaxon_40674 .
obo:BFO_0000141 a rdfs:Class ;
rdfs:label "immaterial entity"@en ;
rdfs:subClassOf obo:BFO_0000004 .
a rdfs:Class ;
rdfs:label "Parent"@en ;
rdfs:subClassOf .
obo:ENVO_01001199 a rdfs:Class ;
rdfs:label "terrestrial environmental zone"@en ;
rdfs:comment "An environmental zone which is bounded by material parts of a land mass or the atmosphere or space adjacent to it." ;
rdfs:subClassOf obo:ENVO_01000408 , obo:ENVO_01000813 .
obo:SDDO_1000010 a rdfs:Class ;
rdfs:label "field campaign"@en ;
rdfs:comment "A campaign that is coordinated among one or more individuals and/or one or more organizations." ;
rdfs:subClassOf obo:SDDO_3000045 .
obo:SDDO_3000009 a rdf:Property ;
rdfs:label "uses"@en ;
rdfs:range .
obo:SDDO_3000020 a rdf:Property ;
rdfs:label "resultsIn"@en ;
rdfs:range .
obo:GENO_0000660 a rdfs:Class ;
rdfs:label "genomic feature set"@en ;
rdfs:comment "A set of genomic features (i.e. sequence features that are of genomic origin)." ;
rdfs:subClassOf obo:GENO_0000659 , obo:GENO_0000897 .
obo:RO_0002351 a rdf:Property ;
rdfs:label "has member" ;
rdfs:comment "has member is a mereological relation between a collection and an item." ;
rdfs:range , obo:OBI_0000245 , obo:OBI_0100051 ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:GENO_0000917 a rdf:Property ;
rdfs:label "has_member_count"@en ;
rdfs:comment "Describes the number of members in some set." ;
rdfs:range .
obo:ENVO_01000646 a rdfs:Class ;
rdfs:label "lithosphere"@en ;
rdfs:comment "A lithosphere is the outermost shell of a terrestrial-type planet or natural satellite that is defined by its rigid mechanical properties." ;
rdfs:subClassOf obo:ENVO_00000191 , obo:ENVO_01000639 , obo:ENVO_01001275 .
obo:RBO_00002102 a rdfs:Class ;
rdfs:label "social affairs and community health study" ;
rdfs:comment "Study involving attitudes, health status, social organisation of defined communities identified by common characteristics such as occupation type, geography, gender identity, with respect to radiation." ;
rdfs:subClassOf obo:RBO_00002027 .
obo:UO_1000188 a rdfs:Class ;
rdfs:label "pi based unit" ;
rdfs:subClassOf obo:UO_0000186 .
obo:UO_1000242 a rdfs:Class ;
rdfs:label "pixels per inch based unit" ;
rdfs:subClassOf obo:UO_0000239 .
obo:CHEBI_33692 a rdfs:Class ;
rdfs:label "hydrides" ;
rdfs:comment "Hydrides are chemical compounds of hydrogen with other chemical elements." ;
rdfs:subClassOf obo:CHEBI_33608 , obo:CHEBI_37577 .
obo:CHEBI_33238 a rdfs:Class ;
rdfs:label "monoatomic entity" ;
rdfs:comment "A monoatomic entity is a molecular entity consisting of a single atom." ;
rdfs:subClassOf obo:CHEBI_33259 .
obo:ENVO_01000500 a rdfs:Class ;
rdfs:label "brick exterior wall" ;
rdfs:comment "A brick exterior wall is an exterior wall that is built from bricks." ;
rdfs:subClassOf obo:ENVO_00000191 , obo:ENVO_01000469 .
obo:UO_0000117 a rdfs:Class ;
rdfs:label "luminous flux unit" ;
rdfs:comment "\"A unit which is a standard measure of the flow of radiant energy.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000157 .
obo:ENVO_00002016 a rdfs:Class ;
rdfs:label "sedimentary rock" ;
rdfs:comment "A rock formed by deposition of either clastic sediments, organic matter, or chemical precipitates (evaporites), followed by compaction of the particulate matter and cementation during diagenesis." ;
rdfs:subClassOf obo:ENVO_00001995 .
obo:UO_1000133 a rdfs:Class ;
rdfs:label "curie based unit" ;
rdfs:subClassOf obo:UO_0000128 .
obo:SDDO_3000105 a rdfs:Class ;
rdfs:label "investigator"@en ;
rdfs:comment "A role which inheres in a person or organization and which is realized during an investigation." ;
rdfs:subClassOf obo:BFO_0000023 , obo:CHEBI_50906 .
obo:CHEBI_50860 a rdfs:Class ;
rdfs:label "organic molecular entity" ;
rdfs:comment "Any molecular entity that contains carbon." ;
rdfs:subClassOf obo:CHEBI_33582 .
a rdfs:Class ;
rdfs:label "Platform"@en ;
rdfs:comment "A Platform is an entity that hosts other entities, particularly Sensors, Actuators, Samplers, and other Platforms."@en .
obo:NCBITaxon_2157 a rdfs:Class ;
rdfs:label "Archaea" ;
rdfs:subClassOf obo:OBI_0100026 .
a rdfs:Class ;
rdfs:label "Address"@en ;
rdfs:comment "To specify the components of the delivery address for the object"@en .
obo:OBI_0200171 a rdfs:Class ;
rdfs:label "partitioning data transformation"@en ;
rdfs:comment "A partitioning data transformation is a data transformation that has objective partitioning."@en ;
rdfs:subClassOf obo:OBI_0200000 .
obo:ENVO_01001436 a rdfs:Class ;
rdfs:label "planned environmental usage process"@en ;
rdfs:comment "A planned process during which humans access and obtain resources, benefits, or services from a natural or anthropised ecosystem." ;
rdfs:subClassOf obo:ENVO_02500027 , obo:OBI_0000011 .
obo:CHEBI_33498 a rdfs:Class ;
rdfs:label "actinoid molecular entity" ;
rdfs:subClassOf obo:CHEBI_33677 .
a rdfs:Class ;
rdfs:label "データセット"@ja , "Σύνολο Δεδομένων"@el , "قائمة بيانات"@ar , "Datasæt"@da , "Jeu de données"@fr , "Datová sada"@cs , "Dataset"@en , "Dataset"@it , "Conjunto de datos"@es ;
rdfs:comment "1つのエージェントによって公開またはキュレートされ、1つ以上の形式でアクセスまたはダウンロードできるデータの集合。"@ja , "Μία συλλογή από δεδομένα, δημοσιευμένη ή επιμελημένη από μία και μόνο πηγή, διαθέσιμη δε προς πρόσβαση ή μεταφόρτωση σε μία ή περισσότερες μορφές."@el , "قائمة بيانات منشورة أو مجموعة من قبل مصدر ما و متاح الوصول إليها أو تحميلها"@ar , "En samling a data, udgivet eller udvalgt og arrangeret af en enkelt kilde og som der er adgang til i en eller flere repræsentationer."@da , "Une collection de données, publiée ou élaborée par une seule source, et disponible pour accès ou téléchargement dans un ou plusieurs formats."@fr , "Kolekce dat poskytovaná či řízená jedním zdrojem, která je k dispozici pro přístup či stažení v jednom či více formátech."@cs , "A collection of data, published or curated by a single source, and available for access or download in one or more represenations."@en , "Raccolta di dati, pubblicati o curati da un'unica fonte, disponibili per l'accesso o il download in uno o più formati."@it , "Una colección de datos, publicados o conservados por una única fuente, y disponibles para ser accedidos o descargados en uno o más formatos."@es ;
rdfs:subClassOf .
obo:UO_1000218 a rdfs:Class ;
rdfs:label "volt based unit" ;
rdfs:subClassOf obo:UO_0000217 .
obo:RBO_00000005 a rdfs:Class ;
rdfs:label "Fe-56 ion radiation" ;
rdfs:comment "Atomic nuclei, each with 26 protons and 30 neutrons with kinetic energy imparted by natural or artificial means such as by a particle accelerator" ;
rdfs:subClassOf obo:RBO_00005001 .
obo:UO_0000157 a rdfs:Class ;
rdfs:label "light unit" ;
rdfs:comment "\"A unit which is a standard measure of the intensity of light.\" [NIST:NIST]" ;
rdfs:subClassOf obo:UO_0000000 .
obo:UO_0000297 a rdfs:Class ;
rdfs:label "milli" ;
rdfs:comment "\"A prefix in the metric system denoting a factor of one thousand.\" [UO:GVG]" ;
rdfs:subClassOf obo:UO_0000046 .
obo:GENO_0000920 a rdfs:Class ;
rdfs:label "qualified sequence feature set"@en ;
rdfs:comment "A set of qualified seqeunce features." ;
rdfs:subClassOf obo:GENO_0000713 .
obo:GENO_0000726 a rdf:Property ;
rdfs:label "has_sequence_feature"@en ;
rdfs:comment "A relation linking a qualified sequence feature to its component sequence feature." ;
rdfs:range obo:SO_0000110 .
obo:RBO_00002036 a rdfs:Class ;
rdfs:label "stakeholder engagement study" ;
rdfs:comment "Studies of the engagement between an organisational entity and those groups or individuals potentially or actually impacted by the actions of that entity over a range of activities and approaches." ;
rdfs:subClassOf obo:RBO_00002013 .
obo:RBO_00000113 a rdfs:Class ;
rdfs:label "low linear energy transfer radiation" ;
rdfs:comment "X and gamma rays or light charged particles such as electrons that produce sparse ionizing events far apart on a molecular scale." ;
rdfs:subClassOf obo:RBO_00000116 .
obo:OBI_0000450 a rdfs:Class ;
rdfs:label "regulatory agency"@en ;
rdfs:comment "A regulatory agency is a organization that has responsibility over or for the legislation (acts and regulations) for a given sector of the government."@en ;
rdfs:subClassOf obo:OBI_0000245 .
obo:OBIB_0000732 a rdf:Property ;
rdfs:label "owns"@en ;
rdfs:range xsd:string .
obo:RBO_00002005 a rdfs:Class ;
rdfs:label "medical therapeutic radiation exposure" ;
rdfs:comment "Planned exposure of an organism to radiation of any type, internally or externally, with the intention to effect a cure or mitigation of disease." ;
rdfs:subClassOf obo:RBO_00002008 .
obo:PATO_0002182 a rdfs:Class ;
rdfs:label "molecular quality" ;
rdfs:comment "A quality which inheres in a molecular entity, a single molecule, atom, ion, radical etc." ;
rdfs:subClassOf obo:PATO_0001241 .
obo:ENVO_01000320 a rdfs:Class ;
rdfs:label "marine environment" ;
rdfs:comment "A marine environment and enviroment which is determined by a marine water body." ;
rdfs:subClassOf obo:ENVO_01000254 , obo:ENVO_01000813 .
obo:GENO_0000897 a rdfs:Class ;
rdfs:label "genomic entity"@en ;
rdfs:comment "An generically dependent continuant that carries biological sequence that is part of or derived from a genome." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:ENVO_01000601 a rdfs:Class ;
rdfs:label "motor vehicle"@en ;
rdfs:comment "A motor vehicle is a vehicle which is propelled by an engine or motor and that does not operate on rails." ;
rdfs:subClassOf obo:ENVO_01000604 .
obo:CHEBI_33969 a rdfs:Class ;
rdfs:label "gold molecular entity" ;
rdfs:subClassOf obo:CHEBI_33745 .
obo:ENVO_01000426 a rdfs:Class ;
rdfs:label "room" ;
rdfs:comment "A building part which is separated from other building parts by one or more interior walls and, optionally, outdoor areas by one or more exterior walls." ;
rdfs:subClassOf obo:ENVO_01000420 .
obo:ENVO_00005805 a rdfs:Class ;
rdfs:label "nest of bird" ;
rdfs:comment "A bird nest is the spot in which a bird lays and incubates its eggs and raises its young." ;
rdfs:subClassOf obo:ENVO_00005803 .
obo:PATO_0001476 a rdfs:Class ;
rdfs:label "decreased position" ;
rdfs:comment "A positional which is relatively low." ;
rdfs:subClassOf obo:PATO_0000140 , obo:PATO_0002303 .
obo:UO_1000152 a rdfs:Class ;
rdfs:label "half life based unit" ;
rdfs:subClassOf obo:UO_0000003 .
a rdfs:Class ;
rdfs:label "Crush"@en ;
rdfs:subClassOf .
obo:UO_0000111 a rdfs:Class ;
rdfs:label "energy unit" ;
rdfs:comment "\"A unit which is a standard measure of the work done by a certain force (gravitational, electric, magnetic, force of inertia, etc).\" [NIST:NIST]" ;
rdfs:subClassOf obo:UO_0000000 .
obo:CHEBI_28616 a rdfs:Class ;
rdfs:label "carbamic acid" ;
rdfs:comment "A one-carbon compound that is ammonia in which one of the hydrogens is replaced by a carboxy group. Although carbamic acid derivatives are common, carbamic acid itself has never been synthesised." ;
rdfs:subClassOf obo:CHEBI_35352 , obo:CHEBI_35605 , obo:CHEBI_64708 .
obo:CHEBI_75767 a rdfs:Class ;
rdfs:label "animal metabolite" ;
rdfs:comment "Any eukaryotic metabolite produced during a metabolic reaction in animals that include diverse creatures from sponges, insects to mammals." ;
rdfs:subClassOf obo:CHEBI_75763 .
obo:OBI_0002356 a rdfs:Class ;
rdfs:label "performance status value specification" ;
rdfs:comment "A categorical value specification that is an assessment of a participant's performance status (general well-being and activities of daily life)." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:RBO_00000080 a rdfs:Class ;
rdfs:label "dentist" ;
rdfs:subClassOf obo:RBO_00000079 .
obo:UO_1000076 a rdfs:Class ;
rdfs:label "mole fraction based unit" ;
rdfs:subClassOf obo:UO_0000051 , obo:UO_0000191 .
obo:BFO_0000040 a rdfs:Class ;
rdfs:label "material entity" ;
rdfs:comment "An independent continuant [snap:IndependentContinuant] that is spatially extended whose identity is independent of that of other entities and can be maintained through time. Note: Material entity [snap:MaterialEntity] subsumes object [snap:Object], fiat object part [snap:FiatObjectPart], and object aggregate [snap:ObjectAggregate], which assume a three level theory of granularity, which is inadequate for some domains, such as biology." ;
rdfs:subClassOf obo:BFO_0000004 .
obo:RBO_00002120 a rdfs:Class ;
rdfs:label "unplanned anthropogenic irradiation" ;
rdfs:comment "Unplanned irradiation that is of anthropogenic origin" ;
rdfs:subClassOf obo:RBO_00002119 .
obo:ENVO_00000284 a rdfs:Class ;
rdfs:label "quarry" ;
rdfs:comment "An open-pit mine from which rock or minerals are extracted." ;
rdfs:subClassOf obo:ENVO_02000110 .
obo:SDDO_3000100 a rdfs:Class ;
rdfs:label "observation"@en ;
rdfs:comment "Act of carrying out an procedure to estimate or calculate a value of a property of a feature." ;
rdfs:subClassOf obo:OBI_0000011 , .
obo:ENVO_00000309 a rdfs:Class ;
rdfs:label "depressed landform" ;
rdfs:comment "A landform sunken or depressed below the surrounding area." ;
rdfs:subClassOf obo:ENVO_01001886 .
a rdfs:Class ;
rdfs:label "CompleteDataFeed"@en ;
rdfs:comment """A CompleteDataFeed is a DataFeed whose standard representation includes content for every item currently in the feed.
This is the equivalent of Atom's element as defined in Feed Paging and Archiving RFC 5005, for example (and as defined for Atom), when using data from a feed that represents a collection of items that varies over time (e.g. \"Top Twenty Records\") there is no need to have newer entries mixed in alongside older, obsolete entries. By marking this feed as a CompleteDataFeed, old entries can be safely discarded when the feed is refreshed, since we can assume the feed has provided descriptions for all current items."""@en ;
rdfs:subClassOf .
a rdf:Property ;
rdfs:label "dataFeedElement"@en ;
rdfs:comment "An item within a data feed. Data feeds may have many elements."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "datasetTimeInterval"@en ;
rdfs:comment "The range of temporal applicability of a dataset, e.g. for a 2011 census dataset, the year 2011 (in ISO 8601 time interval format)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "variablesMeasured"@en ;
rdfs:comment "Originally named variablesMeasured, the variableMeasured property can indicate (repeated as necessary) the variables that are measured in some dataset, either described as text or as pairs of identifier and description using PropertyValue."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "includedDataCatalog"@en ;
rdfs:comment "A data catalog which contains this dataset (this property was previously 'catalog', preferred name is now 'includedInDataCatalog')."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "includedInDataCatalog"@en ;
rdfs:comment "A data catalog which contains this dataset."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "distribution"@en ;
rdfs:comment "A downloadable form of this dataset, at a specific location, in a specific format. This property can be repeated if different variations are available. There is no expectation that different downloadable distributions must contain exactly equivalent information (see also DCAT on this point). Different distributions might include or exclude different subsets of the entire dataset, for example."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "catalog"@en ;
rdfs:comment "A data catalog which contains this dataset."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "variableMeasured"@en ;
rdfs:comment "The variableMeasured property can indicate (repeated as necessary) the variables that are measured in some dataset, either described as text or as pairs of identifier and description using PropertyValue."@en ;
rdfs:range .
obo:UO_1000084 a rdfs:Class ;
rdfs:label "gram per cubic centimeter based unit" ;
rdfs:subClassOf obo:UO_0000052 .
obo:ENVO_00000233 a rdfs:Class ;
rdfs:label "swamp ecosystem" ;
rdfs:comment "A wetland ecosystem in which land mass is permanently inundated by shallow bodies of water, generally with a substantial number of hummocks, or dry-land protrusions." ;
rdfs:subClassOf obo:ENVO_01001209 .
obo:RBO_00002011 a rdfs:Class ;
rdfs:label "unplanned naturally occurring radiation exposure" ;
rdfs:comment "Incidental exposure to naturally occurring radiation in a natural or anthropogenic environment, such as geographical areas with high background levels of radiation or specific locations such as Uranium mines." ;
rdfs:subClassOf obo:RBO_00002004 .
obo:GO_0016772 a rdfs:Class ;
rdfs:label "transferase activity, transferring phosphorus-containing groups" ;
rdfs:subClassOf obo:GO_0016740 .
obo:SLSO_0000031 a rdfs:Class ;
rdfs:label "personnel" ;
rdfs:comment "Persons employed in any field." ;
rdfs:subClassOf obo:NCBITaxon_9606 , obo:SDDO_3000090 .
obo:SLSO_0001079 a rdf:Property ;
rdfs:label "first name" ;
rdfs:comment "The given name associated with the object" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:SLSO_0001062 a rdf:Property ;
rdfs:label "last name" ;
rdfs:comment "The family name associated with the object" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:SLSO_0000001 a rdf:Property ;
rdfs:label "operates" ;
rdfs:range .
obo:SLSO_0001089 a rdf:Property ;
rdfs:label "per_id" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:RO_0002350 a rdf:Property ;
rdfs:label "is member of" ;
rdfs:comment "is member of is a mereological relation between a item and a collection." ;
rdfs:range ;
rdfs:subPropertyOf obo:BFO_0000050 .
obo:SLSO_0001107 a rdf:Property ;
rdfs:label "middle name" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:SDDO_3000034 a rdf:Property ;
rdfs:label "hasRole"@en ;
rdfs:range .
obo:SLSO_0001099 a rdf:Property ;
rdfs:label "city" ;
rdfs:comment "The city or town associated with the address of the object. cf. vcard:locality" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:RBO_00002034 a rdfs:Class ;
rdfs:label "holistic approaches to governance study" ;
rdfs:comment "Sociological, attitudinal, ethocolegal and regulatory approaches to governance of radiation and radioactive substance use." ;
rdfs:subClassOf obo:RBO_00002013 .
obo:RBO_00000107 a rdfs:Class ;
rdfs:label "toxicity study" ;
rdfs:comment "A study of the toxicity of chemical or biological agents on cells or whole organisms." ;
rdfs:subClassOf obo:RBO_00000082 .
obo:ENVO_01001185 a rdfs:Class ;
rdfs:label "acidic soil"@en ;
rdfs:comment "Soil which has increased levels of molecules or ions capable of donating a hydron (proton or hydrogen ion) to other chemical entities, or, alternatively, capable of forming covalent bonds with other chemicals via the acceptance of an electron pair, resulting in a bulk pH measurement of less than 7." ;
rdfs:subClassOf obo:ENVO_00001998 .
obo:UO_1000062 a rdfs:Class ;
rdfs:label "molar based unit" ;
rdfs:subClassOf obo:UO_0000061 .
obo:CHEBI_24432 a rdfs:Class ;
rdfs:label "biological role" ;
rdfs:comment "A role played by the molecular entity or part thereof within a biological context." ;
rdfs:subClassOf obo:BFO_0000023 , obo:CHEBI_50906 .
obo:CHEBI_27081 a rdfs:Class ;
rdfs:label "transition element atom" ;
rdfs:comment "An element whose atom has an incomplete d sub-shell, or which can give rise to cations with an incomplete d sub-shell." ;
rdfs:subClassOf obo:CHEBI_33521 .
obo:UBERON_0010000 a rdfs:Class ;
rdfs:label "multicellular anatomical structure" ;
rdfs:comment "An anatomical structure that has more than one cell as a part." ;
rdfs:subClassOf obo:UBERON_0000061 .
obo:UO_1000195 a rdfs:Class ;
rdfs:label "degree Fahrenheit based unit" ;
rdfs:subClassOf obo:UO_0000005 .
obo:ENVO_03600001 a rdfs:Class ;
rdfs:label "chemically contaminated sediment"@en ;
rdfs:comment "Sediment which contains some chemical contaminant."@en ;
rdfs:subClassOf obo:ENVO_00002007 , obo:ENVO_00002114 .
obo:OBI_0000070 a rdfs:Class ;
rdfs:label "assay" ;
rdfs:comment "A planned process with the objective to produce information about the material entity that is the evaluant, by physically examining it or its proxies." ;
rdfs:subClassOf obo:OBI_0000011 .
obo:PATO_0001655 a rdfs:Class ;
rdfs:label "osmolarity" ;
rdfs:comment "A concentration quality inhering in a bearer by virtue of the bearer's amount of osmoles of solute per liter of solution." ;
rdfs:subClassOf obo:PATO_0000033 .
obo:ENVO_01001806 a rdfs:Class ;
rdfs:label "tropical grassland"@en ;
rdfs:comment "A grassland ecosystem which is subject to tropical climatic conditions." ;
rdfs:subClassOf obo:ENVO_01001206 , obo:ENVO_01001701 .
obo:PATO_0015022 a rdfs:Class ;
rdfs:label "increased combustibility" ;
rdfs:comment "An increase in combustibility." ;
rdfs:subClassOf obo:PATO_0002305 , obo:PATO_0015021 .
obo:PATO_0000033 a rdfs:Class ;
rdfs:label "concentration of" ;
rdfs:comment "A quality inhering in a substance by virtue of the amount of the bearer's there is mixed with another substance." ;
rdfs:subClassOf obo:PATO_0002182 .
obo:RBO_00000079 a rdfs:Class ;
rdfs:label "medical professional" ;
rdfs:subClassOf obo:RBO_00000111 .
obo:ENVO_09000026 a rdfs:Class ;
rdfs:label "concentration of liquid water in soil" ;
rdfs:comment "The concentration of a liquid water when measured in soil." ;
rdfs:subClassOf obo:PATO_0000033 .
obo:CHEBI_78295 a rdfs:Class ;
rdfs:label "food component" ;
rdfs:comment "A physiological role played by any substance that is distributed in foodstuffs. It includes materials derived from plants or animals, such as vitamins or minerals, as well as environmental contaminants." ;
rdfs:subClassOf obo:CHEBI_52211 .
obo:RBO_00000026 a rdfs:Class ;
rdfs:label "cosmic radiation" ;
rdfs:comment "Penetrating ionizing radiation, both particulate and electromagnetic, that originates in outer space" ;
rdfs:subClassOf obo:RBO_00000002 .
obo:ENVO_00002030 a rdfs:Class ;
rdfs:label "aquatic biome" ;
rdfs:comment "A biome which is determined by a water body and which has ecological climax communities adapted to life in or on water." ;
rdfs:subClassOf obo:ENVO_00000428 , obo:ENVO_01001787 .
obo:ENVO_01000832 a rdfs:Class ;
rdfs:label "raindrop"@en ;
rdfs:comment "A droplet formed by condensation of vapour in an atmosphere and which is sufficiently massive to overcome atmospheric resistance and fall to a planetary surface due to gravity." ;
rdfs:subClassOf obo:ENVO_01000831 .
obo:UBERON_0010316 a rdfs:Class ;
rdfs:label "germ layer / neural crest" ;
rdfs:subClassOf obo:UBERON_0002050 , obo:UBERON_0005291 .
obo:RBO_00000050 a rdfs:Class ;
rdfs:label "nuclear reactor radiation" ;
rdfs:comment "Radiation produced by a nuclear reactor." ;
rdfs:subClassOf obo:RBO_00000003 .
obo:ENVO_01000800 a rdfs:Class ;
rdfs:label "planet"@en ;
rdfs:comment "A planet is an astronomical body orbiting a star or stellar remnant that is massive enough to be rounded by its own gravity, is not massive enough to cause thermonuclear fusion, and has cleared its neighbouring region of planetesimals." ;
rdfs:subClassOf obo:ENVO_01000799 .
obo:ENVO_01001089 a rdfs:Class ;
rdfs:label "aerosolised solids"@en ;
rdfs:comment "An aerosol which has non-gaseous parts that are primarily composed of solid particles." ;
rdfs:subClassOf obo:ENVO_00010505 .
obo:CHEBI_35406 a rdfs:Class ;
rdfs:label "oxoanion" ;
rdfs:comment "An oxoanion is an anion derived from an oxoacid by loss of hydron(s) bound to oxygen." ;
rdfs:subClassOf obo:CHEBI_25741 , obo:CHEBI_33273 .
obo:UO_1010023 a rdfs:Class ;
rdfs:label "perch based unit" ;
rdfs:subClassOf obo:UO_0000047 .
obo:ENVO_01001767 a rdfs:Class ;
rdfs:label "structural collapse process"@en ;
rdfs:comment "A process during which the ability of a material entity to maintain its internal organisation fails, resulting in deformation and a breakdown of that organisation." ;
rdfs:subClassOf obo:ENVO_01001852 .
obo:GO_0008152 a rdfs:Class ;
rdfs:label "metabolic process" ;
rdfs:comment "The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation." ;
rdfs:subClassOf obo:GO_0008150 .
obo:UO_1000269 a rdfs:Class ;
rdfs:label "absorbance unit based unit" ;
rdfs:subClassOf obo:UO_0000186 .
obo:ENVO_01003012 a rdfs:Class ;
rdfs:label "advective"@en ;
rdfs:comment "A physical quality of a process which is characteristic of process that transport material without, themselves, changing the qualities of those materials or the processes that are unfolding within them."@en ;
rdfs:subClassOf obo:PATO_0002062 .
obo:CHEBI_33674 a rdfs:Class ;
rdfs:label "s-block molecular entity" ;
rdfs:comment "An s-block molecular entity is a molecular entity containing one or more atoms of an s-block element." ;
rdfs:subClassOf obo:CHEBI_33579 .
obo:ENVO_01000281 a rdfs:Class ;
rdfs:label "layer" ;
rdfs:comment "A material entity which 1) is spatially continuous, 2) is composed of material of comparable thickness, composition, and physical properties, and 3) is physically distinct from adjacent portions of environmental material."@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:UO_0000055 a rdfs:Class ;
rdfs:label "molar mass unit" ;
rdfs:comment "\"A unit which is a standard measure of the mass of a homogeneous substance containing 6.02 x 1023 atoms or molecules.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000002 .
obo:SO_0001026 a rdfs:Class ;
rdfs:label "genome" ;
rdfs:comment "A collection of sequence features (typically a collection of chromosomes) that covers the sum genetic material within a cell or virion (where 'genetic material' refers to any nucleic acid that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or can be replicated and inherited by its progeny)" ;
rdfs:subClassOf obo:GENO_0000660 .
obo:UO_1000221 a rdfs:Class ;
rdfs:label "dalton based unit" ;
rdfs:subClassOf obo:UO_0000002 .
obo:RBO_00000015 a rdfs:Class ;
rdfs:label "mixed radiation" ;
rdfs:comment "The process of exposing the same sample to more than one type and/or energy of radiation, in sequence or simultaneously." ;
rdfs:subClassOf obo:RBO_00000049 .
obo:SLSO_0000029 a rdfs:Class ;
rdfs:label "image (LSDA)" ;
rdfs:comment "A document that is an affine projection to a two dimensional surface, of EM spectrum radiation or measurements of some quality of an entity or entities repeated at regular intervals across a spatial range (where the measurements are represented as color and luminosity on the projected surface.)" ;
rdfs:subClassOf obo:IAO_0000101 .
obo:SLSO_0000007 a rdf:Property ;
rdfs:label "depicts" ;
rdfs:range .
obo:UO_0000095 a rdfs:Class ;
rdfs:label "volume unit" ;
rdfs:comment "\"A unit which is a standard measure of the amount of space occupied by any substance, whether solid, liquid, or gas.\" [NIST:NIST]" ;
rdfs:subClassOf obo:IAO_0000003 , obo:UO_0000000 .
obo:PATO_0001729 a rdfs:Class ;
rdfs:label "shedability" ;
rdfs:comment "An organismal quality inhering in a bearer by virtue of the bearer's disposition to lose an entity by natural process." ;
rdfs:subClassOf obo:PATO_0001995 .
obo:RBO_00002107 a rdfs:Class ;
rdfs:label "radiotherapeutic modelling study" ;
rdfs:comment "Mathematical modelling for theraputic regime optimisation and for optimal tumor response, for example modelling spatiotemporal dynamics of tumor and blood volume fraction, and predicting response to radiation therapy. Also studies for beam modelling and multiimaging techniques." ;
rdfs:subClassOf obo:RBO_00002053 .
obo:ENVO_02500041 a rdfs:Class ;
rdfs:label "environmental monitoring" ;
rdfs:comment "An process in which environmental parameters and variables are continually assayed." ;
rdfs:subClassOf obo:OBI_0000011 .
obo:UO_1010034 a rdfs:Class ;
rdfs:label "pound based unit" ;
rdfs:subClassOf obo:UO_0000002 .
obo:RBO_00005020 a rdfs:Class ;
rdfs:label "cis-mars space" ;
rdfs:comment "The region of space between the Earth and Mars" ;
rdfs:subClassOf obo:RBO_00000016 .
obo:CHEBI_25414 a rdfs:Class ;
rdfs:label "monoatomic monocation" ;
rdfs:subClassOf obo:CHEBI_23906 .
obo:CHEBI_79388 a rdfs:Class ;
rdfs:label "divalent inorganic anion" ;
rdfs:comment "Any inorganic anion with a valency of two." ;
rdfs:subClassOf obo:CHEBI_24834 .
obo:SLSO_0000051 a rdfs:Class ;
rdfs:label "low earth orbit spacecraft" ;
rdfs:comment "A vehicle operating or capable of operating in an extraterrestrial environment between the Earth's atmosphere and the innermost Earth radiation belt" ;
rdfs:subClassOf obo:SLSO_0000032 .
obo:CHEBI_33521 a rdfs:Class ;
rdfs:label "metal atom" ;
rdfs:comment "An atom of an element that exhibits typical metallic properties, being typically shiny, with high electrical and thermal conductivity." ;
rdfs:subClassOf obo:CHEBI_33250 .
obo:ENVO_00000428 a rdfs:Class ;
rdfs:label "biome" ;
rdfs:comment "A biome is an ecosystem which is undergoing climactic ecological succession."@en ;
rdfs:subClassOf obo:ENVO_01000813 , obo:ENVO_01001110 .
obo:UO_0000128 a rdfs:Class ;
rdfs:label "activity (of a radionuclide) unit" ;
rdfs:comment "\"A unit which is a standard measure of the transformation (disintegration) rate of a radioactive substance.\" [DEFRA:DEFRA]" ;
rdfs:subClassOf obo:UO_0000127 .
obo:RBO_00000061 a rdfs:Class ;
rdfs:label "actinide" ;
rdfs:comment "A series of radioactive elements from ACTINIUM, atomic number 89, to and including LAWRENCIUM, atomic number 103" ;
rdfs:subClassOf obo:RBO_00000060 .
obo:RBO_00000100 a rdfs:Class ;
rdfs:label "gene expression study" ;
rdfs:comment "A study of the effects of radiation on gene expression." ;
rdfs:subClassOf obo:RBO_00000082 .
obo:CHEBI_33704 a rdfs:Class ;
rdfs:label "alpha-amino acid" ;
rdfs:comment "An amino acid in which the amino group is located on the carbon atom at the position alpha to the carboxy group." ;
rdfs:subClassOf obo:CHEBI_33709 .
obo:UBERON_0007010 a rdfs:Class ;
rdfs:label "cleaving embryo" ;
rdfs:comment "Organism at the cleavage stage." ;
rdfs:subClassOf obo:UBERON_0000922 .
obo:ENVO_01001705 a rdfs:Class ;
rdfs:label "temperate environment"@en ;
rdfs:comment "An environment which is located in a part of an astronomical body subject to temperate climatic conditions."@en ;
rdfs:subClassOf obo:ENVO_01000254 .
obo:PO_0006001 a rdfs:Class ;
rdfs:label "phyllome" ;
rdfs:comment "A lateral plant organ (PO:0009008) produced by a shoot apical meristem (PO:0020148)." ;
rdfs:subClassOf obo:PO_0009008 .
obo:ENVO_2100004 a rdfs:Class ;
rdfs:label "integumental system environment" ;
rdfs:subClassOf obo:ENVO_2100000 .
obo:UO_0000166 a rdfs:Class ;
rdfs:label "parts per notation unit" ;
rdfs:comment "\"A dimensionless concentration notation which describes the amount of one substance in another. It is the ratio of the amount of the substance of interest to the amount of that substance plus the amount of the substance.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000186 .
obo:ENVO_01001619 a rdfs:Class ;
rdfs:label "snow and ice accumulation process"@en ;
rdfs:comment "A material accumulation process during which a accumulation of snow and ice forms or increases in mass." ;
rdfs:subClassOf obo:ENVO_02500031 , obo:ENVO_03000009 .
obo:RO_0002297 a rdf:Property ;
rdfs:label "results in formation of"@en ;
rdfs:domain obo:GO_0008150 ;
rdfs:range obo:CARO_0000000 ;
rdfs:subPropertyOf obo:RO_0002295 , obo:RO_0002234 .
obo:ENVO_02500001 a rdfs:Class ;
rdfs:label "desertification"@en ;
rdfs:comment "A type of land degradation in which terrestrial ecosystem becomes increasingly dry, typically losing its bodies of water as well as vegetation and wildlife." ;
rdfs:subClassOf obo:ENVO_02500005 .
obo:UO_1000285 a rdfs:Class ;
rdfs:label "count per molar based unit" ;
rdfs:subClassOf obo:UO_0000280 .
obo:ENVO_00002203 a rdfs:Class ;
rdfs:label "inorganically enriched sediment" ;
rdfs:comment "Chemically-enriched sediment which has increased levels of inorganic compounds." ;
rdfs:subClassOf obo:ENVO_00002114 .
obo:ENVO_09200013 a rdfs:Class ;
rdfs:label "wetness of soil" ;
rdfs:comment "The wetness of some soil." ;
rdfs:subClassOf obo:PATO_0001822 .
obo:ENVO_01000349 a rdfs:Class ;
rdfs:label "root matter" ;
rdfs:comment "An organic material primarily composed of a portion of plant root." ;
rdfs:subClassOf obo:ENVO_01000155 .
obo:SDDO_3000109 a rdfs:Class ;
rdfs:label "document"@en ;
rdfs:comment "A written or printed paper that bears the original, official, or legal form of something and can be used to furnish decisive evidence or information." ;
rdfs:subClassOf obo:IAO_0000310 , obo:SDDO_3000079 .
obo:CHEBI_29067 a rdfs:Class ;
rdfs:label "carboxylic acid anion" ;
rdfs:comment "The conjugate base formed when the carboxy group of a carboxylic acid is deprotonated." ;
rdfs:subClassOf obo:CHEBI_25696 , obo:CHEBI_35406 .
obo:ENVO_01000506 a rdfs:Class ;
rdfs:label "concrete exterior wall" ;
rdfs:comment "A concrete exterior wall is an exterior wall that is composed primarily of concrete." ;
rdfs:subClassOf obo:ENVO_01000469 .
obo:IAO_0000100 a rdfs:Class ;
rdfs:label "data set"@en ;
rdfs:comment "A data item that is an aggregate of other data items of the same type that have something in common. Averages and distributions can be determined for data sets."@en ;
rdfs:subClassOf obo:IAO_0000027 .
obo:RBO_00005030 a rdfs:Class ;
rdfs:label "radiation fraction interval" ;
rdfs:comment "Time between fractions in a fractionated irradiation." ;
rdfs:subClassOf obo:RBO_00000029 .
obo:RBO_00002100 a rdfs:Class ;
rdfs:label "public communication study" ;
rdfs:comment "Study on the modality, efficacy and responses to communication of information or advice to populations or individuals, on the safety and risks of exposure to ionising radiation in any context." ;
rdfs:subClassOf obo:RBO_00002026 .
obo:ENVO_02000105 a rdfs:Class ;
rdfs:label "clay dust" ;
rdfs:comment "Dust which is derived from clay material." ;
rdfs:subClassOf obo:ENVO_00002008 .
a rdfs:Class ;
rdfs:label "Individual"@en ;
rdfs:comment "An object representing a single person or entity"@en ;
rdfs:subClassOf , .
obo:CHEBI_33700 a rdfs:Class ;
rdfs:label "proteinogenic amino-acid residue" ;
rdfs:subClassOf obo:CHEBI_33710 .
a rdf:Property ;
rdfs:label "is substituent group from" ;
rdfs:range .
obo:RBO_00002118 a rdfs:Class ;
rdfs:label "radioactive decay" ;
rdfs:comment "A process involving the emission of energy from an atomic nucleus resulting in change in the character of the nucleus" ;
rdfs:subClassOf obo:OBI_0000011 , obo:RBO_00015006 .
obo:ENVO_01001053 a rdfs:Class ;
rdfs:label "saline aerosol environment"@en ;
rdfs:comment "An environmental system which has its properties and dynamics determined by a saline aerosol." ;
rdfs:subClassOf obo:ENVO_01001040 , obo:ENVO_01001052 .
obo:PATO_0002323 a rdfs:Class ;
rdfs:label "temporal distribution quality" ;
rdfs:comment "A temporal distribution pattern of process occurrences within a regulation/reference process." ;
rdfs:subClassOf obo:PATO_0002062 .
obo:RBO_00000016 a rdfs:Class ;
rdfs:label "radiation environment" ;
rdfs:comment "Radiation classified by where the exposure to the radiation is occurring." ;
rdfs:subClassOf obo:ENVO_01000254 .
obo:ENVO_01001832 a rdfs:Class ;
rdfs:label "subtropical biome"@en ;
rdfs:comment "A biome which is subject to subtropical climatic conditions." ;
rdfs:subClassOf obo:ENVO_00000428 , obo:ENVO_01001702 .
obo:ENVO_01000355 a rdfs:Class ;
rdfs:label "vegetation layer" ;
rdfs:comment "A layer which is determined by a form of vegetation." ;
rdfs:subClassOf obo:ENVO_01000281 .
obo:SDDO_3000094 a rdfs:Class ;
rdfs:label "experiment"@en ;
rdfs:comment "A plan for a coordinated set of actions and observations designed to generate data, with the ultimate goal of discovery or hypothesis testing." ;
rdfs:subClassOf obo:OBI_0000011 .
obo:SDDO_3000042 a rdf:Property ;
rdfs:label "partOf"@en ;
rdfs:range .
obo:SDDO_3000008 a rdf:Property ;
rdfs:label "generates"@en ;
rdfs:range .
obo:SDDO_3000036 a rdf:Property ;
rdfs:label "conductedOn"@en ;
rdfs:range .
obo:SDDO_3000023 a rdf:Property ;
rdfs:label "conductedAt"@en ;
rdfs:range .
obo:SDDO_3000013 a rdf:Property ;
rdfs:label "componentOf"@en ;
rdfs:range .
obo:ENVO_01001147 a rdfs:Class ;
rdfs:label "helium planet"@en ;
rdfs:comment "A gas planet which has an atmosphere composed primarily of helium." ;
rdfs:subClassOf obo:ENVO_01001122 .
obo:RBO_00005002 a rdfs:Class ;
rdfs:label "light ion radiation" ;
rdfs:comment "Atomic nuclei, variously defined as having atomic number 2, 3, 4, 5 or 6 and kinetic energy imparted by natural or artificial means" ;
rdfs:subClassOf obo:RBO_00000117 .
obo:CL_0000000 a rdfs:Class .
obo:UO_1010021 a rdfs:Class ;
rdfs:label "cable based unit" .
obo:ENVO_01000184 a rdfs:Class ;
rdfs:label "subtropical desert biome" ;
rdfs:comment "A subtropical desert biome is a desert biome which has communities adapted to temperatures above a monthly average of 18 degrees Celsius, high daily temperature ranges of approximately 20 degrees Celsius, high insolation (but lower than that of a tropical desert biome), inhibited cloud formation, and very low precipitation. Subtropical desert biomes located near coasts with cold upwellings may have cooler temperatures and reduced insolution due to fog." ;
rdfs:subClassOf obo:ENVO_01000179 , obo:ENVO_01001832 .
obo:CHEBI_51151 a rdfs:Class ;
rdfs:label "dipolar compound" ;
rdfs:comment "An organic molecule that is electrically neutral carrying a positive and a negative charge in one of its major canonical descriptions. In most dipolar compounds the charges are delocalized; however the term is also applied to species where this is not the case." ;
rdfs:subClassOf obo:CHEBI_72695 .
obo:CHEBI_25696 a rdfs:Class ;
rdfs:label "organic anion" ;
rdfs:comment "Any organic ion with a net negative charge." ;
rdfs:subClassOf obo:CHEBI_22563 , obo:CHEBI_25699 .
obo:RBO_00000046 a rdfs:Class ;
rdfs:label "space station" ;
rdfs:comment "A spacecraft capable of supporting a human crew in orbit for an extended period of time. It lacks major propulsion or landing systems. Stations must have docking ports to allow other spacecraft to dock to transfer crew and supplies." ;
rdfs:subClassOf obo:RBO_00000033 .
obo:IAO_0000309 a rdfs:Class ;
rdfs:label "diagram"@en ;
rdfs:comment "A figure that expresses one or more propositions"@en ;
rdfs:subClassOf obo:IAO_0000308 .
obo:ENVO_01000639 a rdfs:Class ;
rdfs:label "planetary structural layer"@en ;
rdfs:comment "A planetary structural layer is laminar part of a terrestrial planet or other rocky body large enough to have differentiation by density. Planetary layers have differing physicochemical properties and composition." ;
rdfs:subClassOf obo:ENVO_01000281 , obo:ENVO_01000813 .
a rdfs:Class ;
rdfs:label "software" ;
rdfs:comment "Computer software, or generally just software, is any set of machine-readable instructions (most often in the form of a computer program) that conform to a given syntax (sometimes referred to as a language) that is interpretable by a given processor and that directs a computer's processor to perform specific operations." ;
rdfs:subClassOf obo:IAO_0000033 .
obo:BFO_0000027 a rdfs:Class ;
rdfs:label "object aggregate"@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:ENVO_00002007 a rdfs:Class ;
rdfs:label "sediment" ;
rdfs:comment "Particulate environmental material which is formed as a result of the transport and deposition of particles by flowing liquid."@en ;
rdfs:subClassOf obo:ENVO_01000060 .
obo:RBO_00015002 a rdfs:Class ;
rdfs:label "nanodosimetry assay" ;
rdfs:comment "An assay of the pattern (frequency and spatial distribution) of ionization events produced by energy deposition in time and space in a substance characterized by linear dimensions of the order of 1-100 nanometers" ;
rdfs:subClassOf obo:RBO_00005041 .
obo:BFO_0000057 a rdf:Property ;
rdfs:label "has participant" ;
rdfs:range .
obo:CHEBI_35238 a rdfs:Class ;
rdfs:label "amino acid zwitterion" ;
rdfs:comment "The zwitterionic form of an amino acid having a negatively charged carboxyl group and a positively charged amino group." ;
rdfs:subClassOf obo:CHEBI_27369 .
obo:SLSO_0000056 a rdfs:Class ;
rdfs:label "low earth orbit space flight" ;
rdfs:comment "Activity carried out by crewed or robotic vehicles outside the Earth's atmosphere but inside the Earth's inner radiation belt." ;
rdfs:subClassOf obo:RBO_00005009 , obo:SLSO_0000055 .
obo:UO_1000210 a rdfs:Class ;
rdfs:label "colony forming unit based unit" ;
rdfs:subClassOf obo:UO_0000189 .
obo:ENVO_01001565 a rdfs:Class ;
rdfs:label "water-based rain"@en ;
rdfs:comment "Rain which is composed of water droplets falling to a planetary surface during a rainfall process." ;
rdfs:subClassOf obo:ENVO_01001564 .
obo:SLSO_0000024 a rdfs:Class ;
rdfs:label "investigator (human)" ;
rdfs:comment "An individual who conducts scientific research. The investigator collects and analyses data and study documents, and provides reports in compliance with applicable requirements" ;
rdfs:subClassOf obo:SLSO_0000031 .
obo:SLSO_0001150 a rdf:Property ;
rdfs:label "image description" ;
rdfs:domain obo:SLSO_0000024 ;
rdfs:range .
obo:SLSO_0001101 a rdf:Property ;
rdfs:label "file thumbnail" ;
rdfs:comment "owl:equivalentProperty http://purl.obolibrary.org/obo/NCIT_C91820" ;
rdfs:domain obo:SLSO_0000024 ;
rdfs:range ;
rdfs:subPropertyOf obo:NCIT_C91820 .
obo:SLSO_0001154 a rdf:Property ;
rdfs:label "image name" ;
rdfs:domain obo:SLSO_0000024 ;
rdfs:range .
obo:ENVO_01000887 a rdfs:Class ;
rdfs:label "area of sedge- and forb-dominated herbaceous vegetation"@en ;
rdfs:comment "An area of a planet's surface which is primarily covered by sedges or forbs, possibly interpersed with grasses or grass-like plants. This area is in contact with an atmospheric column extending from the planetary boundary layer to the planet's exosphere with little to no physical obstruction." ;
rdfs:subClassOf obo:ENVO_01001305 .
obo:UO_1000169 a rdfs:Class ;
rdfs:label "parts per million based unit" ;
rdfs:subClassOf obo:UO_0000166 .
obo:ENVO_01001502 a rdfs:Class ;
rdfs:label "visible spectrum radiation from a manufactured product"@en ;
rdfs:comment "Radiation from a manufactured product during which light between the wavelenghts of 380 nm and 760 nm is emitted." ;
rdfs:subClassOf obo:ENVO_01001501 .
obo:RBO_00000076 a rdfs:Class ;
rdfs:label "nuclear industry worker" ;
rdfs:comment "A person employed or otherwise working in commercial activities where nuclear materials are created, handled or disposed and at risk of occupational radiation exposure. Excludes health workers." ;
rdfs:subClassOf obo:RBO_00000111 .
obo:ENVO_01001367 a rdfs:Class ;
rdfs:label "primary aerosol formation process"@en ;
rdfs:comment "A material transport process during which solid or liquid particles are directly introduced into a volume of gas." ;
rdfs:subClassOf obo:ENVO_03000010 .
obo:UO_1010016 a rdfs:Class ;
rdfs:label "furlong based unit" ;
rdfs:subClassOf obo:UO_0000001 .
obo:ENVO_01001688 a rdfs:Class ;
rdfs:label "mass of fluid"@en ;
rdfs:comment "An object which is composed primarily of a fluid."@en ;
rdfs:subClassOf obo:ENVO_01001686 .
obo:PCO_0000002 a rdfs:Class ;
rdfs:label "ecological community"@en ;
rdfs:comment "A multi-species collection of organisms of at least two different species, living in a particular area. Must have at least two populations of different species as members."@en ;
rdfs:subClassOf obo:PCO_0000029 .
obo:RBO_00002041 a rdfs:Class ;
rdfs:label "registry study" ;
rdfs:comment "Observational studies which include an organized system that uses observational methods to collect uniform data (clinical and other) prospectively for a population defined by a particular disorder/disease, condition (including susceptibility to a disorder), or exposure (including products, health care services, and/or procedures) and that serves a predetermined scientific, clinical, or policy purpose. Patient registries may be single purpose or on-going data collection programs that address one or more questions. (AHRQ) An observational study that is also considered to be a Patient Registry." ;
rdfs:subClassOf obo:RBO_00000083 .
obo:RBO_00005041 a rdfs:Class ;
rdfs:label "radiation dosimetry" ;
rdfs:comment "The measurement of the amount of radiation taken up by a sample." ;
rdfs:subClassOf obo:CHMO_0002796 .
obo:UO_0000115 a rdfs:Class ;
rdfs:label "illuminance unit" ;
rdfs:comment "\"A unit which is a standard measure of the luminous flux incident on a unit area.\" [Wikipedia:Wikipedia]" ;
rdfs:subClassOf obo:UO_0000157 .
obo:UO_1000258 a rdfs:Class ;
rdfs:label "poise based unit" ;
rdfs:subClassOf obo:UO_0000256 .
obo:PATO_0001733 a rdfs:Class ;
rdfs:label "evergreen (plant)" ;
rdfs:comment "A quality inhering in a plant by virtue of the bearer's disposition to retain foliage." ;
rdfs:subClassOf obo:PATO_0001729 .
obo:ENVO_01000860 a rdfs:Class ;
rdfs:label "temperate marine upwelling biome"@en ;
rdfs:comment "A marine upwelling biome which is located in a region subject to temperate climate patterns." ;
rdfs:subClassOf obo:ENVO_01000858 , obo:ENVO_01001831 .
obo:UO_1000132 a rdfs:Class ;
rdfs:label "becquerel based unit" ;
rdfs:subClassOf obo:UO_0000128 .
obo:ENVO_01000514 a rdfs:Class ;
rdfs:label "tile" ;
rdfs:comment "A tile is a manufactured piece of hard-wearing material such as ceramic, stone, metal, or even glass, generally used for covering roofs, floors, walls, showers, or other objects such as tabletops. Alternatively, tile can sometimes refer to similar units made from lightweight materials such as perlite, wood, and mineral wool, typically used for wall and ceiling applications." ;
rdfs:subClassOf obo:ENVO_00003074 .
obo:UO_1000216 a rdfs:Class ;
rdfs:label "disintegrations per second based unit" ;
rdfs:subClassOf obo:UO_0000128 .
obo:IAO_0000572 a rdfs:Class ;
rdfs:label "documenting"@en ;
rdfs:comment "A planned process in which a document is created or added to by including the specified input in it."@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:UBERON_0000490 a rdfs:Class ;
rdfs:label "unilaminar epithelium" ;
rdfs:comment "Epithelium which consists of a single layer of epithelial cells. Examples: endothelium, mesothelium, glandular squamous epithelium.[FMA]." ;
rdfs:subClassOf obo:UBERON_0000483 .
obo:PATO_0002198 a rdfs:Class ;
rdfs:label "quality of a substance" ;
rdfs:comment "A quality inhering in a bearer by virtue of its constitution." ;
rdfs:subClassOf obo:PATO_0001018 .
obo:ENVO_00002267 a rdfs:Class ;
rdfs:label "industrial waste material" ;
rdfs:comment "Industrial wastes are liquid, solid and gaseous wastes originating from the manufacture of specific products." ;
rdfs:subClassOf obo:ENVO_00002264 .
obo:ENVO_01000328 a rdfs:Class ;
rdfs:label "dome swamp" ;
rdfs:comment "A dome swamp is a swamp which occurs in a depression where deeper waters at the centre of the swamp allow trees to grow taller relative to those in shallower regions of the depression. This creates a dome-like shape." ;
rdfs:subClassOf obo:ENVO_00000233 .
obo:CHEBI_33267 a rdfs:Class ;
rdfs:label "elemental nitrogen" ;
rdfs:subClassOf obo:CHEBI_33465 , obo:CHEBI_51143 .
obo:BFO_0000023 a rdfs:Class ;
rdfs:label "role"@en ;
rdfs:comment "A realizable entity the manifestation of which brings about some result or end that is not essential to a continuant in virtue of the kind of thing that it is but that can be served or participated in by that kind of continuant in some kinds of natural, social or institutional contexts."@en .
obo:CHEBI_49637 a rdfs:Class ;
rdfs:label "hydrogen atom" ;
rdfs:subClassOf obo:CHEBI_24835 , obo:CHEBI_25585 , obo:CHEBI_33559 .
obo:ENVO_01000669 a rdfs:Class ;
rdfs:label "active geological fault"@en ;
rdfs:comment "An active fault is a fault that is likely to become the source of another earthquake sometime in the future. Geologists commonly consider faults to be active if there has been movement observed or evidence of seismic activity during the last 10,000 years." ;
rdfs:subClassOf obo:ENVO_01000668 .
obo:ENVO_02500012 a rdfs:Class ;
rdfs:label "deforestation" ;
rdfs:comment "An ecosystem process during which the flora and fauna belonging to a forest are removed or destroyed." ;
rdfs:subClassOf obo:ENVO_01001795 .
obo:ENVO_01003001 a rdfs:Class ;
rdfs:label "water-holding capacity"@en ;
rdfs:comment "A disposition of a material entity which is realised when it is saturated with liquid water."@en ;
rdfs:subClassOf obo:BFO_0000016 .
obo:RBO_00002009 a rdfs:Class ;
rdfs:label "accidental anthropogenic radiation exposure" ;
rdfs:comment "Accidental or incidental exposure to radiation from a man made process or machine. Covers both radiation accidents and routine occupational exposure." ;
rdfs:subClassOf obo:RBO_00002007 .
obo:RBO_00002052 a rdfs:Class ;
rdfs:label "radiotherapy study" ;
rdfs:comment "Study of the efficacy, outcomes and adverse consequences of exposure to therapeutic use of ionizing and nonionizing radiation including RADIONUCLIDE THERAPY, therapeutic radiation with visible, laser, or ultraviolet light. Includes technical development of protocols and equipment." ;
rdfs:subClassOf obo:RBO_00002017 .
obo:CHEBI_30222 a rdfs:Class ;
rdfs:label "neutron" ;
rdfs:comment "Nuclear particle of zero charge, spin 1/2 and rest mass of 1.008664904(14) u." ;
rdfs:subClassOf obo:CHEBI_33253 .
obo:ENVO_01000205 a rdfs:Class ;
rdfs:label "subtropical" ;
rdfs:comment "A subtropical condition is an environmental condition in which an envrionmental system receives more solar irradiance than those with temperate conditions, but less than those with tropical conditions. At low elevations, this typically results in eight months of the year having average temperatures greater than or equal to 10 degrees Celsius with the coldest monthly temperature averaging between 2 and 13 degrees Celsius." ;
rdfs:subClassOf obo:ENVO_01000203 .
obo:CHEBI_23114 a rdfs:Class ;
rdfs:label "chloride salt" ;
rdfs:subClassOf obo:CHEBI_23117 , obo:CHEBI_33958 .
obo:SDDO_3000044 a rdfs:Class ;
rdfs:label "event"@en ;
rdfs:comment "Something observable that happened at a given time and place" ;
rdfs:subClassOf obo:BFO_0000015 , obo:SDDO_3000099 .
obo:RBO_00000011 a rdfs:Class ;
rdfs:label "active dosimeter" ;
rdfs:comment "A radiation measuring device which records dose at the time of detection, with data available in real time" ;
rdfs:subClassOf obo:RBO_00000115 .
obo:ENVO_01001828 a rdfs:Class ;
rdfs:label "anthropised ecosystem"@en ;
rdfs:comment "An ecosystem which is formed as a result of human activity or impact."@en ;
rdfs:subClassOf obo:ENVO_01000313 , obo:ENVO_01001110 .
obo:ENVO_01000176 a rdfs:Class ;
rdfs:label "shrubland biome" ;
rdfs:comment "A shrubland biome is a terrestrial biome which includes, across its entire spatial extent, dense groups of shrubs." ;
rdfs:subClassOf obo:ENVO_00000446 .
obo:PO_0009007 a rdfs:Class ;
rdfs:label "portion of plant tissue" ;
rdfs:comment "A plant structure (PO:0009011) that consists predominantly of similarly specialized plant cells (PO:0009002) of one or more types." ;
rdfs:subClassOf obo:PO_0009011 .
obo:ENVO_02500028 a rdfs:Class ;
rdfs:label "planetary erosion" ;
rdfs:comment "An action of exogenic processes (such as water flow or wind) which remove environmental material from one part of a planet's crust, transporting it to another location where it is deposited." ;
rdfs:subClassOf obo:ENVO_01001346 .
obo:ENVO_01001085 a rdfs:Class ;
rdfs:label "atmospheric aerosol formation"@en ;
rdfs:comment "An aerosol formation process which occurs in an atmosphere." ;
rdfs:subClassOf obo:ENVO_01001654 , obo:ENVO_02500003 .
obo:CHEBI_33249 a rdfs:Class ;
rdfs:label "organyl group" ;
rdfs:comment "Any organic substituent group, regardless of functional type, having one free valence at a carbon atom." ;
rdfs:subClassOf obo:CHEBI_51447 .
obo:UO_1010051 a rdfs:Class ;
rdfs:label "large calorie based unit" ;
rdfs:subClassOf obo:UO_0000111 .
a rdfs:Class ;
rdfs:label "Contact"@en ;
rdfs:subClassOf .
obo:RBO_00000065 a rdfs:Class ;
rdfs:label "neptunium" ;
rdfs:comment "A radioactive element of the actinide metals family. It has the atomic symbol Np, and atomic number 93." ;
rdfs:subClassOf obo:RBO_00000061 .
obo:GO_0008150 a rdfs:Class ;
rdfs:label "biological_process" ;
rdfs:comment "A biological process represents a specific objective that the organism is genetically programmed to achieve. Biological processes are often described by their outcome or ending state, e.g., the biological process of cell division results in the creation of two daughter cells (a divided cell) from a single parent cell. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence." ;
rdfs:subClassOf obo:BFO_0000015 .
obo:OBI_0000984 a rdfs:Class ;
rdfs:label "dose" ;
rdfs:comment "A measurement datum that measures the quantity of something that may be administered to an organism or that an organism may be exposed to. Quantities of nutrients, drugs, vaccines and toxins are referred to as doses." ;
rdfs:subClassOf obo:IAO_0000109 .
obo:RBO_00000094 a rdfs:Class ;
rdfs:label "acute external exposure study" ;
rdfs:comment "A study of the effects of external irradiation on an organism where the most of the dose is given in a single or small number of fractions closely in time." ;
rdfs:subClassOf obo:RBO_00000091 .
obo:CHEBI_64708 a rdfs:Class ;
rdfs:label "one-carbon compound" ;
rdfs:comment "An organic molecular entity containing a single carbon atom (C1)." ;
rdfs:subClassOf obo:CHEBI_50860 .
a rdfs:Class ;
rdfs:label "Subject Encoding Schemes"@en-US ;
rdfs:comment "A set of subject encoding schemes and/or formats"@en-US .
obo:SLSO_0000035 a rdfs:Class ;
rdfs:label "dataset file" ;
rdfs:comment "A set of related data (either written or electronic) and is a part of a dataset" ;
rdfs:subClassOf obo:IAO_0000027 .
obo:SLSO_0001153 a rdf:Property ;
rdfs:label "s3 file guid" ;
rdfs:domain obo:SLSO_0000035 ;
rdfs:range .
obo:SLSO_0001157 a rdf:Property ;
rdfs:label "file type" ;
rdfs:domain obo:SLSO_0000035 ;
rdfs:range