PREFIX obo:
PREFIX rdf:
PREFIX rdfs:
PREFIX xsd:
obo:GENO_0000481 a rdfs:Class ;
rdfs:label "genomic feature"@en ;
rdfs:comment "A sequence feature (continuous extent of biological sequence) that is of genomic origin (i.e. carries sequence from the genome of a cell or organism)" ;
rdfs:subClassOf obo:GENO_0000897 , obo:SO_0000110 .
obo:RO_0002162 a rdf:Property ;
rdfs:label "in taxon"@en ;
rdfs:comment "x is in taxon y if an only if y is an organism, and the relationship between x and y is one of: part of (reflexive), developmentally preceded by, derives from, secreted by, expressed." ;
rdfs:range .
obo:BFO_0000050 a rdf:Property ;
rdfs:label "part of" ;
rdfs:comment "For continuants: C part_of C' if and only if: given any c that instantiates C at a time t, there is some c' such that c' instantiates C' at time t, and c *part_of* c' at t. For processes: P part_of P' if and only if: given any p that instantiates P at a time t, there is some p' such that p' instantiates P' at time t, and p *part_of* p' at t. (Here *part_of* is the instance-level part-relation.)" ;
rdfs:seeAlso , , , ;
rdfs:range obo:BFO_0000002 , obo:BFO_0000004 , obo:BFO_0000015 , obo:BFO_0000017 , obo:BFO_0000019 , , obo:BFO_0000020 , obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002131 .
obo:RO_0000056 a rdf:Property ;
rdfs:label "participates in" ;
rdfs:comment "a relation between a continuant and a process, in which the continuant is somehow involved in the process" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000003 .
obo:GENO_0000239 a rdf:Property ;
rdfs:label "has_sequence" ;
rdfs:comment "A relationship between an entity that carries a sequence (e.g. a sequence feature or collection), and the sequence it bears." ;
rdfs:range obo:GENO_0000702 .
obo:RO_0002506 a rdf:Property ;
rdfs:label "causal relation between entities" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:GENO_0000903 a rdf:Property ;
rdfs:label "has_location"@en ;
rdfs:comment "A relation linking a sequence feature to the location it occupies on some reference sequence." ;
rdfs:domain obo:SO_0000110 ;
rdfs:range obo:GENO_0000815 .
obo:RO_0002566 a rdf:Property ;
rdfs:label "causally influences" ;
rdfs:comment "The entity or characteristic A is causally upstream of the entity or characteristic B, A having an effect on B. An entity corresponds to any biological type of entity as long as a mass is measurable. A characteristic corresponds to a particular specificity of an entity (e.g., phenotype, shape, size)." ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002506 .
obo:RO_0000058 a rdf:Property ;
rdfs:label "is concretized as"@en ;
rdfs:comment "A relationship between a generically dependent continuant and a specifically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants."@en ;
rdfs:domain obo:BFO_0000031 ;
rdfs:range obo:BFO_0000020 .
a rdfs:Class ;
rdfs:label "Resource Identifier Encoding Schemes"@en-US ;
rdfs:comment "A set of resource identifier encoding schemes and/or formats"@en-US .
obo:NCBITaxon_117571 a rdfs:Class ;
rdfs:label "Euteleostomi" ;
rdfs:subClassOf obo:NCBITaxon_7742 .
obo:RO_0002450 a rdf:Property ;
rdfs:label "directly positively regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that positively regulates an activity performed by B.
For example, A and B may be gene products and binding of B by A positively regulates the kinase activity of B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002448 .
obo:RO_0002449 a rdf:Property ;
rdfs:label "directly negatively regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that negatively regulates an activity performed by B.
For example, A and B may be gene products and binding of B by A negatively regulates the kinase activity of B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002448 .
obo:RO_0001000 a rdf:Property ;
rdfs:label "derives from" ;
rdfs:comment "a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000004 .
obo:RO_0002448 a rdf:Property ;
rdfs:label "directly regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that regulates an activity performed by B. For example, A and B may be gene products and binding of B by A regulates the kinase activity of B.
A and B can be physically interacting but not necessarily. Immediately upstream means there are no intermediate entity between A and B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0011002 , obo:RO_0002436 .
obo:RO_0011002 a rdf:Property ;
rdfs:label "regulates activity of" ;
rdfs:comment "The entity A has an activity that regulates an activity of the entity B. For example, A and B are gene products where the catalytic activity of A regulates the kinase activity of B." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002566 .
obo:RO_0000087 a rdf:Property ;
rdfs:label "has role"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000023 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0002215 a rdf:Property ;
rdfs:label "capable of"@en ;
rdfs:comment "A relation between a material entity (such as a cell) and a process, in which the material entity has the ability to carry out the process." ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002216 .
obo:OBIB_0000735 a rdf:Property ;
rdfs:label "is owned by"@en ;
rdfs:comment "a is owned by b if b has complete power over a. All rights and obligations of ownership are grounded in this (primitive) relation. The claims and obligations of ownership can be partially transferred to a third party by the owner, b."@en ;
rdfs:range xsd:string .
obo:RO_0000085 a rdf:Property ;
rdfs:label "has function"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a function, in which the function specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000034 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0002595 a rdf:Property ;
rdfs:label "causal relation between material entity and a process" ;
rdfs:comment "A relationship that holds between a material entity and a process in which causality is involved, with either the material entity or some part of the material entity exerting some influence over the process, or the process influencing some aspect of the material entity." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0000091 a rdf:Property ;
rdfs:label "has disposition"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000016 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0002434 a rdf:Property ;
rdfs:label "interacts with" ;
rdfs:comment "A relationship that holds between two entities in which the processes executed by the two entities are causally connected." ;
rdfs:seeAlso ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 .
obo:OBI_0000094 a rdfs:Class ;
rdfs:label "material processing"@en ;
rdfs:comment "A planned process which results in physical changes in a specified input material"@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:BFO_0000062 a rdf:Property ;
rdfs:label "preceded by"@en ;
rdfs:comment "x is preceded by y if and only if the time point at which y ends is before or equivalent to the time point at which x starts. Formally: x preceded by y iff ω(y) <= α(x), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point."@en ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002086 .
obo:BFO_0000063 a rdf:Property ;
rdfs:label "precedes"@en ;
rdfs:comment "x precedes y if and only if the time point at which x ends is before or equivalent to the time point at which y starts. Formally: x precedes y iff ω(x) <= α(y), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point."@en ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002222 .
obo:RO_0002501 a rdf:Property ;
rdfs:label "causal relation between processes" ;
rdfs:comment "p is causally related to q if and only if p or any part of p and q or any part of q are linked by a chain of events where each event pair is one where the execution of p influences the execution of q. p may be upstream, downstream, part of, or a container of q." ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0019000 a rdf:Property ;
rdfs:label "regulates characteristic" ;
rdfs:comment "A relationship that holds between a process and a characteristic in which process (P) regulates characteristic (C) iff: P results in the existence of C OR affects the intensity or magnitude of C." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:PATO_0000001 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:OBI_0000417 a rdf:Property ;
rdfs:label "achieves_planned_objective" ;
rdfs:comment "This relation obtains between a planned process and a objective specification when the criteria specified in the objective specification are met at the end of the planned process." ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:IAO_0000005 .
obo:RO_0002233 a rdf:Property ;
rdfs:label "has input"@en ;
rdfs:comment "p has input c iff: p is a process, c is a material entity, c is a participant in p, c is present at the start of p, and the state of c is modified during p." ;
rdfs:seeAlso ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:RO_0002211 a rdf:Property ;
rdfs:label "regulates"@en ;
rdfs:comment "p regulates q iff p is causally upstream of q, the execution of p is not constant and varies according to specific conditions, and p influences the rate or magnitude of execution of q due to an effect either on some enabler of q or some enabler of a part of q." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002411 .
obo:OBI_0000293 a rdf:Property ;
rdfs:label "has_specified_input"@en ;
rdfs:comment "The inverse property of is_specified_input_of"@en ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:BFO_0000040 , obo:IAO_0000027 , obo:BFO_0000002 , obo:OBI_0000648 ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:RO_0002018 a rdf:Property ;
rdfs:label "has component process" ;
rdfs:comment "w 'has process component' p if p and w are processes, w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002180 .
obo:OBI_0000299 a rdf:Property ;
rdfs:label "has_specified_output"@en ;
rdfs:comment "The inverse property of is_specified_output_of"@en ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:BFO_0000055 a rdf:Property ;
rdfs:label "realizes"@en ;
rdfs:comment "Paraphrase of elucidation: a relation between a process and a realizable entity, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000017 .
obo:RO_0000057 a rdf:Property ;
rdfs:label "has participant" ;
rdfs:comment "a relation between a process and a continuant, in which the continuant is somehow involved in the process" ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000002 .
obo:RO_0002222 a rdf:Property ;
rdfs:label "temporally related to"@en ;
rdfs:comment "A relation that holds between two occurrents. This is a grouping relation that collects together all the Allen relations." ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 .
obo:RO_0002334 a rdf:Property ;
rdfs:label "regulated by"@en ;
rdfs:comment "inverse of regulates" ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002427 .
obo:SDDO_1000002 a rdfs:Class ;
rdfs:label "spase:DisplayData"@en ;
rdfs:comment "A graphical representation of data wherein the underlying numeric values are not (readily) accessible for analysis." ;
rdfs:subClassOf obo:SDDO_3000051 .
obo:OBI_0000312 a rdf:Property ;
rdfs:label "is_specified_output_of"@en ;
rdfs:comment "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of."@en ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:OBI_0000011 , obo:OBIB_0000710 ;
rdfs:subPropertyOf obo:RO_0000056 .
obo:IAO_0000136 a rdf:Property ;
rdfs:label "is about" ;
rdfs:comment "is_about is a (currently) primitive relation that relates an information artifact to an entity." ;
rdfs:domain obo:IAO_0000030 ;
rdfs:range .
obo:BFO_0000034 a rdfs:Class ;
rdfs:label "function"@en ;
rdfs:subClassOf obo:BFO_0000016 .
obo:BFO_0000051 a rdf:Property ;
rdfs:label "has part" ;
rdfs:comment "a core relation that holds between a whole and its part"@en ;
rdfs:range obo:BFO_0000020 , ;
rdfs:subPropertyOf obo:RO_0002131 .
obo:RO_0000059 a rdf:Property ;
rdfs:label "concretizes"@en ;
rdfs:comment "A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant."@en ;
rdfs:domain obo:BFO_0000020 ;
rdfs:range obo:BFO_0000031 .
obo:BFO_0000054 a rdf:Property ;
rdfs:label "realized in"@en ;
rdfs:comment "Paraphrase of elucidation: a relation between a realizable entity and a process, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ;
rdfs:domain obo:BFO_0000017 ;
rdfs:range obo:BFO_0000015 , obo:OBI_0000066 , obo:OBI_0000011 , obo:OBI_0000457 .
obo:RO_0000079 a rdf:Property ;
rdfs:label "function of"@en ;
rdfs:comment "a relation between a function and an independent continuant (the bearer), in which the function specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000034 ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0000052 .
obo:UBERON_0000465 a rdfs:Class ;
rdfs:label "material anatomical entity" ;
rdfs:comment "Anatomical entity that has mass." ;
rdfs:subClassOf obo:BFO_0000040 .
obo:SDDO_3000095 a rdfs:Class ;
rdfs:label "metadata product"@en ;
rdfs:comment "An information product that contains structured metadata." ;
rdfs:subClassOf obo:SDDO_3000079 .
obo:GENO_0000902 a rdfs:Class ;
rdfs:label "genomic feature location"@en ;
rdfs:comment "The location of a sequence feature in a genome, defined by its start and end position on some reference genomic coordinate system" ;
rdfs:subClassOf obo:GENO_0000815 .
obo:IAO_0000009 a rdfs:Class ;
rdfs:label "datum label"@en ;
rdfs:comment "A label is a symbol that is part of some other datum and is used to either partially define the denotation of that datum or to provide a means for identifying the datum as a member of the set of data with the same label"@en ;
rdfs:subClassOf obo:IAO_0000030 .
a rdfs:Class ;
rdfs:label "Met"@en ;
rdfs:subClassOf .
obo:OBI_0000102 a rdfs:Class ;
rdfs:label "responsible party role"@en ;
rdfs:comment "a study personnel role played by a party who is accountable for the execution of a study component and can make decisions about the conduct of the study"@en ;
rdfs:subClassOf obo:OBI_0000202 .
a rdfs:Class ;
rdfs:label "Language Encoding Schemes"@en-US ;
rdfs:comment "A set of language encoding schemes and/or formats."@en-US .
obo:OBI_0000947 a rdfs:Class ;
rdfs:label "service provider role" ;
rdfs:comment "is a role which inheres in a person or organization and is realized in in a planned process which provides access to training, materials or execution of protocols for an organization or person" ;
rdfs:subClassOf obo:OMRSE_00000048 .
obo:RO_0000052 a rdf:Property ;
rdfs:label "inheres in"@en ;
rdfs:comment "a relation between a specifically dependent continuant (the characteristic) and any other entity (the bearer), in which the characteristic depends on the bearer for its existence."@en ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002314 .
obo:BFO_0000017 a rdfs:Class ;
rdfs:label "realizable entity"@en ;
rdfs:comment "A specifically dependent continuant that inheres in continuant entities and are not exhibited in full at every time in which it inheres in an entity or group of entities. The exhibition or actualization of a realizable entity is a particular manifestation, functioning or process that occurs under certain circumstances."@en ;
rdfs:subClassOf obo:BFO_0000020 .
a rdfs:Class ;
rdfs:label "Physician"@en ;
rdfs:comment "A doctor's office."@en .
a rdf:Property ;
rdfs:label "hospitalAffiliation"@en ;
rdfs:comment "A hospital with which the physician or office is affiliated."@en ;
rdfs:range .
obo:OBI_0200172 a rdfs:Class ;
rdfs:label "partitioning objective"@en ;
rdfs:comment "A partitioning objective is a data transformation objective where the aim is to generate a collection of disjoint non-empty subsets whose union equals a non-empty input set."@en ;
rdfs:subClassOf obo:OBI_0200166 .
obo:OBI_0000833 a rdf:Property ;
rdfs:label "objective_achieved_by" ;
rdfs:comment "This relation obtains between an objective specification and a planned process when the criteria specified in the objective specification are met at the end of the planned process." ;
rdfs:domain obo:IAO_0000005 ;
rdfs:range obo:OBI_0000011 .
obo:SDDO_3000079 a rdfs:Class ;
rdfs:label "information product"@en ;
rdfs:comment "A product that describes some entity." ;
rdfs:subClassOf obo:SDDO_3000066 .
a rdfs:Class ;
rdfs:label "RadiationTherapy"@en ;
rdfs:comment "A process of care using radiation aimed at improving a health condition."@en .
obo:OBI_0000663 a rdfs:Class ;
rdfs:label "class prediction data transformation"@en ;
rdfs:comment "A class prediction data transformation (sometimes called supervised classification) is a data transformation that has objective class prediction."@en ;
rdfs:subClassOf obo:OBI_0200000 .
a rdfs:Class ;
rdfs:label "software license" ;
rdfs:comment "A licence is a legal instrument (usually by way of contract law, with or without printed material) governing the use or redistribution of the resource containing the licence." ;
rdfs:subClassOf obo:IAO_0000030 .
obo:OBI_0001933 a rdfs:Class ;
rdfs:label "value specification" ;
rdfs:comment "An information content entity that specifies a value within a classification scheme or on a quantitative scale." ;
rdfs:subClassOf obo:IAO_0000030 .
obo:SDDO_3000084 a rdfs:Class ;
rdfs:label "software"@en ;
rdfs:comment "An information content entity that 1) contains a set of machine-readable instructions (most often in the form of a computer program) that 2) conform to a given syntax (sometimes referred to as a language) that 3) is interpretable by a given processor and that 4) directs a computer's processor to perform specific operations." ;
rdfs:subClassOf .
obo:OBI_0200042 a rdfs:Class ;
rdfs:label "hierarchical clustering"@en ;
rdfs:comment "A hierarchical clustering is a data transformation which achieves a class discovery objective, which takes as input data item and builds a hierarchy of clusters. The traditional representation of this hierarchy is a tree (visualized by a dendrogram), with the individual input objects at one end (leaves) and a single cluster containing every object at the other (root)."@en ;
rdfs:subClassOf obo:APOLLO_SV_00000796 , obo:OBI_0200175 .
a rdfs:Class ;
rdfs:label "Location"@en ;
rdfs:comment "An object representing a named geographical place"@en ;
rdfs:subClassOf , .
a rdf:Property ;
rdfs:label "formatted name"@en ;
rdfs:comment "The formatted text corresponding to the name of the object"@en ;
rdfs:range xsd:string .
a rdfs:Class ;
rdfs:label "Parcel"@en ;
rdfs:comment "This class is deprecated"@en ;
rdfs:subClassOf .
a rdfs:Class ;
rdfs:label "Relation Type"@en ;
rdfs:comment "Used for relation type codes. The URI of the relation type code must be used as the value for the Relation Type."@en .
obo:OBI_0000792 a rdfs:Class ;
rdfs:label "statistical model validation" ;
rdfs:comment "A data transformation which assesses how the results of a statistical analysis will generalize to an independent data set." ;
rdfs:subClassOf obo:OBI_0200171 .
obo:IAO_0000183 a rdfs:Class ;
rdfs:label "dendrogram"@en ;
rdfs:comment """A dendrogram is a report graph which is a tree diagram
frequently used to illustrate the arrangement of the clusters produced by a
clustering algorithm."""@en ;
rdfs:subClassOf obo:IAO_0000038 .
a rdfs:Class ;
rdfs:label "Other"@en ;
rdfs:subClassOf .
obo:OBI_0500000 a rdfs:Class ;
rdfs:label "study design"@en ;
rdfs:comment "A plan specification comprised of protocols (which may specify how and what kinds of data will be gathered) that are executed as part of an investigation and is realized during a study design execution." ;
rdfs:subClassOf obo:IAO_0000104 .
a rdfs:Class ;
rdfs:label "Resource Type Encoding Schemes"@en-US ;
rdfs:comment "A set of resource type encoding schemes and/or formats"@en-US .
obo:SLSO_0000050 a rdfs:Class ;
rdfs:label "age (at launch/start)" ;
rdfs:comment "How long something or someone has existed; measured at launch/start" ;
rdfs:subClassOf obo:ExO_0000102 .
obo:SDDO_3000047 a rdfs:Class ;
rdfs:label "assay"@en ;
rdfs:comment "An assay is an investigative (analytic) procedure for qualitatively assessing or quantitatively measuring the presence, amount, or functional activity of a target entity." .
obo:SDDO_3000017 a rdf:Property ;
rdfs:label "createdBy"@en ;
rdfs:range .
obo:SDDO_3000024 a rdf:Property ;
rdfs:label "capableOfIdentifying"@en ;
rdfs:range .
obo:SDDO_3000026 a rdf:Property ;
rdfs:label "capableOfDetecting"@en ;
rdfs:range .
obo:NCBITaxon_314146 a rdfs:Class ;
rdfs:label "Euarchontoglires" ;
rdfs:subClassOf obo:NCBITaxon_40674 .
obo:ExO_0000038 a rdfs:Class ;
rdfs:label "health status" ;
rdfs:comment "The condition of an organism in all aspects (e.g., functional or metabolic efficiency)." ;
rdfs:subClassOf obo:ExO_0000089 .
a rdfs:Class ;
rdfs:label "Rolle"@da , "Role"@cs , "Role"@en , "Ruolo"@it , "Rol"@es ;
rdfs:comment "En rolle er den funktion en ressource eller aktør har i forhold til en anden ressource, i forbindelse med ressourcekreditering eller ressourcerelationer."@da , "Role je funkce zdroje či agenta ve vztahu k jinému zdroji, v kontextu přiřazení zdrojů či vztahů mezi zdroji."@cs , "A role is the function of a resource or agent with respect to another resource, in the context of resource attribution or resource relationships."@en , "Un ruolo è la funzione di una risorsa o di un agente rispetto ad un'altra risorsa, nel contesto dell'attribuzione delle risorse o delle relazioni tra risorse."@it , "Un rol es la función de un recurso o agente con respecto a otro recuros, en el contexto de atribución del recurso o de las relaciones entre recursos."@es ;
rdfs:seeAlso ;
rdfs:subClassOf .
obo:OBI_0000457 a rdfs:Class ;
rdfs:label "manufacturing"@en ;
rdfs:comment "Manufacturing is a process with the intent to produce a processed material which will have a function for future use. A person or organization (having manufacturer role) is a participant in this process"@en ;
rdfs:subClassOf obo:OBI_0000094 .
obo:OBI_0000047 a rdfs:Class ;
rdfs:label "processed material"@en ;
rdfs:comment "Is a material entity that is created or changed during material processing."@en ;
rdfs:subClassOf obo:BFO_0000040 .
a rdfs:Class ;
rdfs:label "Name"@en ;
rdfs:comment "To specify the components of the name of the object"@en .
obo:OBI_0000835 a rdfs:Class ;
rdfs:label "manufacturer" ;
rdfs:comment "A person or organization that has a manufacturer role" ;
rdfs:subClassOf obo:BFO_0000040 .
a rdfs:Class ;
rdfs:label "EmployeeRole"@en ;
rdfs:comment "A subclass of OrganizationRole used to describe employee relationships."@en ;
rdfs:subClassOf .
a rdf:Property ;
rdfs:label "numberedPosition"@en ;
rdfs:comment "A number associated with a role in an organization, for example, the number on an athlete's jersey."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "namedPosition"@en ;
rdfs:comment "A position played, performed or filled by a person or organization, as part of an organization. For example, an athlete in a SportsTeam might play in the position named 'Quarterback'."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "roleName"@en ;
rdfs:comment "A role played, performed or filled by a person or organization. For example, the team of creators for a comic book might fill the roles named 'inker', 'penciller', and 'letterer'; or an athlete in a SportsTeam might play in the position named 'Quarterback'."@en ;
rdfs:range .
obo:OBI_0000023 a rdfs:Class ;
rdfs:label "classified data set"@en ;
rdfs:comment "A data set that is produced as the output of a class prediction data transformation and consists of a data set with assigned class labels."@en ;
rdfs:subClassOf obo:IAO_0000100 .
obo:GO_0016740 a rdfs:Class ;
rdfs:label "transferase activity" ;
rdfs:subClassOf obo:GO_0003824 .
obo:ExO_0000033 a rdfs:Class ;
rdfs:label "human population" ;
rdfs:comment "An exposure_receptor that is a group of Homo sapiens inhabiting a given area." ;
rdfs:subClassOf obo:ExO_0000001 .
obo:SLSO_0000039 a rdfs:Class ;
rdfs:label "publication document" ;
rdfs:comment "NCIt Definition: A printed or electronic work offered for distribution. MSH Definition: Copies of a work or document distributed to the public by sale, rental, lease, or lending. (From ALA Glossary of Library and Information Science, 1983, p181) CSP Definition: copy or copies of a document offered for distribution; includes the preparation of the documented material." ;
rdfs:subClassOf obo:SLSO_0000028 .
obo:SLSO_0001131 a rdf:Property ;
rdfs:label "s3 file GUID" ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001124 a rdf:Property ;
rdfs:label "creator" ;
rdfs:comment "An entity responsible for making the resource." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001067 a rdf:Property ;
rdfs:label "document title" ;
rdfs:comment "Typically, a Title will be a name by which the resource is formally known. cf IAO:0000305 document title as a class" ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001127 a rdf:Property ;
rdfs:label "publication date" ;
rdfs:comment "Date (often a range) that the resource will become or did become available." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001126 a rdf:Property ;
rdfs:label "location (archive/request)" ;
rdfs:comment "NASA center or other location where the document is archived; for hardcopy documents, this field also indicates where the document can be ordered" ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001129 a rdf:Property ;
rdfs:label "type" ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001094 a rdf:Property ;
rdfs:label "document description" ;
rdfs:comment "An account of the content of the resource." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001130 a rdf:Property ;
rdfs:label "document availability" ;
rdfs:comment "Access restrictions for ordering/receiving the archived document. " ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001132 a rdf:Property ;
rdfs:label "document filename" ;
rdfs:comment "File name for document available for online." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:SLSO_0001054 a rdf:Property ;
rdfs:label "document number" ;
rdfs:comment "Original document number assigned by the JSC or ARC project, mission level offices, or headquarters level offices. For publication citations only, this is a number generated by the SQL database." ;
rdfs:domain obo:SLSO_0000028 ;
rdfs:range .
obo:OBI_0000968 a rdfs:Class ;
rdfs:label "device" ;
rdfs:comment "A material entity that is designed to perform a function in a scientific investigation, but is not a reagent." ;
rdfs:subClassOf obo:OBI_0000047 .
a rdfs:Class ;
rdfs:label "Me"@en ;
rdfs:subClassOf .
obo:SLSO_0000021 a rdfs:Class ;
rdfs:label "space life sciences dataset" ;
rdfs:comment "A data product that is an aggregate of data items of the same type that have something in common. Averages and distributions can be determined for data sets." ;
rdfs:subClassOf obo:IAO_0000100 , obo:SDDO_3000051 , obo:T4FS_0000347 .
obo:SLSO_0001123 a rdf:Property ;
rdfs:label "dataset medium" ;
rdfs:comment "The physical or digital form in which the data are available." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0000015 a rdf:Property ;
rdfs:label "owned by" ;
rdfs:range .
obo:SLSO_0001061 a rdf:Property ;
rdfs:label "dataset availability" ;
rdfs:comment "This value denotes whether a dataset is available for download on the public site. Datasets are either available for download on-line, or available off-line in hardcopy form." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001108 a rdf:Property ;
rdfs:label "review" ;
rdfs:comment "Programmatic, or data acquisition or data quality information regarding this dataset." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001118 a rdf:Property ;
rdfs:label "data collection site" ;
rdfs:comment "Physical location where the data was collected" ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001121 a rdf:Property ;
rdfs:label "hardware_name" ;
rdfs:comment "The mechanical equipment component used." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001049 a rdf:Property ;
rdfs:label "dataset catalog id" ;
rdfs:comment " This alphanumeric string is generated at data acquisition, and is used to uniquely identify the dataset." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001120 a rdf:Property ;
rdfs:label "processing level" ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001056 a rdf:Property ;
rdfs:label "release date" ;
rdfs:comment "Date when data are released (usually by the PI) to the archive, or released to go on the public Website." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001122 a rdf:Property ;
rdfs:label "data source" ;
rdfs:comment "Describes the information, in terms of the group responsible for collecting and/or providing the data." ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
obo:SLSO_0001119 a rdf:Property ;
rdfs:label "protocol approach" ;
rdfs:domain obo:SLSO_0000021 ;
rdfs:range .
a rdfs:Class ;
rdfs:label "Acquaintance"@en ;
rdfs:subClassOf .
obo:NCBITaxon_33208 a rdfs:Class ;
rdfs:label "Metazoa" ;
rdfs:subClassOf obo:NCBITaxon_33154 .
a rdfs:Class ;
rdfs:label "Resource Relation Encoding Schemes"@en-US ;
rdfs:comment "A set of resource relation encoding schemes and/or formats"@en-US .
obo:OBI_0000684 a rdfs:Class ;
rdfs:label "specimen collection objective" ;
rdfs:comment "A objective specification to obtain a material entity for potential use as an input during an investigation." ;
rdfs:subClassOf obo:IAO_0000005 .
a rdfs:Class ;
rdfs:label "Car"@en ;
rdfs:comment "A car is a wheeled, self-powered motor vehicle used for transportation."@en ;
rdfs:subClassOf .
a rdf:Property ;
rdfs:label "wheelbase"@en ;
rdfs:comment """The distance between the centers of the front and rear wheels.
Typical unit code(s): CMT for centimeters, MTR for meters, INH for inches, FOT for foot/feet"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "roofLoad"@en ;
rdfs:comment """The permitted total weight of cargo and installations (e.g. a roof rack) on top of the vehicle.
Typical unit code(s): KGM for kilogram, LBR for pound
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfAxles"@en ;
rdfs:comment """The number of axles.
Typical unit code(s): C62"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "fuelCapacity"@en ;
rdfs:comment """The capacity of the fuel tank or in the case of electric cars, the battery. If there are multiple components for storage, this should indicate the total of all storage of the same type.
Typical unit code(s): LTR for liters, GLL of US gallons, GLI for UK / imperial gallons, AMH for ampere-hours (for electrical vehicles)."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "modelDate"@en ;
rdfs:comment "The release date of a vehicle model (often used to differentiate versions of the same make and model)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleInteriorColor"@en ;
rdfs:comment "The color or color combination of the interior of the vehicle."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "fuelEfficiency"@en ;
rdfs:comment """The distance traveled per unit of fuel used; most commonly miles per gallon (mpg) or kilometers per liter (km/L).
- Note 1: There are unfortunately no standard unit codes for miles per gallon or kilometers per liter. Use unitText to indicate the unit of measurement, e.g. mpg or km/L.
- Note 2: There are two ways of indicating the fuel consumption, fuelConsumption (e.g. 8 liters per 100 km) and fuelEfficiency (e.g. 30 miles per gallon). They are reciprocal.
- Note 3: Often, the absolute value is useful only when related to driving speed (\"at 80 km/h\") or usage pattern (\"city traffic\"). You can use valueReference to link the value for the fuel economy to another value.
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleSeatingCapacity"@en ;
rdfs:comment """The number of passengers that can be seated in the vehicle, both in terms of the physical space available, and in terms of limitations set by law.
Typical unit code(s): C62 for persons."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "weightTotal"@en ;
rdfs:comment """The permitted total weight of the loaded vehicle, including passengers and cargo and the weight of the empty vehicle.
Typical unit code(s): KGM for kilogram, LBR for pound
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "bodyType"@en ;
rdfs:comment "Indicates the design and body style of the vehicle (e.g. station wagon, hatchback, etc.)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "payload"@en ;
rdfs:comment """The permitted weight of passengers and cargo, EXCLUDING the weight of the empty vehicle.
Typical unit code(s): KGM for kilogram, LBR for pound
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "mileageFromOdometer"@en ;
rdfs:comment """The total distance travelled by the particular vehicle since its initial production, as read from its odometer.
Typical unit code(s): KMT for kilometers, SMI for statute miles"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "seatingCapacity"@en ;
rdfs:comment """The number of persons that can be seated (e.g. in a vehicle), both in terms of the physical space available, and in terms of limitations set by law.
Typical unit code(s): C62 for persons"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleModelDate"@en ;
rdfs:comment "The release date of a vehicle model (often used to differentiate versions of the same make and model)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "fuelConsumption"@en ;
rdfs:comment """The amount of fuel consumed for traveling a particular distance or temporal duration with the given vehicle (e.g. liters per 100 km).
- Note 1: There are unfortunately no standard unit codes for liters per 100 km. Use unitText to indicate the unit of measurement, e.g. L/100 km.
- Note 2: There are two ways of indicating the fuel consumption, fuelConsumption (e.g. 8 liters per 100 km) and fuelEfficiency (e.g. 30 miles per gallon). They are reciprocal.
- Note 3: Often, the absolute value is useful only when related to driving speed (\"at 80 km/h\") or usage pattern (\"city traffic\"). You can use valueReference to link the value for the fuel consumption to another value.
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "meetsEmissionStandard"@en ;
rdfs:comment "Indicates that the vehicle meets the respective emission standard."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfForwardGears"@en ;
rdfs:comment """The total number of forward gears available for the transmission system of the vehicle.
Typical unit code(s): C62"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "steeringPosition"@en ;
rdfs:comment "The position of the steering wheel or similar device (mostly for cars)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "tongueWeight"@en ;
rdfs:comment """The permitted vertical load (TWR) of a trailer attached to the vehicle. Also referred to as Tongue Load Rating (TLR) or Vertical Load Rating (VLR).
Typical unit code(s): KGM for kilogram, LBR for pound
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "accelerationTime"@en ;
rdfs:comment """The time needed to accelerate the vehicle from a given start velocity to a given target velocity.
Typical unit code(s): SEC for seconds
- Note: There are unfortunately no standard unit codes for seconds/0..100 km/h or seconds/0..60 mph. Simply use \"SEC\" for seconds and indicate the velocities in the name of the QuantitativeValue, or use valueReference with a QuantitativeValue of 0..60 mph or 0..100 km/h to specify the reference speeds.
"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "cargoVolume"@en ;
rdfs:comment """The available volume for cargo or luggage. For automobiles, this is usually the trunk volume.
Typical unit code(s): LTR for liters, FTQ for cubic foot/feet
Note: You can use minValue and maxValue to indicate ranges."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "dateVehicleFirstRegistered"@en ;
rdfs:comment "The date of the first registration of the vehicle with the respective public authorities."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "driveWheelConfiguration"@en ;
rdfs:comment "The drive wheel configuration, i.e. which roadwheels will receive torque from the vehicle's engine via the drivetrain."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleIdentificationNumber"@en ;
rdfs:comment "The Vehicle Identification Number (VIN) is a unique serial number used by the automotive industry to identify individual motor vehicles."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleEngine"@en ;
rdfs:comment "Information about the engine or engines of the vehicle."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleConfiguration"@en ;
rdfs:comment "A short text indicating the configuration of the vehicle, e.g. '5dr hatchback ST 2.5 MT 225 hp' or 'limited edition'."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "trailerWeight"@en ;
rdfs:comment """The permitted weight of a trailer attached to the vehicle.
Typical unit code(s): KGM for kilogram, LBR for pound
* Note 1: You can indicate additional information in the name of the QuantitativeValue node.
* Note 2: You may also link to a QualitativeValue node that provides additional information using valueReference.
* Note 3: Note that you can use minValue and maxValue to indicate ranges."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfAirbags"@en ;
rdfs:comment "The number or type of airbags in the vehicle."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfDoors"@en ;
rdfs:comment """The number of doors.
Typical unit code(s): C62"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleSpecialUsage"@en ;
rdfs:comment "Indicates whether the vehicle has been used for special purposes, like commercial rental, driving school, or as a taxi. The legislation in many countries requires this information to be revealed when offering a car for sale."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "acrissCode"@en ;
rdfs:comment "The ACRISS Car Classification Code is a code used by many car rental companies, for classifying vehicles. ACRISS stands for Association of Car Rental Industry Systems and Standards."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleTransmission"@en ;
rdfs:comment "The type of component used for transmitting the power from a rotating power source to the wheels or other relevant component(s) (\"gearbox\" for cars)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "knownVehicleDamages"@en ;
rdfs:comment "A textual description of known damages, both repaired and unrepaired."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "numberOfPreviousOwners"@en ;
rdfs:comment """The number of owners of the vehicle, including the current one.
Typical unit code(s): C62"""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "speed"@en ;
rdfs:comment """The speed range of the vehicle. If the vehicle is powered by an engine, the upper limit of the speed range (indicated by maxValue) should be the maximum speed achievable under regular conditions.
Typical unit code(s): KMH for km/h, HM for mile per hour (0.447 04 m/s), KNT for knot
*Note 1: Use minValue and maxValue to indicate the range. Typically, the minimal value is zero.
* Note 2: There are many different ways of measuring the speed range. You can link to information about how the given value has been determined using the valueReference property."""@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "emissionsCO2"@en ;
rdfs:comment "The CO2 emissions in g/km. When used in combination with a QuantitativeValue, put \"g/km\" into the unitText property of that value, since there is no UN/CEFACT Common Code for \"g/km\"."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "vehicleInteriorType"@en ;
rdfs:comment "The type or material of the interior of the vehicle (e.g. synthetic fabric, leather, wood, etc.). While most interior types are characterized by the material used, an interior type can also be based on vehicle usage or target audience."@en ;
rdfs:range .
obo:GENO_0000702 a rdfs:Class ;
rdfs:label "biological sequence"@en ;
rdfs:comment "A linear ordering of units representing monomers of a biological macromolecule (e.g. nucleotides in DNA and RNA, amino acids in polypeptides)." ;
rdfs:subClassOf obo:GENO_0000921 .
obo:GENO_0000251 a rdf:Property ;
rdfs:label "is_sequence_of" ;
rdfs:domain obo:GENO_0000702 ;
rdfs:range .
obo:GENO_0000896 a rdf:Property ;
rdfs:label "has_string" ;
rdfs:comment "Property linking a biological sequence to a string representing the ordered units that comprise the sequence (e.g. 'atgcagctagctaccgtcgatcg')." ;
rdfs:domain obo:GENO_0000702 ;
rdfs:range xsd:string .
obo:ExO_0000002 a rdfs:Class ;
rdfs:label "exposure event" ;
rdfs:comment "An interaction between an exposure stressor and an exposure_receptor." ;
rdfs:subClassOf obo:BFO_0000015 .
a rdf:Property ;
rdfs:label "interacts_with_an_exposure_receptor_via" ;
rdfs:range .
a rdf:Property ;
rdfs:label "interacts_with_an_exposure stressor_via" ;
rdfs:range .
a rdfs:Class ;
rdfs:label "X400"@en ;
rdfs:comment "This class is deprecated"@en ;
rdfs:subClassOf .
obo:GENO_0000713 a rdfs:Class ;
rdfs:label "qualified sequence feature or collection"@en ;
rdfs:comment "A sequence feature (or collection of features) whose identity is dependent on the context or state of its material bearer (in addition to its sequence an position). This context/state describes factors external to its inherent sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification." ;
rdfs:subClassOf obo:BFO_0000031 .
a rdfs:Class ;
rdfs:label "Friend"@en ;
rdfs:subClassOf .
obo:SLSO_0000032 a rdfs:Class ;
rdfs:label "spacecraft" ;
rdfs:comment "Devices, manned and unmanned, which are designed to be placed into an orbit about the Earth or into a trajectory to another celestial body." ;
rdfs:subClassOf .
obo:SDDO_1000009 a rdfs:Class ;
rdfs:label "discovery interface"@en ;
rdfs:comment "An interface that 1) presents users with discovery criteria and may 2) lead to an access interface." ;
rdfs:subClassOf .
obo:OBIB_0000710 a rdfs:Class ;
rdfs:label "survey execution"@en ;
rdfs:comment "A planned process that realizes the concretization of a survey to generate an output(survey data.)"@en ;
rdfs:subClassOf obo:OBI_0000011 .
a rdfs:Class ;
rdfs:label "Child"@en ;
rdfs:subClassOf .
a rdfs:Class .
a rdfs:Class ;
rdfs:label "Vehicle"@en ;
rdfs:comment "A vehicle is a device that is designed or used to transport people or cargo over land, water, air, or through space."@en .
obo:IAO_0000178 a rdfs:Class ;
rdfs:label "material information bearer"@en ;
rdfs:comment "A material entity in which a concretization of an information content entity inheres."@en ;
rdfs:subClassOf obo:BFO_0000040 .
a rdfs:Class ;
rdfs:label "Parent"@en ;
rdfs:subClassOf .
obo:SLSO_0000028 a rdfs:Class ;
rdfs:label "LSDA document" ;
rdfs:comment "NCIt Definition: A physical object, or electronic counterpart, that is characterized by containing writing which is meant to be human-readable." ;
rdfs:subClassOf obo:SDDO_3000109 .
obo:SLSO_0000043 a rdfs:Class ;
rdfs:label "scientific name" ;
rdfs:comment "The name applied to a plant, animal, or other organism, according to the Codes of Nomenclature, consisting of a Genus and species." ;
rdfs:subClassOf obo:SDDO_3000065 .
a rdfs:Class ;
rdfs:label "データセット"@ja , "Σύνολο Δεδομένων"@el , "قائمة بيانات"@ar , "Datasæt"@da , "Jeu de données"@fr , "Datová sada"@cs , "Dataset"@en , "Dataset"@it , "Conjunto de datos"@es ;
rdfs:comment "1つのエージェントによって公開またはキュレートされ、1つ以上の形式でアクセスまたはダウンロードできるデータの集合。"@ja , "Μία συλλογή από δεδομένα, δημοσιευμένη ή επιμελημένη από μία και μόνο πηγή, διαθέσιμη δε προς πρόσβαση ή μεταφόρτωση σε μία ή περισσότερες μορφές."@el , "قائمة بيانات منشورة أو مجموعة من قبل مصدر ما و متاح الوصول إليها أو تحميلها"@ar , "En samling a data, udgivet eller udvalgt og arrangeret af en enkelt kilde og som der er adgang til i en eller flere repræsentationer."@da , "Une collection de données, publiée ou élaborée par une seule source, et disponible pour accès ou téléchargement dans un ou plusieurs formats."@fr , "Kolekce dat poskytovaná či řízená jedním zdrojem, která je k dispozici pro přístup či stažení v jednom či více formátech."@cs , "A collection of data, published or curated by a single source, and available for access or download in one or more represenations."@en , "Raccolta di dati, pubblicati o curati da un'unica fonte, disponibili per l'accesso o il download in uno o più formati."@it , "Una colección de datos, publicados o conservados por una única fuente, y disponibles para ser accedidos o descargados en uno o más formatos."@es ;
rdfs:subClassOf .
obo:GENO_0000897 a rdfs:Class ;
rdfs:label "genomic entity"@en ;
rdfs:comment "An generically dependent continuant that carries biological sequence that is part of or derived from a genome." ;
rdfs:subClassOf obo:BFO_0000031 .
a rdfs:Class ;
rdfs:label "MotorizedBicycle"@en ;
rdfs:comment "A motorized bicycle is a bicycle with an attached motor used to power the vehicle, or to assist with pedaling."@en ;
rdfs:subClassOf .
obo:IAO_0000308 a rdfs:Class ;
rdfs:label "figure"@en ;
rdfs:comment "An information content entity consisting of a two dimensional arrangement of information content entities such that the arrangement itself is about something."@en ;
rdfs:subClassOf obo:IAO_0000030 .
a rdfs:Class ;
rdfs:label "Crush"@en ;
rdfs:subClassOf .
obo:OBI_0002356 a rdfs:Class ;
rdfs:label "performance status value specification" ;
rdfs:comment "A categorical value specification that is an assessment of a participant's performance status (general well-being and activities of daily life)." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:BFO_0000040 a rdfs:Class ;
rdfs:label "material entity" ;
rdfs:comment "An independent continuant [snap:IndependentContinuant] that is spatially extended whose identity is independent of that of other entities and can be maintained through time. Note: Material entity [snap:MaterialEntity] subsumes object [snap:Object], fiat object part [snap:FiatObjectPart], and object aggregate [snap:ObjectAggregate], which assume a three level theory of granularity, which is inadequate for some domains, such as biology." ;
rdfs:subClassOf obo:BFO_0000004 .
obo:SDDO_1000010 a rdfs:Class ;
rdfs:label "field campaign"@en ;
rdfs:comment "A campaign that is coordinated among one or more individuals and/or one or more organizations." ;
rdfs:subClassOf obo:SDDO_3000045 .
obo:SDDO_3000009 a rdf:Property ;
rdfs:label "uses"@en ;
rdfs:range .
obo:SDDO_3000020 a rdf:Property ;
rdfs:label "resultsIn"@en ;
rdfs:range .
obo:GENO_0000660 a rdfs:Class ;
rdfs:label "genomic feature set"@en ;
rdfs:comment "A set of genomic features (i.e. sequence features that are of genomic origin)." ;
rdfs:subClassOf obo:GENO_0000659 , obo:GENO_0000897 .
obo:RO_0002351 a rdf:Property ;
rdfs:label "has member" ;
rdfs:comment "has member is a mereological relation between a collection and an item." ;
rdfs:range , obo:OBI_0000245 , obo:OBI_0100051 ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:GENO_0000917 a rdf:Property ;
rdfs:label "has_member_count"@en ;
rdfs:comment "Describes the number of members in some set." ;
rdfs:range .
obo:SDDO_3000105 a rdfs:Class ;
rdfs:label "investigator"@en ;
rdfs:comment "A role which inheres in a person or organization and which is realized during an investigation." ;
rdfs:subClassOf obo:BFO_0000023 .
a rdfs:Class ;
rdfs:label "Platform"@en ;
rdfs:comment "A Platform is an entity that hosts other entities, particularly Sensors, Actuators, Samplers, and other Platforms."@en .
obo:NCBITaxon_2157 a rdfs:Class ;
rdfs:label "Archaea" ;
rdfs:subClassOf obo:OBI_0100026 .
a rdfs:Class ;
rdfs:label "Address"@en ;
rdfs:comment "To specify the components of the delivery address for the object"@en .
obo:OBI_0200171 a rdfs:Class ;
rdfs:label "partitioning data transformation"@en ;
rdfs:comment "A partitioning data transformation is a data transformation that has objective partitioning."@en ;
rdfs:subClassOf obo:OBI_0200000 .
obo:OBI_0000450 a rdfs:Class ;
rdfs:label "regulatory agency"@en ;
rdfs:comment "A regulatory agency is a organization that has responsibility over or for the legislation (acts and regulations) for a given sector of the government."@en ;
rdfs:subClassOf obo:OBI_0000245 .
obo:OBIB_0000732 a rdf:Property ;
rdfs:label "owns"@en ;
rdfs:range xsd:string .
obo:GENO_0000920 a rdfs:Class ;
rdfs:label "qualified sequence feature set"@en ;
rdfs:comment "A set of qualified seqeunce features." ;
rdfs:subClassOf obo:GENO_0000713 .
obo:GENO_0000726 a rdf:Property ;
rdfs:label "has_sequence_feature"@en ;
rdfs:comment "A relation linking a qualified sequence feature to its component sequence feature." ;
rdfs:range obo:SO_0000110 .
obo:SDDO_3000100 a rdfs:Class ;
rdfs:label "observation"@en ;
rdfs:comment "Act of carrying out an procedure to estimate or calculate a value of a property of a feature." ;
rdfs:subClassOf obo:OBI_0000011 , .
a rdfs:Class ;
rdfs:label "CompleteDataFeed"@en ;
rdfs:comment """A CompleteDataFeed is a DataFeed whose standard representation includes content for every item currently in the feed.
This is the equivalent of Atom's element as defined in Feed Paging and Archiving RFC 5005, for example (and as defined for Atom), when using data from a feed that represents a collection of items that varies over time (e.g. \"Top Twenty Records\") there is no need to have newer entries mixed in alongside older, obsolete entries. By marking this feed as a CompleteDataFeed, old entries can be safely discarded when the feed is refreshed, since we can assume the feed has provided descriptions for all current items."""@en ;
rdfs:subClassOf .
a rdf:Property ;
rdfs:label "dataFeedElement"@en ;
rdfs:comment "An item within a data feed. Data feeds may have many elements."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "datasetTimeInterval"@en ;
rdfs:comment "The range of temporal applicability of a dataset, e.g. for a 2011 census dataset, the year 2011 (in ISO 8601 time interval format)."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "variablesMeasured"@en ;
rdfs:comment "Originally named variablesMeasured, the variableMeasured property can indicate (repeated as necessary) the variables that are measured in some dataset, either described as text or as pairs of identifier and description using PropertyValue."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "includedDataCatalog"@en ;
rdfs:comment "A data catalog which contains this dataset (this property was previously 'catalog', preferred name is now 'includedInDataCatalog')."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "includedInDataCatalog"@en ;
rdfs:comment "A data catalog which contains this dataset."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "distribution"@en ;
rdfs:comment "A downloadable form of this dataset, at a specific location, in a specific format. This property can be repeated if different variations are available. There is no expectation that different downloadable distributions must contain exactly equivalent information (see also DCAT on this point). Different distributions might include or exclude different subsets of the entire dataset, for example."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "catalog"@en ;
rdfs:comment "A data catalog which contains this dataset."@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "variableMeasured"@en ;
rdfs:comment "The variableMeasured property can indicate (repeated as necessary) the variables that are measured in some dataset, either described as text or as pairs of identifier and description using PropertyValue."@en ;
rdfs:range .
obo:GO_0016772 a rdfs:Class ;
rdfs:label "transferase activity, transferring phosphorus-containing groups" ;
rdfs:subClassOf obo:GO_0016740 .
obo:SLSO_0000031 a rdfs:Class ;
rdfs:label "personnel" ;
rdfs:comment "Persons employed in any field." ;
rdfs:subClassOf obo:NCBITaxon_9606 , obo:SDDO_3000090 .
obo:SLSO_0001079 a rdf:Property ;
rdfs:label "first name" ;
rdfs:comment "The given name associated with the object" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:RO_0002350 a rdf:Property ;
rdfs:label "is member of" ;
rdfs:comment "is member of is a mereological relation between a item and a collection." ;
rdfs:range ;
rdfs:subPropertyOf obo:BFO_0000050 .
obo:SLSO_0001107 a rdf:Property ;
rdfs:label "middle name" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:SLSO_0001062 a rdf:Property ;
rdfs:label "last name" ;
rdfs:comment "The family name associated with the object" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:SLSO_0000001 a rdf:Property ;
rdfs:label "operates" ;
rdfs:range .
obo:SLSO_0001089 a rdf:Property ;
rdfs:label "per_id" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:SDDO_3000034 a rdf:Property ;
rdfs:label "hasRole"@en ;
rdfs:range .
obo:SLSO_0001099 a rdf:Property ;
rdfs:label "city" ;
rdfs:comment "The city or town associated with the address of the object. cf. vcard:locality" ;
rdfs:domain obo:SLSO_0000031 ;
rdfs:range .
obo:SO_0001026 a rdfs:Class ;
rdfs:label "genome" ;
rdfs:comment "A collection of sequence features (typically a collection of chromosomes) that covers the sum genetic material within a cell or virion (where 'genetic material' refers to any nucleic acid that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or can be replicated and inherited by its progeny)" ;
rdfs:subClassOf obo:GENO_0000660 .
obo:SLSO_0000029 a rdfs:Class ;
rdfs:label "image (LSDA)" ;
rdfs:comment "A document that is an affine projection to a two dimensional surface, of EM spectrum radiation or measurements of some quality of an entity or entities repeated at regular intervals across a spatial range (where the measurements are represented as color and luminosity on the projected surface.)" ;
rdfs:subClassOf obo:IAO_0000101 .
obo:SLSO_0000007 a rdf:Property ;
rdfs:label "depicts" ;
rdfs:range .
obo:SDDO_3000109 a rdfs:Class ;
rdfs:label "document"@en ;
rdfs:comment "A written or printed paper that bears the original, official, or legal form of something and can be used to furnish decisive evidence or information." ;
rdfs:subClassOf obo:IAO_0000310 , obo:SDDO_3000079 .
obo:SDDO_3000094 a rdfs:Class ;
rdfs:label "experiment"@en ;
rdfs:comment "A plan for a coordinated set of actions and observations designed to generate data, with the ultimate goal of discovery or hypothesis testing." ;
rdfs:subClassOf obo:OBI_0000011 .
obo:SDDO_3000042 a rdf:Property ;
rdfs:label "partOf"@en ;
rdfs:range .
obo:SDDO_3000008 a rdf:Property ;
rdfs:label "generates"@en ;
rdfs:range .
obo:SDDO_3000036 a rdf:Property ;
rdfs:label "conductedOn"@en ;
rdfs:range .
obo:SDDO_3000023 a rdf:Property ;
rdfs:label "conductedAt"@en ;
rdfs:range .
obo:SDDO_3000013 a rdf:Property ;
rdfs:label "componentOf"@en ;
rdfs:range .
obo:BFO_0000027 a rdfs:Class ;
rdfs:label "object aggregate"@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:IAO_0000100 a rdfs:Class ;
rdfs:label "data set"@en ;
rdfs:comment "A data item that is an aggregate of other data items of the same type that have something in common. Averages and distributions can be determined for data sets."@en ;
rdfs:subClassOf obo:IAO_0000027 .
a rdfs:Class ;
rdfs:label "Individual"@en ;
rdfs:comment "An object representing a single person or entity"@en ;
rdfs:subClassOf , .
obo:SLSO_0000024 a rdfs:Class ;
rdfs:label "investigator (human)" ;
rdfs:comment "An individual who conducts scientific research. The investigator collects and analyses data and study documents, and provides reports in compliance with applicable requirements" ;
rdfs:subClassOf obo:SLSO_0000031 .
a rdf:Property ;
rdfs:label "has role"@en ;
rdfs:comment "Used to support property parameters for the role data property"@en ;
rdfs:range .
obo:SLSO_0001150 a rdf:Property ;
rdfs:label "image description" ;
rdfs:domain obo:SLSO_0000024 ;
rdfs:range .
obo:SLSO_0001101 a rdf:Property ;
rdfs:label "file thumbnail" ;
rdfs:comment "owl:equivalentProperty http://purl.obolibrary.org/obo/NCIT_C91820" ;
rdfs:domain obo:SLSO_0000024 ;
rdfs:range ;
rdfs:subPropertyOf obo:NCIT_C91820 .
obo:SLSO_0001154 a rdf:Property ;
rdfs:label "image name" ;
rdfs:domain obo:SLSO_0000024 ;
rdfs:range .
obo:OBI_0001185 a rdfs:Class ;
rdfs:label "selectively maintained organism"@en ;
rdfs:comment "An organism that is bred to have some uniform behavioral, morphological, physiological, or genetic characteristics with similarly bred organisms" ;
rdfs:subClassOf obo:OBI_0100026 .
obo:IAO_0000572 a rdfs:Class ;
rdfs:label "documenting"@en ;
rdfs:comment "A planned process in which a document is created or added to by including the specified input in it."@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:BFO_0000023 a rdfs:Class ;
rdfs:label "role"@en ;
rdfs:comment "A realizable entity the manifestation of which brings about some result or end that is not essential to a continuant in virtue of the kind of thing that it is but that can be served or participated in by that kind of continuant in some kinds of natural, social or institutional contexts."@en ;
rdfs:subClassOf obo:BFO_0000017 .
obo:SDDO_3000044 a rdfs:Class ;
rdfs:label "event"@en ;
rdfs:comment "Something observable that happened at a given time and place" ;
rdfs:subClassOf obo:BFO_0000015 , obo:SDDO_3000099 .
obo:IAO_0000309 a rdfs:Class ;
rdfs:label "diagram"@en ;
rdfs:comment "A figure that expresses one or more propositions"@en ;
rdfs:subClassOf obo:IAO_0000308 .
a rdfs:Class ;
rdfs:label "software" ;
rdfs:comment "Computer software, or generally just software, is any set of machine-readable instructions (most often in the form of a computer program) that conform to a given syntax (sometimes referred to as a language) that is interpretable by a given processor and that directs a computer's processor to perform specific operations." ;
rdfs:subClassOf obo:IAO_0000033 .
obo:GO_0008150 a rdfs:Class ;
rdfs:label "biological_process" ;
rdfs:comment "A process that emerges from two or more causally-connected macromolecular activities and has evolved to achieve a biological objective." ;
rdfs:subClassOf obo:BFO_0000015 .
obo:SDDO_3000099 a rdfs:Class ;
rdfs:label "phenomenon"@en ;
rdfs:comment "A fact or situation that is observed to exist." .
obo:GO_0003674 a rdfs:Class ;
rdfs:label "molecular_function" ;
rdfs:comment "A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs." ;
rdfs:subClassOf obo:BFO_0000015 .
obo:RBO_00000033 a rdfs:Class ;
rdfs:label "spacecraft" ;
rdfs:comment "Vehicles, crewed or uncrewed, which are designed to orbit about the Earth or another celestial body or be placed into a trajectory to another celestial body or location in space." ;
rdfs:subClassOf obo:OBI_0000968 .
a rdfs:Class ;
rdfs:label "Contact"@en ;
rdfs:subClassOf .
obo:IAO_0000180 a rdfs:Class ;
rdfs:label "heatmap"@en ;
rdfs:comment """A heatmap is a report graph which is a graphical representation of data
where the values taken by a variable(s) are shown as colors in a
two-dimensional map."""@en ;
rdfs:subClassOf obo:IAO_0000038 .
obo:OBI_0000471 a rdfs:Class ;
rdfs:label "study design execution" ;
rdfs:comment "a planned process that carries out a study design" ;
rdfs:subClassOf obo:OBI_0000011 .
obo:BFO_0000016 a rdfs:Class ;
rdfs:label "disposition"@en ;
rdfs:subClassOf obo:BFO_0000017 .
obo:SLSO_0000046 a rdfs:Class ;
rdfs:label "newsletter document" ;
rdfs:comment "NCIt Definition: A regularly issued printed or electronic report describing a main topic of interest to its subscribers." ;
rdfs:subClassOf obo:SLSO_0000028 .
obo:OBI_0000704 a rdfs:Class ;
rdfs:label "decision tree induction objective" ;
rdfs:comment "A decision tree induction objective is a data transformation objective in which a tree-like graph of edges and nodes is created and from which the selection of each branch requires that some type of logical decision is made." ;
rdfs:subClassOf obo:OBI_0200166 .
a rdfs:Class ;
rdfs:label "Subject Encoding Schemes"@en-US ;
rdfs:comment "A set of subject encoding schemes and/or formats"@en-US .
obo:SLSO_0000035 a rdfs:Class ;
rdfs:label "dataset file" ;
rdfs:comment "A set of related data (either written or electronic) and is a part of a dataset" ;
rdfs:subClassOf obo:IAO_0000027 .
obo:SLSO_0001153 a rdf:Property ;
rdfs:label "s3 file guid" ;
rdfs:domain obo:SLSO_0000035 ;
rdfs:range .
obo:SLSO_0001157 a rdf:Property ;
rdfs:label "file type" ;
rdfs:domain obo:SLSO_0000035 ;
rdfs:range .
obo:SLSO_0001155 a rdf:Property ;
rdfs:label "file extension" ;
rdfs:domain obo:SLSO_0000035 ;
rdfs:range .
obo:SLSO_0001103 a rdf:Property ;
rdfs:label "file name" ;
rdfs:comment "The name (or part of a name) of a file (of any type)" ;
rdfs:domain obo:SLSO_0000035 ;
rdfs:range .
a rdfs:Class ;
rdfs:label "MedicalObservationalStudy"@en ;
rdfs:comment "An observational study is a type of medical study that attempts to infer the possible effect of a treatment through observation of a cohort of subjects over a period of time. In an observational study, the assignment of subjects into treatment groups versus control groups is outside the control of the investigator. This is in contrast with controlled studies, such as the randomized controlled trials represented by MedicalTrial, where each subject is randomly assigned to a treatment group or a control group before the start of the treatment."@en .
a rdf:Property ;
rdfs:label "studyDesign"@en ;
rdfs:comment "Specifics about the observational study design (enumerated)."@en ;
rdfs:range .
a rdfs:Class ;
rdfs:label "application programming interface" ;
rdfs:comment "An application programming interface is a set of routines, protocols, and tools for building software applications. An API expresses a software component in terms of its operations, inputs, outputs, and underlying types. An API defines functionalities that are independent of their respective implementations, which allows definitions and implementations to vary without compromising each other. The API specifies how software components should interact." ;
rdfs:subClassOf .
a rdfs:Class ;
rdfs:label "MedicalGuidelineRecommendation"@en ;
rdfs:comment "A guideline recommendation that is regarded as efficacious and where quality of the data supporting the recommendation is sound."@en .
a rdf:Property ;
rdfs:label "recommendationStrength"@en ;
rdfs:comment "Strength of the guideline's recommendation (e.g. 'class I')."@en ;
rdfs:range .
a rdfs:Class ;
rdfs:label "Fax"@en ;
rdfs:subClassOf .
obo:IAO_0000030 a rdfs:Class ;
rdfs:label "information content entity" ;
rdfs:comment "An information content entity is an entity that is generically dependent on some artifact and stands in relation of aboutness to some entity." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:SDDO_3000088 a rdfs:Class ;
rdfs:label "mission"@en ;
rdfs:comment "Coordinated tasks and operations undertaken to meet a set of specific objectives, within clearly delineated time and location constraints." ;
rdfs:subClassOf obo:OBI_0000011 .
obo:SDDO_3000015 a rdf:Property ;
rdfs:label "organizedBy"@en ;
rdfs:range .
obo:SDDO_3000018 a rdf:Property ;
rdfs:label "deployedOn"@en ;
rdfs:range .
obo:SDDO_3000059 a rdfs:Class ;
rdfs:label "space agency"@en ;
rdfs:comment "A government agency engaged in activities related to outer space and space exploration." ;
rdfs:subClassOf obo:SDDO_3000103 .
obo:OBIB_0000726 a rdfs:Class ;
rdfs:label "normal specimen"@en ;
rdfs:comment "A specimen that is normal."@en ;
rdfs:subClassOf obo:OBI_0100051 .
obo:SLSO_0000020 a rdfs:Class ;
rdfs:label "experiment document" ;
rdfs:comment "Any document (electronic or written record) that is about an experiment process (limited to the conduct of the experiment)" ;
rdfs:subClassOf obo:SLSO_0000028 .
obo:OBI_0000103 a rdfs:Class ;
rdfs:label "principal investigator role"@en ;
rdfs:comment "a responsible party role played by a person responsible for the overall conduct of a study"@en ;
rdfs:subClassOf obo:OBI_0000102 .
obo:NCBITaxon_7742 a rdfs:Class ;
rdfs:label "Vertebrata " ;
rdfs:subClassOf obo:NCBITaxon_33213 .
a rdfs:Class ;
rdfs:label "Spouse"@en ;
rdfs:subClassOf .
obo:ExO_0000110 a rdfs:Class ;
rdfs:label "sex" ;
rdfs:comment "The assemblage of physical properties or qualities by which male is distinguished from female; the physical difference between male and female; the distinguishing peculiarity of male or female." ;
rdfs:subClassOf obo:ExO_0000103 .
obo:OBI_0000272 a rdfs:Class ;
rdfs:label "protocol"@en ;
rdfs:comment "A plan specification which has sufficient level of detail and quantitative information to communicate it between investigation agents, so that different investigation agents will reliably be able to independently reproduce the process."@en ;
rdfs:subClassOf obo:IAO_0000104 .
obo:OBI_0000458 a rdfs:Class ;
rdfs:label "manufacturing objective"@en ;
rdfs:comment "is the objective to manufacture a material of a certain function (device)"@en ;
rdfs:subClassOf obo:OBI_0000456 .
a rdfs:Class ;
rdfs:label "Place Encoding Schemes"@en-US ;
rdfs:comment "A set of geographic place encoding schemes and/or formats"@en-US .
obo:UBERON_0000477 a rdfs:Class ;
rdfs:label "anatomical cluster" ;
rdfs:comment "Anatomical group whose component anatomical structures lie in close proximity to each other." ;
rdfs:subClassOf obo:BFO_0000040 .
obo:SDDO_3000069 a rdfs:Class ;
rdfs:label "study"@en ;
rdfs:comment "A data product from the GeneLab repository" ;
rdfs:subClassOf obo:SDDO_3000051 .
a rdfs:Class ;
rdfs:label "Email"@en ;
rdfs:comment "To specify the electronic mail address for communication with the object the vCard represents. Use the hasEmail object property."@en .
obo:OBI_0000338 a rdfs:Class ;
rdfs:label "drawing a conclusion based on data"@en ;
rdfs:comment "A planned process in which data gathered in an investigation is evaluated in the context of existing knowledge with the objective to generate more general conclusions or to conclude that the data does not allow one to draw general conclusion"@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:BFO_0000001 a rdfs:Class ;
rdfs:label "entity"@en .
obo:GO_0003824 a rdfs:Class ;
rdfs:label "catalytic activity" ;
rdfs:subClassOf obo:GO_0003674 .
obo:OBI_0000017 a rdfs:Class ;
rdfs:label "regulatory role"@en ;
rdfs:comment "a role which inheres in material entities and is realized in the processes of making, enforcing or being defined by legislation or orders issued by a governmental body."@en ;
rdfs:subClassOf obo:BFO_0000023 .
a rdfs:Class ;
rdfs:label "MedicalRiskScore"@en ;
rdfs:comment "A simple system that adds up the number of risk factors to yield a score that is associated with prognosis, e.g. CHAD score, TIMI risk score."@en .
a rdf:Property ;
rdfs:label "algorithm"@en ;
rdfs:comment "The algorithm or rules to follow to compute the score."@en ;
rdfs:range .
obo:NCBITaxon_9606 a rdfs:Class ;
rdfs:label "Homo sapiens" ;
rdfs:subClassOf obo:NCBITaxon_314146 .
obo:T4FS_0000347 a rdfs:Class ;
rdfs:label "dataset"@en ;
rdfs:comment "Any organized collection of data in a computational format, defined by a theme or category that reflects what is being measured/observed/monitored. The presentation of the data in the application is enabled through metadata.REFERENCE. Research Data Alliance http://smw-rda.esc.rzg.mpg.de/index.php/Main_Page ; Mapping the Data Landscape 2011 Summit; TBS Standard on Geospatial Data (ISO 19115:2003); Environment Canada data stewardship … .
obo:SLSO_0001100 a rdf:Property ;
rdfs:label "configuration name" ;
rdfs:domain obo:SLSO_0000036 ;
rdfs:range .
obo:SLSO_0001096 a rdf:Property ;
rdfs:label "component name" ;
rdfs:domain obo:SLSO_0000036 ;
rdfs:range .
obo:SLSO_0001069 a rdf:Property ;
rdfs:label "hardware description" ;
rdfs:domain obo:SLSO_0000037 ;
rdfs:range .
obo:SLSO_0001097 a rdf:Property ;
rdfs:label "configuration_description" ;
rdfs:domain obo:SLSO_0000036 ;
rdfs:range .
obo:SLSO_0001098 a rdf:Property ;
rdfs:label "hardware type" ;
rdfs:domain obo:SLSO_0000037 ;
rdfs:range