PREFIX obo:
PREFIX rdf:
PREFIX rdfs:
PREFIX xsd:
obo:GENO_0000481 a rdfs:Class ;
rdfs:label "genomic feature"@en ;
rdfs:comment "A sequence feature (continuous extent of biological sequence) that is of genomic origin (i.e. carries sequence from the genome of a cell or organism)" ;
rdfs:subClassOf obo:GENO_0000897 , obo:SO_0000110 .
obo:RO_0002162 a rdf:Property ;
rdfs:label "in taxon" ;
rdfs:comment "x is in taxon y if an only if y is an organism, and the relationship between x and y is one of: part of (reflexive), developmentally preceded by, derives from, secreted by, expressed." ;
rdfs:range obo:OBI_0100026 ;
rdfs:subPropertyOf obo:RO_0002320 .
obo:RO_0002200 a rdf:Property ;
rdfs:label "has phenotype" ;
rdfs:comment "A relationship that holds between a biological entity and a phenotype. Here a phenotype is construed broadly as any kind of quality of an organism part, a collection of these qualities, or a change in quality or qualities (e.g. abnormally increased temperature). The subject of this relationship can be an organism (where the organism has the phenotype, i.e. the qualities inhere in parts of this organism), a genomic entity such as a gene or genotype (if modifications of the gene or the genotype causes the phenotype), or a condition such as a disease (such that if the condition inheres in an organism, then the organism has the phenotype)." ;
rdfs:range obo:UPHENO_0001001 ;
rdfs:subPropertyOf obo:RO_0016001 .
obo:BFO_0000050 a rdf:Property ;
rdfs:label "is part of" ;
rdfs:comment "a core relation that holds between a part and its whole"@en ;
rdfs:seeAlso ;
rdfs:range obo:BFO_0000031 , obo:BFO_0000004 , obo:BFO_0000020 , obo:BFO_0000017 , obo:BFO_0000003 , obo:BFO_0000019 , obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002131 .
obo:IAO_0000235 a rdf:Property ;
rdfs:label "denoted by"@en ;
rdfs:comment "inverse of the relation 'denotes'"@en ;
rdfs:domain obo:BFO_0000001 ;
rdfs:range obo:IAO_0000030 .
obo:GENO_0000239 a rdf:Property ;
rdfs:label "has_sequence" ;
rdfs:comment "A relationship between an entity that carries a sequence (e.g. a sequence feature or collection), and the sequence it bears." ;
rdfs:range obo:GENO_0000702 .
obo:RO_0002506 a rdf:Property ;
rdfs:label "causal relation between entities" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:GENO_0000903 a rdf:Property ;
rdfs:label "has_location"@en ;
rdfs:comment "A relation linking a sequence feature to the location it occupies on some reference sequence." ;
rdfs:domain obo:SO_0000110 ;
rdfs:range obo:GENO_0000815 .
obo:RO_0000058 a rdf:Property ;
rdfs:label "is concretized as"@en ;
rdfs:comment "A relationship between a generically dependent continuant and a specifically dependent continuant or process, in which the generically dependent continuant depends on some independent continuant or process in virtue of the fact that the specifically dependent continuant or process also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants or processes."@en ;
rdfs:domain obo:BFO_0000031 ;
rdfs:range xsd:string .
obo:GENO_0000703 a rdf:Property ;
rdfs:label "has_sequence_string"@en ;
rdfs:comment "Shortcut relation linking a sequence feature directly to a string representing the 'state' of its sequence - i.e. the ordering of units that comprise it (e.g. 'atgcagctagctaccgtcgatcg')." ;
rdfs:domain obo:SO_0000110 ;
rdfs:range xsd:string .
obo:GENO_0000207 a rdf:Property ;
rdfs:label "has_sequence_attribute" ;
rdfs:comment "A relation used to link sequence entities (sequences, features, qualified features, and collections thereof) to their 'attributes'." ;
rdfs:range .
obo:GENO_0000408 a rdf:Property ;
rdfs:label "is_allele_of" ;
rdfs:comment "A relation linking an instance of a variable feature (aka an allele) to a genomic location/locus it occupies. This is typically a gene locus, but a feature may be an allele of other types of named loci such as QTLs, or alleles of some unnamed locus of arbitrary size." ;
rdfs:domain obo:GENO_0000481 ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000418 .
obo:RO_0002258 a rdf:Property ;
rdfs:label "developmentally preceded by"@en ;
rdfs:comment "Candidate definition: x developmentally related to y if and only if there exists some developmental process (GO:0032502) p such that x and y both participates in p, and x is the output of p and y is the input of p" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002324 .
obo:RO_0000056 a rdf:Property ;
rdfs:label "participates in" ;
rdfs:comment "a relation between a continuant and a process, in which the continuant is somehow involved in the process" ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000003 .
obo:RO_0002566 a rdf:Property ;
rdfs:label "causally influences" ;
rdfs:comment "The entity or characteristic A is causally upstream of the entity or characteristic B, A having an effect on B. An entity corresponds to any biological type of entity as long as a mass is measurable. A characteristic corresponds to a particular specificity of an entity (e.g., phenotype, shape, size)." ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002506 .
obo:RO_0010001 a rdf:Property ;
rdfs:label "generically depends on" ;
rdfs:comment "A generically dependent continuant *b* generically depends on an independent continuant *c* at time *t* means: there inheres in *c* a specifically deendent continuant which concretizes *b* at *t*." ;
rdfs:domain obo:BFO_0000031 ;
rdfs:range obo:BFO_0000004 .
obo:NCBITaxon_117571 a rdfs:Class ;
rdfs:label "Euteleostomi" ;
rdfs:subClassOf obo:NCBITaxon_7742 .
obo:RO_0002450 a rdf:Property ;
rdfs:label "directly positively regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that positively regulates an activity performed by B.
For example, A and B may be gene products and binding of B by A positively regulates the kinase activity of B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002448 .
obo:RO_0002449 a rdf:Property ;
rdfs:label "directly negatively regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that negatively regulates an activity performed by B.
For example, A and B may be gene products and binding of B by A negatively regulates the kinase activity of B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002448 .
obo:RO_0001000 a rdf:Property ;
rdfs:label "derives from" ;
rdfs:comment "a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000004 , obo:CL_0000236 .
obo:RO_0002448 a rdf:Property ;
rdfs:label "directly regulates activity of" ;
rdfs:comment """The entity A, immediately upstream of the entity B, has an activity that regulates an activity performed by B. For example, A and B may be gene products and binding of B by A regulates the kinase activity of B.
A and B can be physically interacting but not necessarily. Immediately upstream means there are no intermediate entity between A and B.""" ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0011002 , obo:RO_0002436 .
obo:RO_0010002 a rdf:Property ;
rdfs:label "is carrier of"@en ;
rdfs:comment "*b* is carrier of *c* at time *t* if and only if *c* *g-depends on* *b* at *t*" ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000031 .
obo:RO_0002202 a rdf:Property ;
rdfs:label "develops from"@en ;
rdfs:comment "x develops from y if and only if either (a) x directly develops from y or (b) there exists some z such that x directly develops from z and z develops from y" ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000004 ;
rdfs:subPropertyOf obo:RO_0002258 , obo:RO_0002254 .
obo:RO_0011002 a rdf:Property ;
rdfs:label "regulates activity of" ;
rdfs:comment "The entity A has an activity that regulates an activity of the entity B. For example, A and B are gene products where the catalytic activity of A regulates the kinase activity of B." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 ;
rdfs:subPropertyOf obo:RO_0002566 .
obo:RO_0000087 a rdf:Property ;
rdfs:label "has role" ;
rdfs:comment "a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000023 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0002215 a rdf:Property ;
rdfs:label "capable of"@en ;
rdfs:comment "A relation between a material entity (such as a cell) and a process, in which the material entity has the ability to carry out the process. " ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002216 .
obo:RO_0000085 a rdf:Property ;
rdfs:label "has function"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a function, in which the function specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000034 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0002595 a rdf:Property ;
rdfs:label "causal relation between material entity and a process" ;
rdfs:comment "A relationship that holds between a material entity and a process in which causality is involved, with either the material entity or some part of the material entity exerting some influence over the process, or the process influencing some aspect of the material entity." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0000091 a rdf:Property ;
rdfs:label "has disposition" ;
rdfs:comment "a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence" ;
rdfs:domain obo:BFO_0000004 ;
rdfs:range obo:BFO_0000016 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0002434 a rdf:Property ;
rdfs:label "interacts with" ;
rdfs:comment "A relationship that holds between two entities in which the processes executed by the two entities are causally connected." ;
rdfs:domain obo:BFO_0000040 ;
rdfs:range obo:BFO_0000040 .
obo:SO_0001218 a rdfs:Class ;
rdfs:label "transgenic_insertion" ;
rdfs:comment "An insertion that derives from another organism, via the use of recombinant DNA technology." ;
rdfs:subClassOf obo:SO_0000667 .
obo:BFO_0000051 a rdf:Property ;
rdfs:label "has part" ;
rdfs:comment "a core relation that holds between a whole and its part"@en ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0002131 .
obo:GENO_0000683 a rdf:Property ;
rdfs:label "varies_with"@en ;
rdfs:comment "A relation that holds between two sequence features at a particular genomic location that vary in their sequence. These features will have the same position when mapped onto a reference sequence, but vary in their sequence (in whole or in part)." ;
rdfs:range .
obo:GENO_0000784 a rdf:Property ;
rdfs:label "completely_varies_with"@en ;
rdfs:comment "A relation between two seqeunces or features that are considered variant with each other along their entire extents." ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000683 .
a rdfs:Class ;
rdfs:label "Both strands"@en ;
rdfs:subClassOf .
obo:GENO_0000966 a rdf:Property ;
rdfs:label "has_interval" ;
rdfs:comment "Relates a sequence feature location to an interval that defines its start and end position." ;
rdfs:domain obo:GENO_0000815 ;
rdfs:range .
obo:GENO_0000131 a rdfs:Class ;
rdfs:label "in cis" ;
rdfs:comment "A quality inhering in a collection of discontinuous sequence features in a single genome that reside on the same macromolecule (eg the same chromosomes)." ;
rdfs:subClassOf obo:GENO_0000886 .
obo:RO_0000059 a rdf:Property ;
rdfs:label "concretizes"@en ;
rdfs:comment "A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant." ;
rdfs:domain obo:BFO_0000020 ;
rdfs:range obo:BFO_0000031 .
obo:BFO_0000034 a rdfs:Class ;
rdfs:label "function"@en ;
rdfs:subClassOf obo:BFO_0000016 .
obo:BFO_0000054 a rdf:Property ;
rdfs:label "realized in"@en ;
rdfs:comment "Paraphrase of elucidation: a relation between a realizable entity and a process, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ;
rdfs:domain obo:BFO_0000017 ;
rdfs:range obo:BFO_0000015 , obo:OBI_0000011 , obo:OBI_0000457 .
obo:RO_0000079 a rdf:Property ;
rdfs:label "function of"@en ;
rdfs:comment "a relation between a function and an independent continuant (the bearer), in which the function specifically depends on the bearer for its existence"@en ;
rdfs:domain obo:BFO_0000034 ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0000052 .
obo:UBERON_0000465 a rdfs:Class ;
rdfs:label "material anatomical entity" ;
rdfs:comment "Anatomical entity that has mass." ;
rdfs:subClassOf obo:UBERON_0001062 .
obo:RO_0020105 a rdf:Property ;
rdfs:label "is anatomical entity" ;
rdfs:comment "This property only applies to anatomical entities." ;
rdfs:domain obo:UBERON_0001062 ;
rdfs:range .
obo:RO_0002254 a rdf:Property ;
rdfs:label "has developmental contribution from"@en ;
rdfs:comment "x has developmental contribution from y iff x has some part z such that z develops from y"@en ;
rdfs:domain obo:UBERON_0001062 ;
rdfs:range obo:UBERON_0001062 ;
rdfs:subPropertyOf obo:RO_0002258 .
obo:RO_0002384 a rdf:Property ;
rdfs:label "has developmental potential involving"@en ;
rdfs:comment "x has developmental potential involving y iff x is capable of a developmental process with output y. y may be the successor of x, or may be a different structure in the vicinity (as for example in the case of developmental induction)."@en ;
rdfs:domain obo:UBERON_0001062 ;
rdfs:range obo:UBERON_0001062 ;
rdfs:subPropertyOf obo:RO_0002324 .
obo:SO_0000783 a rdfs:Class ;
rdfs:label "engineered" ;
rdfs:comment "An attribute to describe a region that was modified in vitro." ;
rdfs:subClassOf obo:GENO_0000788 .
obo:SO_0000207 a rdfs:Class ;
rdfs:label "simple_sequence_length_variation" ;
rdfs:subClassOf obo:SO_0000248 .
obo:GENO_0000902 a rdfs:Class ;
rdfs:label "genomic feature location"@en ;
rdfs:comment "The location of a sequence feature in a genome, defined by its start and end position on some reference genomic coordinate system" ;
rdfs:subClassOf obo:GENO_0000815 .
obo:GENO_0000528 a rdfs:Class ;
rdfs:label "transiently-expressed transgene complement" ;
rdfs:comment "The set of all transgenes trransiently expressed in a biological system in the context of a given experiment." ;
rdfs:subClassOf obo:GENO_0000715 .
obo:GENO_0000382 a rdf:Property ;
rdfs:label "has_variant_part"@en ;
rdfs:comment "A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is variant in terms of its sequence, position, or expression." ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000654 .
obo:GENO_0000726 a rdf:Property ;
rdfs:label "has_sequence_feature"@en ;
rdfs:comment "A relation linking a qualified sequence feature to its component sequence feature." ;
rdfs:range obo:SO_0000110 .
obo:RO_0002351 a rdf:Property ;
rdfs:label "has member" ;
rdfs:comment "has member is a mereological relation between a collection and an item." ;
rdfs:range , obo:NCBITaxon_8090 , obo:NCBITaxon_7955 , obo:OBI_0100051 ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:IAO_0000009 a rdfs:Class ;
rdfs:label "datum label"@en ;
rdfs:comment "A label is a symbol that is part of some other datum and is used to either partially define the denotation of that datum or to provide a means for identifying the datum as a member of the set of data with the same label"@en ;
rdfs:subClassOf obo:IAO_0000030 .
obo:IAO_0000219 a rdf:Property ;
rdfs:label "denotes" ;
rdfs:comment "Denotes is a primitive, instance-level, relation obtaining between an information content entity and some portion of reality. Denotation is what happens when someone creates an information content entity E in order to specifically refer to something. The only relation between E and the thing is that E can be used to 'pick out' the thing. This relation connects those two together. Freedictionary.com sense 3: To signify directly; refer to specifically" ;
rdfs:domain obo:IAO_0000030 ;
rdfs:range obo:BFO_0000001 ;
rdfs:subPropertyOf obo:IAO_0000136 .
obo:IAO_0000136 a rdf:Property ;
rdfs:label "is about" ;
rdfs:comment "is_about is a (currently) primitive relation that relates an information artifact to an entity." ;
rdfs:domain obo:IAO_0000030 ;
rdfs:range .
obo:GENO_0000937 a rdfs:Class ;
rdfs:label "complete X-linked dominant inheritance"@en ;
rdfs:comment "An X-linked dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." ;
rdfs:subClassOf obo:GENO_0000146 .
obo:GENO_0000030 a rdfs:Class ;
rdfs:label "variant single locus complement" ;
rdfs:comment "A single locus complement in which at least one member allele is considered variant, and/or the total number of features in the complement deviates from the normal poloidy of the reference genome (e.g. trisomy 13)." ;
rdfs:subClassOf obo:GENO_0000516 .
obo:GENO_0000608 a rdf:Property ;
rdfs:label "has_zygosity"@en ;
rdfs:comment "a relation to link a single locus complement to its zygosity." ;
rdfs:domain obo:GENO_0000516 ;
rdfs:range obo:GENO_0000133 ;
rdfs:subPropertyOf obo:GENO_0000207 .
obo:GENO_0000917 a rdf:Property ;
rdfs:label "has_member_count"@en ;
rdfs:comment "Describes the number of members in some set." ;
rdfs:range .
obo:GENO_0000152 a rdfs:Class ;
rdfs:label "reference" ;
rdfs:comment "An attribute inhering in a feature that is designated to serve as a standard against which 'variant' versions of the same location are compared." ;
rdfs:subClassOf obo:GENO_0000773 .
obo:OBI_0000094 a rdfs:Class ;
rdfs:label "material processing"@en ;
rdfs:comment "A planned process which results in physical changes in a specified input material"@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:BFO_0000062 a rdf:Property ;
rdfs:label "preceded by"@en ;
rdfs:comment "x is preceded by y if and only if the time point at which y ends is before or equivalent to the time point at which x starts. Formally: x preceded by y iff ω(y) <= α(x), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point."@en ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002086 .
obo:BFO_0000063 a rdf:Property ;
rdfs:label "precedes"@en ;
rdfs:comment "x precedes y if and only if the time point at which x ends is before or equivalent to the time point at which y starts. Formally: x precedes y iff ω(x) <= α(y), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point."@en ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002222 .
obo:RO_0002091 a rdf:Property ;
rdfs:label "starts during" ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002222 .
obo:RO_0002501 a rdf:Property ;
rdfs:label "causal relation between processes" ;
rdfs:comment "p is causally related to q if and only if p or any part of p and q or any part of q are linked by a chain of events where each event pair is one where the execution of p influences the execution of q. p may be upstream, downstream, part of, or a container of q." ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0019000 a rdf:Property ;
rdfs:label "regulates characteristic" ;
rdfs:comment "A relationship that holds between a process and a characteristic in which process (P) regulates characteristic (C) iff: P results in the existence of C OR affects the intensity or magnitude of C." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:PATO_0000001 ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:OBI_0000417 a rdf:Property ;
rdfs:label "achieves_planned_objective" ;
rdfs:comment "This relation obtains between a planned process and a objective specification when the criteria specified in the objective specification are met at the end of the planned process." ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:IAO_0000005 .
obo:RO_0002233 a rdf:Property ;
rdfs:label "has input"@en ;
rdfs:comment "p has direct input c iff c is a participant in p, c is present at the start of p, and the state of c is modified during p." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:RO_0002211 a rdf:Property ;
rdfs:label "regulates"@en ;
rdfs:comment "p regulates q iff p is causally upstream of q, the execution of p is not constant and varies according to specific conditions, and p influences the rate or magnitude of execution of q due to an effect either on some enabler of q or some enabler of a part of q." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002411 .
obo:OBI_0000293 a rdf:Property ;
rdfs:label "has_specified_input" ;
rdfs:comment "A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of." ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:BFO_0000040 , obo:IAO_0000027 , obo:BFO_0000002 , obo:OBI_0000648 ;
rdfs:subPropertyOf obo:RO_0002233 , obo:RO_0000057 .
obo:RO_0002018 a rdf:Property ;
rdfs:label "has component process" ;
rdfs:comment "w 'has process component' p if p and w are processes, w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type." ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002180 .
obo:OBI_0000299 a rdf:Property ;
rdfs:label "has_specified_output" ;
rdfs:comment "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of." ;
rdfs:domain obo:OBI_0000011 ;
rdfs:range obo:BFO_0000002 ;
rdfs:subPropertyOf obo:RO_0002234 , obo:RO_0000057 .
obo:BFO_0000055 a rdf:Property ;
rdfs:label "realizes"@en ;
rdfs:comment "Paraphrase of elucidation: a relation between a process and a realizable entity, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000017 .
obo:RO_0000057 a rdf:Property ;
rdfs:label "has participant" ;
rdfs:comment "a relation between a process and a continuant, in which the continuant is somehow involved in the process" ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000002 .
obo:RO_0002222 a rdf:Property ;
rdfs:label "temporal relation"@en ;
rdfs:comment "A relation that holds between two occurrents. This is a grouping relation that collects together all the Allen relations." ;
rdfs:domain obo:BFO_0000003 ;
rdfs:range obo:BFO_0000003 .
obo:RO_0002334 a rdf:Property ;
rdfs:label "regulated by"@en ;
rdfs:comment "inverse of regulates" ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0002427 .
obo:RO_0002414 a rdf:Property ;
rdfs:label "transitively provides input for"@en ;
rdfs:comment "transitive form of directly_provides_input_for" ;
rdfs:domain obo:BFO_0000015 ;
rdfs:range obo:BFO_0000015 ;
rdfs:subPropertyOf obo:RO_0004047 .
obo:GENO_0000351 a rdfs:Class ;
rdfs:label "biological process" ;
rdfs:subClassOf obo:BFO_0000015 .
obo:OBI_0000947 a rdfs:Class ;
rdfs:label "service provider role" ;
rdfs:comment "is a role which inheres in a person or organization and is realized in in a planned process which provides access to training, materials or execution of protocols for an organization or person" ;
rdfs:subClassOf obo:BFO_0000023 .
obo:BFO_0000017 a rdfs:Class ;
rdfs:label "realizable entity" ;
rdfs:comment "A specifically dependent continuant that inheres in continuant entities and are not exhibited in full at every time in which it inheres in an entity or group of entities. The exhibition or actualization of a realizable entity is a particular manifestation, functioning or process that occurs under certain circumstances."@en ;
rdfs:subClassOf obo:BFO_0000020 .
obo:SO_0000353 a rdfs:Class ;
rdfs:label "sequence_assembly" ;
rdfs:comment "A sequence of nucleotides that has been algorithmically derived from an alignment of two or more different sequences." ;
rdfs:subClassOf obo:SO_0001248 .
obo:SO_0000704 a rdfs:Class ;
rdfs:label "gene" ;
rdfs:comment "A region (or regions) that includes all of the sequence elements necessary to encode a functional transcript. A gene may include regulatory regions, transcribed regions and/or other functional sequence regions." ;
rdfs:subClassOf obo:GENO_0000481 .
obo:GENO_0000887 a rdfs:Class ;
rdfs:label "oryzias latipes strain" ;
rdfs:subClassOf obo:GENO_0000112 .
obo:OBI_0200172 a rdfs:Class ;
rdfs:label "partitioning objective"@en ;
rdfs:comment "A partitioning objective is a data transformation objective where the aim is to generate a collection of disjoint non-empty subsets whose union equals a non-empty input set."@en ;
rdfs:subClassOf obo:OBI_0200166 .
obo:OBI_0000833 a rdf:Property ;
rdfs:label "objective_achieved_by" ;
rdfs:comment "This relation obtains between an objective specification and a planned process when the criteria specified in the objective specification are met at the end of the planned process." ;
rdfs:domain obo:IAO_0000005 ;
rdfs:range obo:OBI_0000011 .
obo:GENO_0000941 a rdfs:Class ;
rdfs:label "Y-linked inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a Y-chromosome." ;
rdfs:subClassOf obo:GENO_0000935 .
obo:OBI_0001933 a rdfs:Class ;
rdfs:label "value specification" ;
rdfs:comment "An information content entity that specifies a value within a classification scheme or on a quantitative scale." ;
rdfs:subClassOf obo:IAO_0000030 .
obo:GENO_0000684 a rdfs:Class ;
rdfs:label "novel replicon"@en ;
rdfs:comment "A genomic feature that represents an entirely new replicon in the genome, e.g. an extrachromosomal replicon or an extra copy of a chromosome." ;
rdfs:subClassOf obo:SO_0001059 .
obo:GENO_0000962 a rdfs:Class ;
rdfs:label "variant copy number complement"@en ;
rdfs:comment "A 'copy number complement' that has an abnormal number of members, as the result of deletion or duplication event(s)." ;
rdfs:subClassOf obo:GENO_0000961 .
obo:GENO_0000959 a rdf:Property ;
rdfs:label "has_defining_feature"@en ;
rdfs:comment "Holds between a copy number complement or functional copy number complement and a genomic feature that serves as a proxy for the sequence that defines the complement." ;
rdfs:range obo:SO_0000110 .
obo:GENO_0000958 a rdf:Property ;
rdfs:label "has_defining_sequence"@en ;
rdfs:comment "Holds between a copy number complement or functional copy number complement, and the biological sequence that defines the complement." ;
rdfs:range obo:GENO_0000702 .
obo:GENO_0000957 a rdf:Property ;
rdfs:label "has_defining_location"@en ;
rdfs:comment "Holds between a copy number complement or functional copy number complement, and a genomic location that serves as a proxy for the sequence or functional element that defines the complement." ;
rdfs:range obo:GENO_0000815 .
obo:OBI_0000663 a rdfs:Class ;
rdfs:label "class prediction data transformation"@en ;
rdfs:comment "A class prediction data transformation (sometimes called supervised classification) is a data transformation that has objective class prediction."@en ;
rdfs:subClassOf obo:OBI_0200000 .
obo:GENO_0000873 a rdfs:Class ;
rdfs:label "microsatellite alteration"@en ;
rdfs:subClassOf obo:GENO_0000874 .
obo:SO_0001784 a rdfs:Class ;
rdfs:label "complex_structural_alteration" ;
rdfs:comment "A structural sequence alteration where there are multiple equally plausible explanations for the change." ;
rdfs:subClassOf obo:SO_0001785 .
obo:OBI_0200042 a rdfs:Class ;
rdfs:label "hierarchical clustering"@en ;
rdfs:comment "A hierarchical clustering is a data transformation which achieves a class discovery objective, which takes as input data item and builds a hierarchy of clusters. The traditional representation of this hierarchy is a tree (visualized by a dendrogram), with the individual input objects at one end (leaves) and a single cluster containing every object at the other (root)."@en ;
rdfs:subClassOf obo:APOLLO_SV_00000796 , obo:OBI_0200175 .
obo:IAO_8000003 a rdfs:Class ;
rdfs:label "main release ontology module"@en ;
rdfs:comment "An ontology module that is intended to be the primary release product and the one consumed by the majority of tools."@en ;
rdfs:subClassOf obo:IAO_8000000 .
obo:GENO_0000833 a rdfs:Class ;
rdfs:label "genotype-phenotype association"@en ;
rdfs:subClassOf .
a rdf:Property ;
rdfs:label "association has object"@en ;
rdfs:range .
obo:GENO_0000580 a rdf:Property ;
rdfs:label "has_qualifier" ;
rdfs:comment "A relation used to describe a context or conditions that define and/or identify an entity." ;
rdfs:range .
obo:GENO_0000861 a rdfs:Class ;
rdfs:label "extra-chromosomal transgene"@en ;
rdfs:comment "A transgene that is not chromosomally integrated in the host genome, but instead exists as part of an extra-chromosomal construct." ;
rdfs:subClassOf obo:SO_0000902 .
obo:IAO_8000014 a rdfs:Class ;
rdfs:label "generated ontology module"@en ;
rdfs:comment "An ontology module that is automatically generated, for example via a SPARQL query or via template and a CSV."@en ;
rdfs:subClassOf obo:IAO_8000000 .
obo:SO_1000010 a rdfs:Class ;
rdfs:label "pyrimidine_transition" ;
rdfs:comment "A substitution of a pyrimidine, C or T, for another pyrimidine." ;
rdfs:subClassOf obo:SO_1000009 .
obo:GENO_0000480 a rdfs:Class ;
rdfs:label "mutant"@en ;
rdfs:comment "An attribute inhering in a feature bearing a sequence alteration that is present at very low levels in a given population (typically less than 1%), or that has been experimentally generated to alter the feature with respect to some reference sequence." ;
rdfs:subClassOf obo:GENO_0000773 .
obo:GENO_0000952 a rdfs:Class ;
rdfs:label "sex-limited autosomal dominant inheritance"@en ;
rdfs:comment "An autosomal dominant inheritance pattern wherein the trait manifests in heterozygotes in a sex-specific manner (i.e. only in males or only in females)." ;
rdfs:subClassOf obo:GENO_0000147 .
obo:GENO_0000002 a rdfs:Class ;
rdfs:label "variant allele" ;
rdfs:comment "An allele that varies in it sequence from what is considered the reference or canonical sequence at that location." ;
rdfs:subClassOf obo:GENO_0000512 .
obo:GENO_0000641 a rdf:Property ;
rdfs:label "is_variant_allele_of"@en ;
rdfs:comment "A relationship between a variant allele and the gene class it is an allele of." ;
rdfs:domain obo:GENO_0000002 ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000408 .
obo:HP_0000118 a rdfs:Class ;
rdfs:label "human phenotypic abnormality" ;
rdfs:comment "pulling in HP 'phenotypic abnormality' root here" ;
rdfs:subClassOf obo:UPHENO_0001001 .
obo:RO_0002201 a rdf:Property ;
rdfs:label "phenotype of"@en ;
rdfs:comment "inverse of has phenotype" ;
rdfs:domain obo:UPHENO_0001001 ;
rdfs:range .
obo:GENO_0000882 a rdfs:Class ;
rdfs:label "somatic allele origin"@en ;
rdfs:comment "Describes an allele that result from some spontaneous mutation event in a somatic cell after fertilization, and thus are not present in every cell in the body." ;
rdfs:subClassOf obo:GENO_0000877 .
obo:GENO_0000724 a rdfs:Class ;
rdfs:label "obsolete biological sequence or collection" .
obo:GENO_0000930 a rdfs:Class ;
rdfs:label "digenic inheritance"@en ;
rdfs:comment "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles in two genes." ;
rdfs:subClassOf obo:GENO_0000929 .
obo:SO_0001746 a rdfs:Class ;
rdfs:label "paternal_uniparental_disomy" ;
rdfs:comment "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the father and no copies of the same chromosome or region from the mother." ;
rdfs:subClassOf obo:SO_0001744 .
obo:CL_0000842 a rdfs:Class ;
rdfs:label "mononuclear cell" ;
rdfs:comment "A leukocyte with a single non-segmented nucleus in the mature form." ;
rdfs:subClassOf obo:CL_0000000 .
obo:IAO_0000183 a rdfs:Class ;
rdfs:label "dendrogram"@en ;
rdfs:comment """A dendrogram is a report graph which is a tree diagram
frequently used to illustrate the arrangement of the clusters produced by a
clustering algorithm."""@en ;
rdfs:subClassOf obo:IAO_0000038 .
obo:GENO_0000872 a rdfs:Class ;
rdfs:label "genomic sequence set"@en ;
rdfs:comment "A set of genomic sequences (a biological sequence that is of genomic origin)." ;
rdfs:subClassOf obo:GENO_0000922 .
obo:GENO_0000620 a rdfs:Class ;
rdfs:label "gneg"@en ;
rdfs:subClassOf obo:GENO_0000618 .
obo:GO_0032502 a rdfs:Class ;
rdfs:label "developmental process"@en ;
rdfs:comment "A biological process whose specific outcome is the progression of an integrated living unit: an anatomical structure (which may be a subcellular structure, cell, tissue, or organ), or organism over time from an initial condition to a later condition. [database_cross_reference: GOC:isa_complete]" ;
rdfs:subClassOf obo:GENO_0000351 .
obo:GENO_0000141 a rdfs:Class ;
rdfs:label "inheritance pattern" ;
rdfs:comment "The pattern in which a genetic trait or condition is passed from one generation to the next, as determined by genetic interactions between alleles of the causal gene, and interactions between these alleles and the environment." ;
rdfs:subClassOf obo:BFO_0000016 .
obo:GENO_0000147 a rdfs:Class ;
rdfs:label "autosomal dominant inheritance" ;
rdfs:comment "An inheritance pattern wherein a trait caused by alleles of an autosomal gene manifests in heterozygotes." ;
rdfs:subClassOf obo:GENO_0000934 .
obo:GENO_0000142 a rdfs:Class ;
rdfs:label "obsolete dominant inheritance" ;
rdfs:comment "disposition inhering in a genetic locus variant that is realized in its inheritance by some offspring such that at least a partial variant-associated phenotype is apparent in heterozygotes" .
obo:NCBITaxon_314146 a rdfs:Class ;
rdfs:label "Euarchontoglires" ;
rdfs:subClassOf obo:NCBITaxon_40674 .
obo:OBI_0000792 a rdfs:Class ;
rdfs:label "statistical model validation" ;
rdfs:comment "A data transformation which assesses how the results of a statistical analysis will generalize to an independent data set." ;
rdfs:subClassOf obo:OBI_0200171 .
obo:GENO_0000963 a rdfs:Class ;
rdfs:label "functional copy complement"@en ;
rdfs:comment "A set representing the complement of all functional versions of a specified sequence (typically that of a gene) in a particular genome." ;
rdfs:subClassOf obo:GENO_0000872 .
obo:OBI_0000457 a rdfs:Class ;
rdfs:label "manufacturing"@en ;
rdfs:comment "Manufacturing is a process with the intent to produce a processed material which will have a function for future use. A person or organization (having manufacturer role) is a participant in this process"@en ;
rdfs:subClassOf obo:OBI_0000094 .
obo:OBI_0000047 a rdfs:Class ;
rdfs:label "processed material"@en ;
rdfs:comment "Is a material entity that is created or changed during material processing."@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:OBI_0000312 a rdf:Property ;
rdfs:label "is_specified_output_of"@en ;
rdfs:comment "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of."@en ;
rdfs:domain obo:BFO_0000002 ;
rdfs:range obo:OBI_0000011 ;
rdfs:subPropertyOf obo:RO_0000056 .
obo:GENO_0000850 a rdfs:Class ;
rdfs:label "P-element construct"@en ;
rdfs:comment "A construct that contains a mobile P-element, holding sequences to be delivered to a target cell or genome." ;
rdfs:subClassOf obo:GENO_0000856 .
obo:GENO_0000877 a rdfs:Class ;
rdfs:label "allele origin"@en ;
rdfs:comment "A quality inhering in an allele that describes its genetic origin (how it came to be part of a cell's genome), i.e. whether it occurred de novo through some spontaneous mutation event, or was inherited from a parent." ;
rdfs:subClassOf obo:GENO_0000788 .
obo:OBI_0000023 a rdfs:Class ;
rdfs:label "classified data set"@en ;
rdfs:comment "A data set that is produced as the output of a class prediction data transformation and consists of a data set with assigned class labels."@en ;
rdfs:subClassOf obo:IAO_0000100 .
obo:GENO_0000892 a rdfs:Class ;
rdfs:label "heteroplasmic mitochondrial inheritance" ;
rdfs:comment "A mitochondrial inheritance pattern whereby manifestation of a trait is observed when some inherited mitochondria contian the causative allele and some do not." ;
rdfs:subClassOf obo:GENO_0000949 .
obo:NCBITaxon_8090 a rdfs:Class ;
rdfs:label "Oryzias latipes" ;
rdfs:subClassOf obo:OBI_0100026 .
obo:IAO_8000000 a rdfs:Class ;
rdfs:label "ontology module"@en ;
rdfs:subClassOf obo:IAO_0000102 .
obo:OBI_0000835 a rdfs:Class ;
rdfs:label "manufacturer" ;
rdfs:comment "A person or organization that has a manufacturer role" ;
rdfs:subClassOf obo:BFO_0000040 .
obo:GENO_0000891 a rdfs:Class ;
rdfs:label "obsolete contextual allele" ;
rdfs:comment "An informational artifact that describes a canonical allele by defining its sequence and position relative to a particular reference sequence." .
obo:GENO_0000113 a rdfs:Class ;
rdfs:label "taxonomic group" ;
rdfs:subClassOf obo:PCO_0000000 .
obo:IAO_8000018 a rdfs:Class ;
rdfs:label "obo basic subset ontology module"@en ;
rdfs:comment """A subset ontology that is designed for basic applications to continue to make certain simplifying assumptions; many of these simplifying assumptions were based on the initial version of the Gene Ontology, and have become enshrined in many popular and useful tools such as term enrichment tools.
Examples of such assumptions include: traversing the ontology graph ignoring relationship types using a naive algorithm will not lead to cycles (i.e. the ontology is a DAG); every referenced term is declared in the ontology (i.e. there are no dangling clauses).
An ontology is OBO Basic if and only if it has the following characteristics:
DAG
Unidirectional
No Dangling Clauses
Fully Asserted
Fully Labeled
No equivalence axioms
Singly labeled edges
No qualifier lists
No disjointness axioms
No owl-axioms header
No imports"""@en ;
rdfs:seeAlso ;
rdfs:subClassOf obo:IAO_8000017 .
obo:GENO_0000974 a rdfs:Class ;
rdfs:label "inherited allele origin"@en ;
rdfs:comment "Describes an allele that is inherited from a parent." ;
rdfs:subClassOf obo:GENO_0000877 .
obo:GENO_0000392 a rdfs:Class ;
rdfs:label "aneusomic zygosity" ;
rdfs:comment "A zygosity quality inhering in a 'single locus complement' in a genome with an abnormal ploidy at the location (i.e. an autosomal locus with one or three copies in a diploid genome)." ;
rdfs:subClassOf obo:GENO_0000133 .
obo:RO_0000052 a rdf:Property ;
rdfs:label "inheres_in" ;
rdfs:comment "a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence" ;
rdfs:range ;
rdfs:subPropertyOf obo:RO_0002314 .
obo:GENO_0000139 a rdfs:Class ;
rdfs:label "heritable" ;
rdfs:subClassOf obo:GENO_0000138 .
a rdfs:Class ;
rdfs:label "Stranded position"@en ;
rdfs:comment "Part of the coordinate system denoting on which strand the feature can be found. If you do not yet know which stand the feature is on, you should tag the position with just this class. If you know more you should use one of the subclasses. This means a region described with a '.' in GFF3. A GFF3 unstranded position does not have this type in FALDO -- those are just a 'position'." ;
rdfs:subClassOf .
obo:GENO_0000092 a rdfs:Class ;
rdfs:label "gene trap insertion" ;
rdfs:subClassOf obo:SO_0000667 .
obo:GENO_0000119 a rdfs:Class ;
rdfs:label "danio rerio strain" ;
rdfs:subClassOf obo:GENO_0000112 .
obo:IAO_8000010 a rdfs:Class ;
rdfs:label "exclusion subset ontology module"@en ;
rdfs:comment "A subset of an ontology that is intended to be excluded for some purpose. For example, a blacklist of classes."@en ;
rdfs:subClassOf obo:IAO_8000006 .
obo:GENO_0000944 a rdfs:Class ;
rdfs:label "complete Z-linked dominant inheritance"@en ;
rdfs:comment "A Z-linked dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." ;
rdfs:subClassOf obo:GENO_0000943 .
obo:GENO_0000647 a rdfs:Class ;
rdfs:label "female intrinsic genotype"@en ;
rdfs:comment "A genomic genotype here the genomic background specifies a female sex chromosome complement." ;
rdfs:subClassOf obo:GENO_0000645 .
obo:GENO_0000385 a rdf:Property ;
rdfs:label "has_reference_part" ;
rdfs:comment "A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is not variant." ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000654 .
obo:GENO_0000650 a rdf:Property ;
rdfs:label "has_sex_agnostic_part"@en ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000654 .
obo:ZP_0005692 a rdfs:Class ;
rdfs:label "abnormal(ly) absent adaxial cell" ;
rdfs:subClassOf obo:GENO_0000575 .
obo:SO_1000015 a rdfs:Class ;
rdfs:label "A_to_G_transition" ;
rdfs:comment "A transition of an adenine to a guanine." ;
rdfs:subClassOf obo:SO_1000014 .
obo:SO_0000830 a rdfs:Class ;
rdfs:label "chromosome part" ;
rdfs:comment "An extended region of sequence corresponding to a defined feature that is a proper part of a chromosome, e.g. a chromosomal 'arm', 'region', or 'band'." ;
rdfs:subClassOf obo:GENO_0000481 .
obo:GENO_0000248 a rdf:Property ;
rdfs:label "is_proper_part_of" ;
rdfs:comment "An asymmetric, irreflexive (normally transitive) relation between a part and its distinct whole." ;
rdfs:range ;
rdfs:subPropertyOf obo:BFO_0000050 .
obo:PATO_0000016 a rdfs:Class ;
rdfs:label "obsolete color brightness" .
obo:GENO_0000415 a rdfs:Class ;
rdfs:label "obsolete reagent sequence feature" ;
rdfs:comment "A sequence feature that references some biological macromolecule applied as a reagent in an experiment or technique (e.g. a morpholino expression plasmid, or oligonucleotide probe)" .
obo:NCBITaxon_33208 a rdfs:Class ;
rdfs:label "Metazoa" ;
rdfs:subClassOf obo:NCBITaxon_33154 .
obo:GENO_0000057 a rdfs:Class ;
rdfs:label "mus musculus gene" ;
rdfs:comment "A gene that originates from the genome of a mus musculus." ;
rdfs:subClassOf obo:SO_0000704 .
obo:GENO_0000169 a rdfs:Class ;
rdfs:label "obsolete random genetic insertion technique" .
obo:SO_1000009 a rdfs:Class ;
rdfs:label "transition" ;
rdfs:comment "Change of a pyrimidine nucleotide, C or T, into an other pyrimidine nucleotide, or change of a purine nucleotide, A or G, into an other purine nucleotide." ;
rdfs:subClassOf obo:SO_0001483 .
obo:OBI_0000684 a rdfs:Class ;
rdfs:label "specimen collection objective" ;
rdfs:comment "A objective specification to obtain a material entity for potential use as an input during an investigation." ;
rdfs:subClassOf obo:IAO_0000005 .
obo:OBI_0600036 a rdfs:Class ;
rdfs:label "establishing cell culture" ;
rdfs:comment "a process through which a new type of cell culture or cell line is created, either through the isolation and culture of one or more cells from a fresh source, or the deliberate experimental modification of an existing cell culture (e.g passaging a primary culture to become a secondary culture or line, or the immortalization or stable genetic modification of an existing culture or line)." ;
rdfs:subClassOf obo:OBI_0000094 .
obo:GENO_0000108 a rdfs:Class ;
rdfs:label "material genome" ;
rdfs:comment "A material entity that represents all genetic material in a cell or virion. The material genome is typically molecular aggregate of all the chromosomal DNA and epi-chromosomal DNA that represents all sequences that are heritable by progeny of a cell or virion." ;
rdfs:subClassOf obo:BFO_0000040 .
obo:GENO_0000644 a rdfs:Class ;
rdfs:label "karyotype"@en ;
rdfs:comment "A genotype that describes what is known about variation in a genome at a gross structural level, in terms of the number and appearance of chromosomes in the nucleus of a eukaryotic cell." ;
rdfs:subClassOf obo:GENO_0000899 .
obo:GENO_0000702 a rdfs:Class ;
rdfs:label "biological sequence"@en ;
rdfs:comment "A linear ordering of units representing monomers of a biological macromolecule (e.g. nucleotides in DNA and RNA, amino acids in polypeptides)." ;
rdfs:subClassOf obo:GENO_0000921 .
obo:GENO_0000251 a rdf:Property ;
rdfs:label "is_sequence_of" ;
rdfs:domain obo:GENO_0000702 ;
rdfs:range .
obo:GENO_0000896 a rdf:Property ;
rdfs:label "has_string" ;
rdfs:comment "Property linking a biological sequence to a string representing the ordered units that comprise the sequence (e.g. 'atgcagctagctaccgtcgatcg')." ;
rdfs:domain obo:GENO_0000702 ;
rdfs:range xsd:string .
obo:GENO_0000136 a rdfs:Class ;
rdfs:label "homozygous" ;
rdfs:comment "A zygosity quality inhering in a 'single locus complement' where all copies of the feature at this location have the same sequence (in a eukaryotic diploid genome, this means having identical alleles on each of the two homologous chromosomes, one inherited from each parent)." ;
rdfs:subClassOf obo:GENO_0000391 .
obo:ZP_0000755 a rdfs:Class ;
rdfs:label "abnormal(ly) disrupted diencephalon development"@en ;
rdfs:subClassOf obo:GENO_0000575 .
a rdfs:Class ;
rdfs:label "danio rerio cdkn1ca gene" ;
rdfs:subClassOf obo:GENO_0000047 .
obo:GENO_0000713 a rdfs:Class ;
rdfs:label "qualified sequence feature or collection"@en ;
rdfs:comment "A sequence feature (or collection of features) whose identity is dependent on the context or state of its material bearer (in addition to its sequence an position). This context/state describes factors external to its inherent sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:GENO_0000948 a rdfs:Class ;
rdfs:label "W-linked inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a W-chromosome." ;
rdfs:subClassOf obo:GENO_0000935 .
obo:GENO_0000175 a rdfs:Class ;
rdfs:label "obsolete random transgene insertion technique" .
obo:IAO_0000178 a rdfs:Class ;
rdfs:label "material information bearer"@en ;
rdfs:comment "A material entity in which a concretization of an information content entity inheres."@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:GENO_0000916 a rdfs:Class ;
rdfs:label "obsolete haplotype block" ;
rdfs:comment "A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequences it contain are typically co-inherited/transmitted across generations." .
obo:GENO_0000933 a rdfs:Class ;
rdfs:label "monogenic inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by alleles of a single causal gene, possibly together with environmental factors." ;
rdfs:subClassOf obo:GENO_0000141 .
a rdfs:Class .
obo:GENO_0000925 a rdfs:Class ;
rdfs:label "obsolete extrinsic sequence feature attribute" ;
rdfs:comment "A sequence feature attribute that reflects characteristics of the physical molecule in which the feature is concretized (e.g. its cellular context, source of origin, etc.)" .
obo:GENO_0000929 a rdfs:Class ;
rdfs:label "multifactorial inheritance"@en ;
rdfs:comment "An inheritance pattern that depends on a mixture of major and minor genetic determinants (i.e. alleles of more than one contributing genes), possibly together with environmental factors." ;
rdfs:subClassOf obo:GENO_0000141 .
obo:SO_1000027 a rdfs:Class ;
rdfs:label "G_to_T_transversion" ;
rdfs:comment "A transversion from guanine to thymine." ;
rdfs:subClassOf obo:SO_1000023 .
obo:UBERON_0001062 a rdfs:Class ;
rdfs:label "anatomical entity" ;
rdfs:comment "Biological entity that is either an individual member of a biological species or constitutes the structural organization of an individual member of a biological species." ;
rdfs:subClassOf obo:GENO_0000904 .
obo:GENO_0000637 a rdfs:Class ;
rdfs:label "regulatory transgene region"@en ;
rdfs:comment "A transgene part whose sequence regulates the synthesis of a functional product, but which is not itself transcribed." ;
rdfs:subClassOf obo:GENO_0000460 , obo:SO_0005836 .
obo:RO_0002524 a rdf:Property ;
rdfs:label "has subsequence" ;
rdfs:comment "x has subsequence y iff all of the sequence parts of x are sequence parts of y" ;
rdfs:domain obo:RO_0002532 ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000654 , obo:RO_0002522 , obo:RO_0002526 , obo:BFO_0000051 .
obo:RO_0002525 a rdf:Property ;
rdfs:label "is subsequence of" ;
rdfs:comment "inverse of has subsequence" ;
rdfs:domain obo:RO_0002532 ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000655 , obo:RO_0002523 , obo:RO_0002526 , obo:BFO_0000050 .
obo:RO_0002514 a rdf:Property ;
rdfs:label "sequentially related to" ;
rdfs:comment "A relation that holds between two entities that have the property of being sequences or having sequences. " ;
rdfs:domain obo:RO_0002532 ;
rdfs:range obo:RO_0002532 .
obo:PATO_0001241 a rdfs:Class ;
rdfs:label "physical object quality" ;
rdfs:comment "A quality which inheres in a continuant." ;
rdfs:subClassOf obo:BFO_0000019 .
obo:GENO_0000688 a rdfs:Class ;
rdfs:label "terminus"@en ;
rdfs:comment "A sequence feature representing the end of a sequence that is bounded only on one side (e.g. at the end of an chromosome or oligonucleotide)." ;
rdfs:subClassOf obo:SO_0000110 .
obo:GENO_0000660 a rdfs:Class ;
rdfs:label "genomic feature set"@en ;
rdfs:comment "A set of genomic features (i.e. sequence features that are of genomic origin)." ;
rdfs:subClassOf obo:GENO_0000659 , obo:GENO_0000897 .
obo:GENO_0000839 a rdfs:Class ;
rdfs:label "knockdown reagent targeted gene complement"@en ;
rdfs:subClassOf obo:GENO_0000527 .
obo:GENO_0000125 a rdfs:Class ;
rdfs:label "obsolete sequence feature collection attribute" ;
rdfs:comment "sequence attribute that can inhere only in a collection of more than one sequence features" .
obo:GENO_0000955 a rdfs:Class ;
rdfs:label "obsolete variant copy number complement" ;
rdfs:comment "A copy number complement' that has an abnormal number of members (e.g. more or less than two for an autosomal sequence in a diploid genome, as a result of deletion or duplication event(s)." .
obo:GENO_0000778 a rdfs:Class ;
rdfs:label "obsolete sequence information entity" ;
rdfs:comment "An information entity that is intented to represent some biological sequence, sequence feature, qualified sequence feature, or a collection of one or more of these entities." .
obo:IAO_0000308 a rdfs:Class ;
rdfs:label "figure"@en ;
rdfs:comment "An information content entity consisting of a two dimensional arrangement of information content entities such that the arrangement itself is about something."@en ;
rdfs:subClassOf obo:IAO_0000030 .
a rdfs:Class ;
rdfs:label "Position"@en ;
rdfs:comment "Superclass for the general concept of a position on a sequence. The sequence is designated with the reference predicate." ;
rdfs:subClassOf obo:GENO_0000902 .
obo:SO_0000804 a rdfs:Class ;
rdfs:label "engineered_region"@en ;
rdfs:subClassOf obo:SO_0000110 .
obo:IAO_8000007 a rdfs:Class ;
rdfs:label "curation subset ontology module"@en ;
rdfs:comment "A subset ontology that is intended as a whitelist for curators using the ontology. Such a subset will exclude classes that curators should not use for curation."@en ;
rdfs:subClassOf obo:IAO_8000006 .
obo:OBI_0002356 a rdfs:Class ;
rdfs:label "performance status value specification" ;
rdfs:comment "A categorical value specification that is an assessment of a participant's performance status (general well-being and activities of daily life)." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:BFO_0000040 a rdfs:Class ;
rdfs:label "material entity" ;
rdfs:comment "An independent continuant that is spatially extended whose identity is independent of that of other entities and can be maintained through time."@en ;
rdfs:subClassOf obo:BFO_0000004 .
obo:GENO_0000604 a rdfs:Class ;
rdfs:label "hemizygous X-linked"@en ;
rdfs:subClassOf obo:GENO_0000134 .
obo:GENO_0000721 a rdfs:Class ;
rdfs:label "RNA sequence"@en ;
rdfs:subClassOf obo:GENO_0000702 .
obo:GENO_0000783 a rdf:Property ;
rdfs:label "has_sequence_unit"@en ;
rdfs:comment "A relation between a nucleic acid or amino acid sequence or sequence feature, and one of its monomeric units (nucleotide or amino acid residues)" ;
rdfs:range obo:GENO_0000781 , obo:GENO_0000780 , obo:GENO_0000782 ;
rdfs:subPropertyOf obo:GENO_0000654 .
obo:GENO_0000164 a rdfs:Class ;
rdfs:label "obsolete genetic insertion technique" .
obo:SO_1000032 a rdfs:Class ;
rdfs:label "indel" ;
rdfs:comment "A sequence alteration which included an insertion and a deletion, affecting 2 or more bases." ;
rdfs:subClassOf obo:SO_0001059 .
obo:GENO_0000174 a rdfs:Class ;
rdfs:label "obsolete targeted knock-in technique" .
obo:NCBITaxon_2157 a rdfs:Class ;
rdfs:label "Archaea" ;
rdfs:subClassOf obo:OBI_0100026 .
obo:OBI_0200171 a rdfs:Class ;
rdfs:label "partitioning data transformation"@en ;
rdfs:comment "A partitioning data transformation is a data transformation that has objective partitioning."@en ;
rdfs:subClassOf obo:OBI_0200000 .
obo:OBI_0001905 a rdfs:Class ;
rdfs:label "secondary cultured cell population" ;
rdfs:comment "A cultured cell population that is derived through one or more passages in culture." ;
rdfs:subClassOf obo:OBI_0100060 .
obo:OBI_0000643 a rdf:Property ;
rdfs:label "has grain" ;
rdfs:comment "the relation of the cells in the finger of the skin to the finger, in which an indeterminate number of grains are parts of the whole by virtue of being grains in a collective that is part of the whole, and in which removing one granular part does not nec- essarily damage or diminish the whole. Ontological Whether there is a fixed, or nearly fixed number of parts - e.g. fingers of the hand, chambers of the heart, or wheels of a car - such that there can be a notion of a single one being missing, or whether, by contrast, the number of parts is indeterminate - e.g., cells in the skin of the hand, red cells in blood, or rubber molecules in the tread of the tire of the wheel of the car." ;
rdfs:range obo:OBI_0001866 , obo:CL_0000010 , obo:CLO_0000001 ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:OBI_0000450 a rdfs:Class ;
rdfs:label "regulatory agency"@en ;
rdfs:comment "A regulatory agency is a organization that has responsibility over or for the legislation (acts and regulations) for a given sector of the government."@en ;
rdfs:subClassOf obo:OBI_0000245 .
obo:GENO_0000920 a rdfs:Class ;
rdfs:label "qualified sequence feature set"@en ;
rdfs:comment "A set of qualified seqeunce features." ;
rdfs:subClassOf obo:GENO_0000713 .
obo:SO_1000021 a rdfs:Class ;
rdfs:label "T_to_A_transversion" ;
rdfs:comment "A transversion from T to A." ;
rdfs:subClassOf obo:SO_1000018 .
obo:SO_0001500 a rdfs:Class ;
rdfs:label "heritable_phenotypic_marker"@en ;
rdfs:comment "A biological_region characterized as a single heritable trait in a phenotype screen. The heritable phenotype may be mapped to a chromosome but generally has not been characterized to a specific gene locus." ;
rdfs:subClassOf obo:GENO_0000481 .
obo:CL_0000010 a rdfs:Class ;
rdfs:label "cultured cell" ;
rdfs:comment "A cell in vitro that is or has been maintained or propagated as part of a cell culture." ;
rdfs:subClassOf obo:CL_0000578 .
obo:SO_0001248 a rdfs:Class ;
rdfs:label "assembly" ;
rdfs:comment "A region of the genome of known length that is composed by ordering and aligning two or more different regions." ;
rdfs:subClassOf obo:SO_0001410 .
obo:GENO_0000897 a rdfs:Class ;
rdfs:label "genomic entity"@en ;
rdfs:comment "An generically dependent continuant that carries biological sequence that is part of or derived from a genome." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:SO_0000149 a rdfs:Class ;
rdfs:label "contig" ;
rdfs:comment "A contiguous sequence derived from sequence assembly. Has no gaps, but may contain N's from unavailable bases." ;
rdfs:subClassOf obo:SO_0000353 .
obo:NCBITaxon_10090 a rdfs:Class ;
rdfs:label "Mus musculus" ;
rdfs:subClassOf obo:NCBITaxon_39107 .
obo:PCO_0000020 a rdfs:Class ;
rdfs:label "family" ;
rdfs:comment "A domestic group, or a number of domestic groups linked through descent (demonstrated or stipulated) from a common ancestor, marriage, or adoption." ;
rdfs:subClassOf obo:PCO_0000000 .
obo:SO_0001742 a rdfs:Class ;
rdfs:label "copy_number_gain" ;
rdfs:comment "A sequence alteration whereby the copy number of a given regions is greater than the reference sequence." ;
rdfs:subClassOf obo:SO_0001019 .
obo:SO_0001026 a rdfs:Class ;
rdfs:label "genome" ;
rdfs:comment "A collection of sequence features (typically a collection of chromosomes) that covers the sum genetic material within a cell or virion (where 'genetic material' refers to any nucleic acid that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or can be replicated and inherited by its progeny)" ;
rdfs:subClassOf obo:GENO_0000660 .
obo:GENO_0000623 a rdfs:Class ;
rdfs:label "gpos75"@en ;
rdfs:subClassOf obo:GENO_0000619 .
obo:SO_1000020 a rdfs:Class ;
rdfs:label "C_to_G_transversion" ;
rdfs:subClassOf obo:SO_1000018 .
obo:GENO_0000009 a rdfs:Class ;
rdfs:label "genomic variation complement" ;
rdfs:comment "A genomic feature set representing all 'variant single locus complements' in a single genome, which together constitute the 'variant' component of a genomic genotype." ;
rdfs:subClassOf obo:GENO_0000660 .
obo:SO_0000337 a rdfs:Class ;
rdfs:label "RNAi_reagent"@en ;
rdfs:subClassOf obo:GENO_0000533 .
obo:GENO_0000886 a rdfs:Class ;
rdfs:label "allelic phase" ;
rdfs:comment "A quality inhering in a collection of discontinuous sequence features in a single genome in virtue of their relative position on the same or separate chromosomes." ;
rdfs:subClassOf obo:GENO_0000788 .
obo:GENO_0000511 a rdfs:Class ;
rdfs:label "wild-type"@en ;
rdfs:comment "An allele attribute describing a highly common variant (typically >99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are compared." ;
rdfs:subClassOf obo:GENO_0000773 .
obo:IAO_0000309 a rdfs:Class ;
rdfs:label "diagram"@en ;
rdfs:comment "A figure that expresses one or more propositions"@en ;
rdfs:subClassOf obo:IAO_0000308 .
obo:GENO_0000033 a rdfs:Class ;
rdfs:label "variant genome" ;
rdfs:comment "A genome that varies at one or more loci from the sequence of some reference genome." ;
rdfs:subClassOf obo:SO_0001026 .
obo:IAO_0000100 a rdfs:Class ;
rdfs:label "data set"@en ;
rdfs:comment "A data item that is an aggregate of other data items of the same type that have something in common. Averages and distributions can be determined for data sets."@en ;
rdfs:subClassOf obo:IAO_0000027 .
obo:IAO_8000017 a rdfs:Class ;
rdfs:label "ontology module subsetted by expressivity"@en ;
rdfs:subClassOf obo:IAO_8000006 .
obo:GENO_0000912 a rdfs:Class ;
rdfs:label "selectable marker region"@en ;
rdfs:subClassOf obo:GENO_0000638 .
obo:MP_0000001 a rdfs:Class ;
rdfs:label "mammalian phenotype" ;
rdfs:comment "where to place this depends on if we take the organismal view or the quality centric view." ;
rdfs:subClassOf obo:UPHENO_0001001 .
obo:GENO_0000924 a rdfs:Class ;
rdfs:label "obsolete intrinsic sequence feature attribute" ;
rdfs:comment "A sequence feature attribute that reflects feature-level characteristics that depend only on the sequence, location, or genomic context of a feature or collection, but are independent of how it may be concretized in physical form." .
obo:GENO_0000137 a rdfs:Class ;
rdfs:label "unspecified zygosity" ;
rdfs:subClassOf obo:GENO_0000133 .
obo:GENO_0000150 a rdfs:Class ;
rdfs:label "obsolete autosomal recessive inheritance" .
obo:GENO_0000014 a rdfs:Class ;
rdfs:label "gene allele" ;
rdfs:comment "A genomic feature that represents one of a set of versions of a gene (i.e. a haplotype whose extent is that of a gene)" ;
rdfs:subClassOf obo:GENO_0000512 .
obo:OBI_0100010 a rdfs:Class ;
rdfs:label "Epstein Barr virus transformed B cell"@en ;
rdfs:comment "A material entity which results from viral transformation process using EBV as transformation agent when applied to B-cell entity"@en ;
rdfs:subClassOf obo:OBI_0000047 .
obo:SO_1000017 a rdfs:Class ;
rdfs:label "transversion" ;
rdfs:comment "Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G, or vice versa." ;
rdfs:subClassOf obo:SO_0001483 .
a rdfs:Class ;
rdfs:label "Region"@en ;
rdfs:comment "A region describes a length of sequence with a start position and end position that represents a feature on a sequence, e.g. a gene." ;
rdfs:subClassOf obo:SO_0000110 .
a rdf:Property ;
rdfs:label "begin"@en ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000708 .
a rdf:Property ;
rdfs:label "end"@en ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000708 .
obo:GENO_0000972 a rdfs:Class ;
rdfs:label "chromosomal rearrangement inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by inheritance of translocation or inversion of sections of one or more chromosomes, possibly together with environmental factors." ;
rdfs:subClassOf obo:GENO_0000969 .
obo:CL_0000000 a rdfs:Class ;
rdfs:label "cell" ;
rdfs:comment "A material entity of anatomical origin (part of or deriving from an organism) that has as its parts a maximally connected cell compartment surrounded by a plasma membrane." ;
rdfs:subClassOf obo:UBERON_0000061 .
obo:IAO_8000002 a rdfs:Class ;
rdfs:label "editors ontology module"@en ;
rdfs:comment "An ontology module that is intended to be directly edited, typically managed in source control, and typically not intended for direct consumption by end-users."@en ;
rdfs:subClassOf obo:IAO_8000000 .
obo:GENO_0000112 a rdfs:Class ;
rdfs:label "strain or breed" ;
rdfs:comment "A maximal collection of organisms of a single species that have been bred or experimentally manipulated with the goal of being genetically identical." ;
rdfs:subClassOf obo:GENO_0000113 .
obo:OBI_0001879 a rdfs:Class ;
rdfs:label "reagent"@en ;
rdfs:comment "A biological or chemical entity that bears a reagent role in virtue of it being intended for application in a scientific technique to participate in (or have molecular parts that participate in) a chemical reaction that facilitates the generation of data about some distinct entity, or the generation of some distinct material specified output." ;
rdfs:subClassOf obo:BFO_0000040 , obo:OBI_0000047 .
obo:BFO_0000023 a rdfs:Class ;
rdfs:label "role" ;
rdfs:comment "A realizable entity the manifestation of which brings about some result or end that is not essential to a continuant in virtue of the kind of thing that it is but that can be served or participated in by that kind of continuant in some kinds of natural, social or institutional contexts."@en ;
rdfs:subClassOf obo:BFO_0000017 .
obo:GENO_0000527 a rdfs:Class ;
rdfs:label "reagent-targeted gene complement"@en ;
rdfs:comment "A set comprised of *all* reagent-targeted genes in a single genome in the context of a given experiment (e.g. the zebrafish shha and shhb genes in a zebrafish exposed to morpholinos targeting both of these genes)." ;
rdfs:subClassOf obo:GENO_0000715 .
obo:UBERON_0000105 a rdfs:Class ;
rdfs:label "life cycle stage" ;
rdfs:comment "A spatiotemporal region encompassing some part of the life cycle of an organism." ;
rdfs:subClassOf obo:GENO_0000351 , obo:GO_0008150 .
obo:RO_0002295 a rdf:Property ;
rdfs:label "results in developmental progression of"@en ;
rdfs:comment "p results in the developmental progression of s iff p is a developmental process and s is an anatomical entity and p causes s to undergo a change in state at some point along its natural developmental cycle (this cycle starts with its formation, through the mature structure, and ends with its loss)." ;
rdfs:domain obo:GO_0008150 ;
rdfs:range obo:UBERON_0001062 ;
rdfs:subPropertyOf obo:RO_0002324 .
obo:GENO_0000036 a rdfs:Class ;
rdfs:label "reference allele" ;
rdfs:comment "An allele whose sequence matches what is consdiered to be the reference sequence at that location in the genome." ;
rdfs:subClassOf obo:GENO_0000512 .
obo:GENO_0000610 a rdf:Property ;
rdfs:label "is_reference_allele_of"@en ;
rdfs:comment "A relationship between a reference locus/allele and the gene class it is an allele of." ;
rdfs:domain obo:GENO_0000036 ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000408 .
obo:GENO_0000968 a rdf:Property ;
rdfs:label "sequence role" ;
rdfs:comment "A role assigned to a sequence feature, collection, or genotype, e.g. serving as a 'reference' against with other sequences are compared." ;
rdfs:range obo:BFO_0000020 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:GO_0003674 a rdfs:Class ;
rdfs:label "molecular_function" ;
rdfs:comment "A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs." ;
rdfs:subClassOf obo:BFO_0000015 .
obo:SO_0000771 a rdfs:Class ;
rdfs:label "QTL" ;
rdfs:comment "A quantitative trait locus (QTL) is a polymorphic locus which contains alleles that differentially affect the expression of a continuously distributed phenotypic trait. Usually it is a marker described by statistical association to quantitative variation in the particular phenotypic trait that is thought to be controlled by the cumulative action of alleles at multiple loci." ;
rdfs:subClassOf obo:GENO_0000481 .
obo:OBI_0600014 a rdfs:Class ;
rdfs:label "material component separation"@en ;
rdfs:comment "a material processing in which components of an input material become segregated in space"@en ;
rdfs:subClassOf obo:OBI_0000094 .
obo:GENO_0000000 a rdfs:Class ;
rdfs:label "genomic genotype (sex-agnostic)" ;
rdfs:comment "A genomic genotype that does not specify the sex determining chromosomal features of its bearer (i.e. does not indicate the background sex chromosome complement)" ;
rdfs:subClassOf obo:GENO_0000899 .
obo:GENO_0000871 a rdfs:Class ;
rdfs:label "haplotype"@en ;
rdfs:comment "A set of discrete, genetically-linked sequence alterations that reside on the same chromosomal strand and are typically co-inherited within a haplotype block." ;
rdfs:subClassOf obo:GENO_0000660 .
obo:IAO_8000013 a rdfs:Class ;
rdfs:label "reasoned ontology module"@en ;
rdfs:comment "An ontology module that contains axioms generated by a reasoner. The generated axioms are typically direct SubClassOf axioms, but other possibilities are available."@en ;
rdfs:seeAlso ;
rdfs:subClassOf obo:IAO_8000000 .
obo:GENO_0000393 a rdfs:Class ;
rdfs:label "trisomic homozygous" ;
rdfs:subClassOf obo:GENO_0000392 .
obo:GENO_0000344 a rdfs:Class ;
rdfs:label "gained aneusomic chromosomal segment" ;
rdfs:comment "A part of some non-homologous chromosome that has been gained as the result of an unbalanced translocation event." ;
rdfs:subClassOf obo:GENO_0000343 .
obo:BFO_0000016 a rdfs:Class ;
rdfs:label "disposition" ;
rdfs:subClassOf obo:BFO_0000017 .
obo:OBI_0000704 a rdfs:Class ;
rdfs:label "decision tree induction objective" ;
rdfs:comment "A decision tree induction objective is a data transformation objective in which a tree-like graph of edges and nodes is created and from which the selection of each branch requires that some type of logical decision is made." ;
rdfs:subClassOf obo:OBI_0200166 .
obo:GENO_0000140 a rdfs:Class ;
rdfs:label "non-heritable" ;
rdfs:subClassOf obo:GENO_0000138 .
obo:GO_0008150 a rdfs:Class ;
rdfs:label "biological_process" ;
rdfs:comment "A biological process represents a specific objective that the organism is genetically programmed to achieve. Biological processes are often described by their outcome or ending state, e.g., the biological process of cell division results in the creation of two daughter cells (a divided cell) from a single parent cell. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence." ;
rdfs:subClassOf obo:BFO_0000015 .
obo:GENO_0000901 a rdfs:Class ;
rdfs:label "obsolete allele cellular context" ;
rdfs:comment "A quality inhering in a particular allele in virtue of its presence only in a particular type of cell in an organism (e.g. somatic vs germ cells)" .
obo:OBI_0000838 a rdfs:Class ;
rdfs:label "material maintenance" ;
rdfs:comment "a process with that achieves the objective to maintain some or all of the characteristics of an input material over time" ;
rdfs:subClassOf obo:OBI_0000011 .
obo:GENO_0000890 a rdfs:Class ;
rdfs:label "obsolete canonical allele" ;
rdfs:comment "One of a set of sequence features or haplotypes that exist at a particular genetic locus. " .
obo:GENO_0000524 a rdfs:Class ;
rdfs:label "extrinsic genotype"@en ;
rdfs:comment "A specification of the known state of gene expression across a genome, and how it varies from some baseline/reference state." ;
rdfs:subClassOf obo:GENO_0000536 .
obo:GENO_0000666 a rdfs:Class ;
rdfs:label "gene part" ;
rdfs:comment "A genomic feature that is part of a gene, and delineated by some functional or structural function or role it serves (e.g.a promoter element, coding region, etc)." ;
rdfs:subClassOf obo:GENO_0000481 , obo:RO_0002532 .
obo:GENO_0000500 a rdfs:Class ;
rdfs:label "ancestral polymorphic allele" ;
rdfs:comment "A polymorphic allele that is determined from the sequence of a recent ancestor in a phylogentic tree." ;
rdfs:subClassOf obo:GENO_0000497 .
obo:GENO_0000652 a rdf:Property ;
rdfs:label "is_polymorphic_allele_of"@en ;
rdfs:comment "A relationship between a polymorphic allele and the gene class it is an allele of." ;
rdfs:domain obo:GENO_0000497 ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000641 .
obo:IAO_0000180 a rdfs:Class ;
rdfs:label "heatmap"@en ;
rdfs:comment """A heatmap is a report graph which is a graphical representation of data
where the values taken by a variable(s) are shown as colors in a
two-dimensional map."""@en ;
rdfs:subClassOf obo:IAO_0000038 .
obo:IAO_0000030 a rdfs:Class ;
rdfs:label "information content entity" ;
rdfs:comment "an information content entity is an entity that is generically dependent on some artifact and stands in relation of aboutness to some entity"@en ;
rdfs:subClassOf obo:BFO_0000031 .
obo:SO_0000699 a rdfs:Class ;
rdfs:label "junction"@en ;
rdfs:comment "A junction is a boundary between regions. A boundary has an extent of zero." ;
rdfs:subClassOf obo:SO_0000110 .
obo:GENO_0000022 a rdfs:Class ;
rdfs:label "obsolete genomic feature collection" ;
rdfs:comment "A sequence feature collection comprised of discontiguous sequences from a single genome" .
obo:GENO_0000945 a rdfs:Class ;
rdfs:label "incomplete Z-linked dominant inheritance"@en ;
rdfs:comment "A Z-linked dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." ;
rdfs:subClassOf obo:GENO_0000943 .
obo:GENO_0000499 a rdfs:Class ;
rdfs:label "minor polymorphic allele" ;
rdfs:comment "A polymorphic allele that is not present at the highest frequency among all fixed variants at the locus (i.e. not the major polymorphic allele at a given location)." ;
rdfs:subClassOf obo:GENO_0000497 .
obo:PATO_0001995 a rdfs:Class ;
rdfs:label "organismal quality" ;
rdfs:comment "A quality that inheres in an entire organism or part of an organism." ;
rdfs:subClassOf obo:PATO_0001241 .
obo:OBI_0001912 a rdfs:Class ;
rdfs:label "cell freezing medium"@en ;
rdfs:comment "A processed material that serves as a liquid vehicle for freezing cells for long term quiescent stroage, which contains chemicls needed to sustain cell viability across freeze-thaw cycles. " ;
rdfs:subClassOf obo:OBI_0000047 .
obo:SO_1000013 a rdfs:Class ;
rdfs:label "T_to_C_transition" ;
rdfs:subClassOf obo:SO_1000010 .
obo:NCBITaxon_7742 a rdfs:Class ;
rdfs:label "Vertebrata " ;
rdfs:subClassOf obo:NCBITaxon_33213 .
obo:GENO_0000685 a rdfs:Class ;
rdfs:label "novel"@en ;
rdfs:comment "An attribute of a genomic feature that represents a feature not previously found in a given genome, e.g. an extrachromosomal replicon or aneusomic third copy of a chromosome." ;
rdfs:subClassOf obo:GENO_0000773 .
obo:IAO_8000006 a rdfs:Class ;
rdfs:label "subset ontology module"@en ;
rdfs:comment "An ontology module that is extracted from a main ontology module and includes only a subset of entities or axioms."@en ;
rdfs:seeAlso , ;
rdfs:subClassOf obo:IAO_8000000 .
obo:ZP_0000386 a rdfs:Class ;
rdfs:label "abnormal(ly) absent dorso-rostral cluster"@en ;
rdfs:subClassOf obo:GENO_0000575 .
obo:OBI_0000458 a rdfs:Class ;
rdfs:label "manufacturing objective"@en ;
rdfs:comment "is the objective to manufacture a material of a certain function (device)"@en ;
rdfs:subClassOf obo:OBI_0000456 .
obo:GENO_0000881 a rdfs:Class ;
rdfs:label "unknown allele origin"@en ;
rdfs:comment "Describes an allele whose origin is not known." ;
rdfs:subClassOf obo:GENO_0000877 .
obo:SO_0000289 a rdfs:Class ;
rdfs:label "microsatellite" ;
rdfs:comment "A repeat_region containing repeat_units of 2 to 10 bp repeated in tandem." ;
rdfs:subClassOf obo:GENO_0000481 .
obo:GENO_0000148 a rdfs:Class ;
rdfs:label "autosomal recessive inheritance" ;
rdfs:comment "An inheritance pattern wherein a trait caused by alleles of an autosomal gene manifests in homozygous but not heterozygote individuals." ;
rdfs:subClassOf obo:GENO_0000934 .
obo:GENO_0000934 a rdfs:Class ;
rdfs:label "autosomal inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a non-sex chromosome." ;
rdfs:subClassOf obo:GENO_0000933 .
obo:OBI_0000017 a rdfs:Class ;
rdfs:label "regulatory role"@en ;
rdfs:comment "a role which inheres in material entities and is realized in the processes of making, enforcing or being defined by legislation or orders issued by a governmental body."@en ;
rdfs:subClassOf obo:BFO_0000023 .
obo:NCBITaxon_9606 a rdfs:Class ;
rdfs:label "Homo sapiens" ;
rdfs:subClassOf obo:NCBITaxon_314146 .
obo:GENO_0000605 a rdfs:Class ;
rdfs:label "hemizygous Y-linked"@en ;
rdfs:subClassOf obo:GENO_0000134 .
obo:GENO_0000720 a rdfs:Class ;
rdfs:label "DNA sequence"@en ;
rdfs:subClassOf obo:GENO_0000702 .
obo:IAO_0000184 a rdfs:Class ;
rdfs:label "scatter plot"@en ;
rdfs:comment "A scatterplot is a graph which uses Cartesian coordinates to display values for two variables for a set of data. The data is displayed as a collection of points, each having the value of one variable determining the position on the horizontal axis and the value of the other variable determining the position on the vertical axis."@en ;
rdfs:subClassOf obo:IAO_0000038 .
obo:SO_0000199 a rdfs:Class ;
rdfs:label "translocation" ;
rdfs:comment "A region of nucleotide sequence that has translocated to a new position." ;
rdfs:subClassOf obo:SO_0001059 .
obo:GENO_0000638 a rdfs:Class ;
rdfs:label "expressed transgene region"@en ;
rdfs:comment "A transgene part whose sequence is expressed in a gene product through transcription and/or translation." ;
rdfs:subClassOf obo:GENO_0000460 .
obo:GENO_0000494 a rdfs:Class ;
rdfs:label "extrachromosomal replicon"@en ;
rdfs:comment "A genetic feature that is not part of the chromosomal genome of a cell or virion, but rather a stable and heritable element that is replilcated and passed on to progeny (e.g. a replicative plasmid or transposon)" ;
rdfs:subClassOf obo:GENO_0000481 .
obo:GENO_0000876 a rdfs:Class ;
rdfs:label "obsolete genetic dosage" ;
rdfs:comment """Genetic dosage reflects how many 'functional' copies of a sequence are present in a genome. In diploid organisms, the normal dosage is 2 for autosomal genes/regions. Dosage increases if there is a duplication of the gene/region. Dosage decreases if there is either a deletion of a gene/region, or an inactivating mutation that eliminates gene function. This sets it apart from the notion of 'copy number', which reflects how many actual copies of a sequence exist in a genome. Addition of a non-functional allele of a gene will increase its copy number, but not increase its dosage.
Duplications of a sequence can occur at new locations in the genome, such that the resulting sequence represents a distinct sequence feature from the copy at its native locus. For example, duplication of a region containing the human APOE gene on a different chromosome creates a sequence feature that shares sequence from the original gene, but not location, and therefore represents a different sequence feature. The notions of dosage and copy number are therefore concerned with sequence-level entities (how many copies of a 'sequence' exist), as opposed to sequence feature-level entities. The notion of a single-locus complement would be used to describe how many of a particular features are present in a genome - and describe which alleles of this feature are found.""" .
obo:SO_1000039 a rdfs:Class ;
rdfs:label "direct_tandem_duplication" ;
rdfs:comment "A tandem duplication where the individual regions are in the same orientation." ;
rdfs:subClassOf obo:SO_1000173 .
obo:BFO_0000001 a rdfs:Class ;
rdfs:label "entity"@en .
obo:GENO_0000921 a rdfs:Class ;
rdfs:label "biological sequence or set"@en ;
rdfs:comment "A biolocical sequence, or set of such sequences." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:IAO_8000011 a rdfs:Class ;
rdfs:label "external import ontology module"@en ;
rdfs:comment "An imported ontology module that is derived from an external ontology. Derivation methods include the OWLAPI SLME approach."@en ;
rdfs:subClassOf obo:IAO_8000005 .
obo:GENO_0000616 a rdfs:Class ;
rdfs:label "chromosome sub-band"@en ;
rdfs:subClassOf obo:SO_0000830 .
obo:IAO_0000007 a rdfs:Class ;
rdfs:label "action specification"@en ;
rdfs:comment "A directive information entity that describes an action the bearer will take."@en ;
rdfs:subClassOf obo:IAO_0000033 .
obo:GENO_0000093 a rdfs:Class ;
rdfs:label "integrated transgene" ;
rdfs:comment "A transgene that has been integrated into a chrromosome in the host genome." ;
rdfs:subClassOf obo:SO_0000902 .
obo:OBI_0200188 a rdfs:Class ;
rdfs:label "cross validation objective"@en ;
rdfs:comment "A cross validation objective is a data transformation objective in which the aim is to partition a sample of data into subsets such that the analysis is initially performed on a single subset, while the other subset(s) are retained for subsequent use in confirming and validating the initial analysis."@en ;
rdfs:subClassOf obo:OBI_0200172 .
obo:GENO_0000893 a rdfs:Class ;
rdfs:label "homoplasmic mitochondrial inheritance" ;
rdfs:comment "A mitochondrial inheritance pattern whereby manifestation of a trait occurs when only mitochondria containing the causative allele are inherited." ;
rdfs:subClassOf obo:GENO_0000949 .
obo:NCBITaxon_39107 a rdfs:Class ;
rdfs:label "Murinae" ;
rdfs:subClassOf obo:NCBITaxon_9989 .
obo:OBI_0002989 a rdfs:Class ;
rdfs:label "material supplier" ;
rdfs:comment "A person or organization that provides material supplies to other people or organizations." ;
rdfs:subClassOf obo:BFO_0000040 .
obo:SO_0000902 a rdfs:Class ;
rdfs:label "transgene"@en ;
rdfs:comment "A gene that has been transferred naturally or by any of a number of genetic engineering techniques into a cell or organism where it is foreign (i.e. does not belong to the host genome)." ;
rdfs:subClassOf obo:SO_0000704 .
obo:GENO_0000880 a rdfs:Class ;
rdfs:label "de novo allele origin"@en ;
rdfs:comment "Describes an allele that originated through a mutation event in a germ cell of one of the parents, or in the fertilized egg itself during early embryogenesis. De novo alleles are* heritable* but *not inherited*." ;
rdfs:subClassOf obo:GENO_0000877 .
obo:BFO_0000004 a rdfs:Class ;
rdfs:label "independent continuant" ;
rdfs:comment "b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002])"@en ;
rdfs:subClassOf obo:BFO_0000002 .
obo:GENO_0000017 a rdfs:Class ;
rdfs:label "reference sequence" ;
rdfs:comment "A sequence that serves as a standard against which other sequences at the same location are compared." ;
rdfs:subClassOf obo:GENO_0000702 .
obo:BFO_0000015 a rdfs:Class ;
rdfs:label "process" ;
rdfs:comment "p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003])"@en ;
rdfs:subClassOf obo:BFO_0000003 .
obo:NCBITaxon_33154 a rdfs:Class ;
rdfs:label "Opisthokonta" ;
rdfs:subClassOf obo:NCBITaxon_2759 .
obo:GENO_0000961 a rdfs:Class ;
rdfs:label "copy number complement"@en ;
rdfs:comment "A set representing the complement of all copies of a particular biological sequence (typically at the scale of complete genes or larger) present in a particular genome." ;
rdfs:subClassOf obo:GENO_0000872 .
obo:GENO_0000144 a rdfs:Class ;
rdfs:label "complete autosomal dominant inheritance" ;
rdfs:comment "An autosomal dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." ;
rdfs:subClassOf obo:GENO_0000147 .
obo:GENO_0000919 a rdfs:Class ;
rdfs:label "qualified sequence feature"@en ;
rdfs:comment "A sequence feature whose identity is additionally dependent on the context or state of the material sequence molecule in which the feature is concretized. This context/state describes factors external to the feature's intrinsic sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification." ;
rdfs:subClassOf obo:GENO_0000713 .
obo:OBI_0200166 a rdfs:Class ;
rdfs:label "data transformation objective"@en ;
rdfs:comment "An objective specification to transformation input data into output data"@en ;
rdfs:subClassOf obo:IAO_0000005 .
obo:GENO_0000818 a rdfs:Class ;
rdfs:label "modification-qualified sequence feature"@en ;
rdfs:comment "A sequence feature whose identity is additionally dependent on a chemical modification made to the genetic material bearing the feature (e.g. binding of transcriptional regulators, or epigenetic modifications including direct DNA methylation, or modification of histones associated with a feature)" ;
rdfs:subClassOf obo:GENO_0000714 .
obo:GENO_0000681 a rdfs:Class ;
rdfs:label "novel extrachromosomal replicon" ;
rdfs:comment "An extrachromosomal replicon that is variant in a genome in virtue of its being a novel addition to the genome - i.e. it is not present in the reference for the genome in which it is found." ;
rdfs:subClassOf obo:GENO_0000494 , obo:GENO_0000684 .
obo:OBI_0000079 a rdfs:Class ;
rdfs:label "culture medium"@en ;
rdfs:comment "a processed material that provides the needed nourishment for microorganisms or cells grown in vitro." ;
rdfs:subClassOf obo:OBI_0000047 .
obo:GENO_0000515 a rdfs:Class ;
rdfs:label "variant gene allele" ;
rdfs:comment "An allele of a gene that contains some sequence alteration." ;
rdfs:subClassOf obo:GENO_0000002 , obo:GENO_0000014 .
obo:GENO_0000173 a rdfs:Class ;
rdfs:label "obsolete promoter trapping technique" .
obo:CLO_0000001 a rdfs:Class ;
rdfs:label "cell line cell" ;
rdfs:comment """A cultured cell that is part of a cell line - a stable and homogeneous population of cells with a common biological origin and propagation history in culture
""" ;
rdfs:subClassOf obo:OBI_0001866 .
obo:GENO_0000898 a rdfs:Class ;
rdfs:label "haplotype block"@en ;
rdfs:comment "A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequence alterations it contains are typically co-inherited across generations." ;
rdfs:subClassOf obo:GENO_0000481 .
obo:SO_1000016 a rdfs:Class ;
rdfs:label "G_to_A_transition" ;
rdfs:comment "A transition of a guanine to an adenine." ;
rdfs:subClassOf obo:SO_1000014 .
obo:GENO_0000978 a rdfs:Class ;
rdfs:label "nullizygous"@en ;
rdfs:comment "A disomic zygosity quality inhering in a 'single locus complement' that is comprised of two non-functional copies of a gene. Loss of function may result from the gene being entirely missing via a deletion, or mutated in a way that eliminates its function." ;
rdfs:subClassOf obo:GENO_0000391 .
obo:OBI_0001930 a rdfs:Class ;
rdfs:label "categorical value specification" ;
rdfs:comment "A value specification that is specifies one category out of a fixed number of nominal categories" ;
rdfs:subClassOf obo:OBI_0001933 .
obo:CHEBI_23367 a rdfs:Class ;
rdfs:label "molecular entity" ;
rdfs:comment "Any constitutionally or isotopically distinct atom, molecule, ion, ion pair, radical, radical ion, complex, conformer etc., identifiable as a separately distinguishable entity." ;
rdfs:subClassOf obo:BFO_0000040 .
obo:IAO_0000104 a rdfs:Class ;
rdfs:label "plan specification"@en ;
rdfs:comment "A directive information entity with action specifications and objective specifications as parts that, when concretized, is realized in a process in which the bearer tries to achieve the objectives by taking the actions specified."@en ;
rdfs:subClassOf obo:IAO_0000033 .
obo:GENO_0000640 a rdfs:Class ;
rdfs:label "reporter region"@en ;
rdfs:subClassOf obo:GENO_0000638 .
obo:OBI_0600024 a rdfs:Class ;
rdfs:label "maintaining cell culture"@en ;
rdfs:comment "a protocol application in which cells are kept alive in a defined environment outside of an organism. part of cell_culturing"@en ;
rdfs:subClassOf obo:OBI_0000838 .
obo:GENO_0000047 a rdfs:Class ;
rdfs:label "danio rerio gene" ;
rdfs:comment "A gene that originates from the genome of a danio rerio." ;
rdfs:subClassOf obo:SO_0000704 .
obo:SO_1000005 a rdfs:Class ;
rdfs:label "complex_substitution" ;
rdfs:comment "When no simple or well defined DNA mutation event describes the observed DNA change, the keyword \\\"complex\\\" should be used. Usually there are multiple equally plausible explanations for the change." ;
rdfs:subClassOf obo:SO_1000002 .
obo:GENO_0000133 a rdfs:Class ;
rdfs:label "zygosity" ;
rdfs:comment "An allelic state that describes the degree of similarity between features in a 'single locus complement', within the genome of a cell or organism (i.e., whether the alleles or haplotypes that reside at the same location on paired chromosomes are the same or different)." ;
rdfs:subClassOf obo:GENO_0000875 .
obo:GENO_0000956 a rdfs:Class ;
rdfs:label "obsolete copy number complement" ;
rdfs:comment "A set of all features in a particular genome whose sequence aligns with a particular location on a reference genome. Such features are typically on the scale of complete genes or larger." .
obo:SO_0000281 a rdfs:Class ;
rdfs:label "engineered_foreign_gene" ;
rdfs:subClassOf obo:SO_0000704 , obo:SO_0000804 .
obo:GENO_0000619 a rdfs:Class ;
rdfs:label "gpos"@en ;
rdfs:subClassOf obo:GENO_0000618 .
obo:GENO_0000166 a rdfs:Class ;
rdfs:label "obsolete targeted gene mutation technique" .
obo:GENO_0000504 a rdfs:Class ;
rdfs:label "reagent targeted gene"@en ;
rdfs:comment "A gene altered in its expression level in the context of some experiment as a result of being targeted by gene-knockdown reagent(s) such as a morpholino or RNAi." ;
rdfs:subClassOf obo:GENO_0000529 .
obo:GENO_0000231 a rdf:Property ;
rdfs:label "has_proper_part" ;
rdfs:comment "An antisymmetric, irreflexive (normally transitive) relation between a whole and a distinct part (source: SIO)" ;
rdfs:range ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:GENO_0000447 a rdf:Property ;
rdfs:label "is_gene_target_of" ;
rdfs:comment "A relation between a gene class and a gene targeting reagent that targets it." ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000445 .
obo:GENO_0000443 a rdf:Property ;
rdfs:label "is_expression_variant_of" ;
rdfs:comment "A relation between an expression-variant gene (ie integrated transgenes or knockdown reagent targeted genes), and the class of gene it represents." ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000418 .
obo:ZP_0005531 a rdfs:Class ;
rdfs:label "abnormal(ly) disrupted neutrophil aggregation"@en ;
rdfs:subClassOf obo:GENO_0000575 .
obo:OBI_0000011 a rdfs:Class ;
rdfs:label "planned process" ;
rdfs:comment "A processual entity that realizes a plan which is the concretization of a plan specification." ;
rdfs:subClassOf obo:BFO_0000015 .
obo:SO_0000341 a rdfs:Class ;
rdfs:label "chromosome band"@en ;
rdfs:comment "A cytologically distinguishable feature of a chromosome, often made visible by staining, and usually alternating light and dark." ;
rdfs:subClassOf obo:SO_0000830 .
obo:GENO_0000172 a rdfs:Class ;
rdfs:label "obsolete gene trapping technique" .
obo:BFO_0000002 a rdfs:Class ;
rdfs:label "continuant" ;
rdfs:comment "An entity that exists in full at any time in which it exists at all, persists through time while maintaining its identity and has no temporal parts."@en ;
rdfs:subClassOf obo:BFO_0000001 .
obo:GENO_0000875 a rdfs:Class ;
rdfs:label "allelic state"@en ;
rdfs:comment "A quality inhering in an 'allelic complement' (aka a 'single locus complement') that describes the allelic variability found at a particular locus in the genome of a single cell/organism" ;
rdfs:subClassOf obo:GENO_0000788 .
obo:OBI_0000181 a rdfs:Class ;
rdfs:label "population"@en ;
rdfs:comment "a population is a collection of individuals from the same taxonomic class living, counted or sampled at a particular site or in a particular area" ;
rdfs:subClassOf obo:GENO_0000113 .
obo:OBI_0000953 a rdfs:Class ;
rdfs:label "processed specimen" ;
rdfs:comment "A specimen that has been intentionally physically modified." ;
rdfs:subClassOf obo:OBI_0000047 , obo:OBI_0100051 .
obo:ZP_0000199 a rdfs:Class ;
rdfs:label "abnormal(ly) malformed endocardium cell"@en ;
rdfs:subClassOf obo:GENO_0000575 .
obo:GENO_0000111 a rdfs:Class ;
rdfs:label "human population" ;
rdfs:comment "a population of homo sapiens grouped together in virtue of their sharing some commonality (either an inherent attribute or an externally assigned role)" ;
rdfs:subClassOf obo:OBI_0000181 .
obo:GENO_0000954 a rdfs:Class ;
rdfs:label "allele set"@en ;
rdfs:comment "A set of discrete alleles within a particular genome." ;
rdfs:subClassOf obo:GENO_0000660 .
obo:IAO_0000033 a rdfs:Class ;
rdfs:label "directive information entity"@en ;
rdfs:comment "An information content entity whose concretizations indicate to their bearer how to realize them in a process."@en ;
rdfs:subClassOf obo:IAO_0000030 .
a rdfs:Class ;
rdfs:label "Positive strand"@en ;
rdfs:subClassOf .
obo:OBI_0000700 a rdfs:Class ;
rdfs:label "support vector machine" ;
rdfs:comment "A support vector machine is a data transformation with a class prediction objective based on the construction of a separating hyperplane that maximizes the margin between two data sets of vectors in n-dimensional space." ;
rdfs:subClassOf obo:OBI_0000663 .
obo:CL_0000236 a rdfs:Class ;
rdfs:label "B cell" ;
rdfs:comment "A lymphocyte of B lineage that is capable of B cell mediated immunity." ;
rdfs:subClassOf obo:CL_0000542 .
obo:SO_0001743 a rdfs:Class ;
rdfs:label "copy_number_loss" ;
rdfs:comment "A sequence alteration whereby the copy number of a given region is less than the reference sequence." ;
rdfs:subClassOf obo:SO_0001019 .
obo:GENO_0000870 a rdfs:Class ;
rdfs:label "obsolete sequence feature collection" ;
rdfs:comment "A collection of more than one sequence feature." .
obo:UBERON_0000061 a rdfs:Class ;
rdfs:label "anatomical structure" ;
rdfs:comment "Material anatomical entity that is a single connected structure with inherent 3D shape generated by coordinated expression of the organism's own genome." ;
rdfs:subClassOf obo:UBERON_0000465 .
obo:GENO_0000714 a rdfs:Class ;
rdfs:label "qualified genomic feature"@en ;
rdfs:comment "A qualified sequence feature that carries sequence derived from the genome of a cell or organism." ;
rdfs:subClassOf obo:GENO_0000897 , obo:GENO_0000919 .
obo:SO_0001059 a rdfs:Class ;
rdfs:label "sequence_alteration" ;
rdfs:comment "A sequence_alteration is a sequence_feature whose extent is the deviation from another sequence." ;
rdfs:subClassOf obo:GENO_0000512 .
a rdfs:Class ;
rdfs:label "danio rerio shha gene" ;
rdfs:subClassOf obo:GENO_0000047 .
obo:SO_0001019 a rdfs:Class ;
rdfs:label "copy_number_variation" ;
rdfs:comment "A variation that increases or decreases the copy number of a given region." ;
rdfs:subClassOf obo:SO_0001059 .
obo:SO_0005836 a rdfs:Class ;
rdfs:label "regulatory_region" ;
rdfs:comment "A region of sequence that is involved in the control of a biological process." ;
rdfs:subClassOf obo:GENO_0000666 , obo:SO_0000001 .
obo:GENO_0000649 a rdfs:Class ;
rdfs:label "unspecified genomic background"@en ;
rdfs:comment "A background genotype whose sequence or identity is not known or specified." ;
rdfs:subClassOf obo:GENO_0000611 .
obo:GENO_0000768 a rdfs:Class ;
rdfs:label "obsolete genomic position" ;
rdfs:comment "A sequence feature position based on a genomic coordinate system, where the position specifies start and end coordinates based on its alignment with some reference genomic sequence." .
obo:GENO_0000911 a rdfs:Class ;
rdfs:label "selectable marker"@en ;
rdfs:subClassOf obo:GENO_0000788 .
obo:GO_0016301 a rdfs:Class ;
rdfs:label "kinase activity" ;
rdfs:comment "Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule." ;
rdfs:subClassOf obo:GO_0003674 .
obo:IAO_0000064 a rdfs:Class ;
rdfs:label "algorithm"@en ;
rdfs:comment "A plan specification which describes the inputs and output of mathematical functions as well as workflow of execution for achieving an predefined objective. Algorithms are realized usually by means of implementation as computer programs for execution by automata."@en ;
rdfs:subClassOf obo:IAO_0000104 .
obo:GENO_0000932 a rdfs:Class ;
rdfs:label "polygenic inheritance"@en ;
rdfs:comment "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles a large number of genes." ;
rdfs:subClassOf obo:GENO_0000929 .
obo:GENO_0000054 a rdfs:Class ;
rdfs:label "homo sapiens gene" ;
rdfs:comment "A gene that originates from the genome of a homo sapiens." ;
rdfs:subClassOf obo:SO_0000704 .
obo:GENO_0000633 a rdfs:Class ;
rdfs:label "gpos33" ;
rdfs:subClassOf obo:GENO_0000619 .
obo:GENO_0000971 a rdfs:Class ;
rdfs:label "chromosomal duplication inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by inheritance of duplicated sections of one or more chromosomes, encompassing either 0 or multiple genes, possibly together with environmental factors." ;
rdfs:subClassOf obo:GENO_0000969 .
obo:SO_1000012 a rdfs:Class ;
rdfs:label "C_to_T_transition_at_pCpG_site" ;
rdfs:comment "The transition of cytidine to thymine occurring at a pCpG site as a consequence of the spontaneous deamination of 5'-methylcytidine." ;
rdfs:subClassOf obo:SO_1000011 .
obo:GENO_0000402 a rdfs:Class ;
rdfs:label "compound heterozygous" ;
rdfs:comment "A heterozygous quality inhering in a single locus complement comprised of two different varaint alleles and no wild type locus. (e.g.fgf8a/fgf8a)" ;
rdfs:subClassOf obo:GENO_0000135 .
obo:WBPhenotype_0000886 a rdfs:Class ;
rdfs:label "worm phenotype"@en ;
rdfs:comment "Animals exhibit variations compared to a given control." ;
rdfs:subClassOf obo:UPHENO_0001001 .
obo:IAO_0000015 a rdfs:Class ;
rdfs:label "information carrier"@en ;
rdfs:comment "A quality of an information bearer that imparts the information content"@en ;
rdfs:subClassOf obo:BFO_0000019 .
obo:CL_0000578 a rdfs:Class ;
rdfs:label "experimentally modified cell in vitro" ;
rdfs:comment "A cell in vitro that has undergone physical changes as a consequence of a deliberate and specific experimental procedure." ;
rdfs:subClassOf obo:CL_0000000 , obo:OBI_0000047 .
obo:GENO_0000345 a rdfs:Class ;
rdfs:label "lost aneusomic chromosomal segment" ;
rdfs:comment "A deletion of a terminal portion of a chromosome resulting from an unbalanced translocation to another chromosome." ;
rdfs:subClassOf obo:GENO_0000343 .
obo:GENO_0000678 a rdf:Property ;
rdfs:label "has_extent"@en ;
rdfs:comment "Property linking a sequence or sequence feature to an integer representing its length in terms of the number of units in the sequence." ;
rdfs:range xsd:int .
obo:GENO_0000010 a rdfs:Class ;
rdfs:label "background genome" ;
rdfs:comment "A reference genome that represents the sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations)." ;
rdfs:subClassOf obo:GENO_0000914 .
obo:GENO_0000781 a rdfs:Class ;
rdfs:label "RNA residue"@en ;
rdfs:subClassOf obo:GENO_0000779 .
obo:IAO_0000037 a rdfs:Class ;
rdfs:label "dot plot"@en ;
rdfs:comment "A dot plot is a report graph which is a graphical representation of data where each data point is represented by a single dot placed on coordinates corresponding to data point values in particular dimensions."@en ;
rdfs:subClassOf obo:IAO_0000038 .
obo:CL_0000001 a rdfs:Class ;
rdfs:label "primary cultured cell" ;
rdfs:comment "A cultured cell that is freshly isolated from a organismal source, or derives in culture from such a cell prior to the culture being passaged." ;
rdfs:subClassOf obo:CL_0000010 .
obo:OGMS_0000031 a rdfs:Class ;
rdfs:label "disease" ;
rdfs:comment "A disposition (i) to undergo pathological processes that (ii) exists in an organism because of one or more disorders in that organism."@en ;
rdfs:subClassOf obo:BFO_0000016 .
obo:GENO_0000907 a rdfs:Class ;
rdfs:label "gene product"@en ;
rdfs:comment "The molecular product resulting from transcription of a single gene (either a protein or RNA molecule)" ;
rdfs:subClassOf obo:SO_0000110 .
obo:GENO_0000525 a rdfs:Class ;
rdfs:label "effective genotype"@en ;
rdfs:comment "A genotype that describes the total intrinsic and extrinsic variation across a genome at the time of a phenotypic assessment (where 'intrinsic' refers to variation in genomic sequence, as mediated by sequence alterations, and 'extrinsic' refers to variation in gene expression, as mediated through transient gene-specific interventions such as gene knockdown reagents or overexpression constructs)." ;
rdfs:subClassOf obo:GENO_0000536 .
obo:OBI_0000571 a rdfs:Class ;
rdfs:label "manufacturer role" ;
rdfs:comment "Manufacturer role is a role which inheres in a person or organization and which is realized by a manufacturing process." ;
rdfs:subClassOf obo:BFO_0000023 .
obo:GENO_0000533 a rdfs:Class ;
rdfs:label "gene knockdown reagent"@en ;
rdfs:subClassOf obo:SO_0000804 .
obo:SO_1000024 a rdfs:Class ;
rdfs:label "A_to_C_transversion" ;
rdfs:comment "A transversion from adenine to cytidine." ;
rdfs:subClassOf obo:SO_1000023 .
obo:OBI_0000014 a rdfs:Class ;
rdfs:label "regulator role"@en ;
rdfs:comment "a regulatory role involved with making and/or enforcing relevant legislation and governmental orders"@en ;
rdfs:subClassOf obo:OBI_0000017 .
obo:GENO_0000611 a rdfs:Class ;
rdfs:label "genomic background"@en ;
rdfs:comment "A genomic genotype that specifies the baseline sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations)." ;
rdfs:subClassOf obo:GENO_0000899 .
obo:GENO_0000885 a rdfs:Class ;
rdfs:label "diplotype"@en ;
rdfs:comment """An allelic genotype specifying the set of two alleles present at a particular location in a diploid genome (i.e., a diploid 'single locus complement')
Alt: A sequence feature complement comprised of two haplotypes at a particular location on paired homologous chromosomes in a diploid genome.""" ;
rdfs:subClassOf obo:GENO_0000823 .
obo:GENO_0000923 a rdfs:Class ;
rdfs:label "obsolete functional copy number complement" ;
rdfs:comment "A set of all features representing *functional* versions of a specified sequence (typically that of a gene) in a particular genome." .
obo:GENO_0000943 a rdfs:Class ;
rdfs:label "Z-linked dominant inheritance"@en ;
rdfs:comment "A Z-linked inheritance pattern wherein the trait manifests in heterozygotes." ;
rdfs:subClassOf obo:GENO_0000942 .
obo:OBI_0100026 a rdfs:Class ;
rdfs:label "organism" ;
rdfs:comment "A material entity that is an individual living system, such as animal, plant, bacteria or virus, that is capable of replicating or reproducing, growth and maintenance in the right environment. An organism may be unicellular or made up, like humans, of many billions of cells divided into specialized tissues and organs."@en ;
rdfs:subClassOf obo:GENO_0000904 .
obo:GENO_0000782 a rdfs:Class ;
rdfs:label "amino acid residue"@en ;
rdfs:subClassOf obo:GENO_0000779 .
obo:GENO_0000667 a rdfs:Class ;
rdfs:label "reporter transgene"@en ;
rdfs:comment "A transgene that codes for a product used as a reporter of gene expression or activity." ;
rdfs:subClassOf obo:SO_0000804 , obo:SO_0000902 .
obo:OBI_0001867 a rdfs:Class ;
rdfs:label "establishing cell line" ;
rdfs:comment "a process whereby a new type of cell line is created, either through passaging of a primary cell culture to relative genetic stability and compositional homogeneity, or through some experimental modification of an existing cell line to produce a new line with novel characteristics (e.g. immortalization or some other stable genetic modification, or selection of some defined subset)." ;
rdfs:subClassOf obo:OBI_0600036 .
obo:GENO_0000502 a rdfs:Class ;
rdfs:label "wild-type gene" ;
rdfs:comment "A gene allele representing the most common varaint in a population (typically >99% frequency), that exhibits canonical function, and against which rare and/or non-functional mutant gene alleles are compared in characterizing the phenotypic consequences of genetic variation." ;
rdfs:subClassOf obo:GENO_0000501 , obo:SO_0000704 .
obo:GENO_0000653 a rdf:Property ;
rdfs:label "is_wild_type_allele_of"@en ;
rdfs:comment "A relationship between a wild-type allele and the gene class it is an allele of." ;
rdfs:domain obo:GENO_0000501 ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000408 .
obo:GENO_0000498 a rdfs:Class ;
rdfs:label "major polymorphic allele" ;
rdfs:comment "A polymorphic allele that is present at the highest frequency relative to other polymorphic variants at the same genomic location." ;
rdfs:subClassOf obo:GENO_0000497 .
obo:GENO_0000091 a rdfs:Class ;
rdfs:label "obsolete experimental insertion" .
obo:IAO_0000101 a rdfs:Class ;
rdfs:label "image"@en ;
rdfs:comment "An image is an affine projection to a two dimensional surface, of measurements of some quality of an entity or entities repeated at regular intervals across a spatial range, where the measurements are represented as color and luminosity on the projected on surface."@en ;
rdfs:subClassOf obo:IAO_0000308 .
obo:SO_1000035 a rdfs:Class ;
rdfs:label "duplication" ;
rdfs:comment "One or more nucleotides are added between two adjacent nucleotides in the sequence; the inserted sequence derives from, or is identical in sequence to, nucleotides adjacent to insertion point." ;
rdfs:subClassOf obo:SO_0000667 .
obo:GENO_0000536 a rdfs:Class ;
rdfs:label "genotype"@en ;
rdfs:comment "A specification of the genetic state of an organism, whether complete (defined over the whole genome) or incomplete (defined over a subset of the genome). Genotypes typically describe this genetic state as a diff between some variant component and a canonical reference." ;
rdfs:subClassOf obo:IAO_0000030 .
obo:OBI_0200111 a rdfs:Class ;
rdfs:label "data visualization"@en ;
rdfs:comment "An planned process that creates images, diagrams or animations from the input data."@en ;
rdfs:subClassOf obo:OBI_0000011 .
a rdfs:Class ;
rdfs:label "mus musculus shh gene" ;
rdfs:comment "Equivalent to: http://www.informatics.jax.org/marker/MGI:98297" ;
rdfs:subClassOf obo:GENO_0000057 .
obo:GENO_0000394 a rdfs:Class ;
rdfs:label "trisomic heterozygous" ;
rdfs:subClassOf obo:GENO_0000392 .
obo:BFO_0000019 a rdfs:Class ;
rdfs:label "quality" ;
rdfs:subClassOf obo:BFO_0000020 .
obo:GENO_0000622 a rdfs:Class ;
rdfs:label "gpos100"@en ;
rdfs:subClassOf obo:GENO_0000619 .
obo:SO_1000014 a rdfs:Class ;
rdfs:label "purine_transition" ;
rdfs:comment "A substitution of a purine, A or G, for another purine." ;
rdfs:subClassOf obo:SO_1000009 .
obo:SO_0000167 a rdfs:Class ;
rdfs:label "promoter" ;
rdfs:comment "A regulatory_region composed of the TSS(s) and binding sites for TF_complexes of the basal transcription machinery." ;
rdfs:subClassOf obo:SO_0005836 .
obo:GENO_0000476 a rdfs:Class ;
rdfs:label "variant"@en ;
rdfs:comment "An attribute inhering in a sequence feature that varies from some designated reference in virtue of alterations in its sequence or expression level" ;
rdfs:subClassOf obo:GENO_0000773 .
obo:PATO_0000383 a rdfs:Class ;
rdfs:label "female" ;
rdfs:comment "A biological sex quality inhering in an individual or a population that only produces gametes that can be fertilised by male gametes." ;
rdfs:subClassOf obo:PATO_0001894 .
obo:SO_1000040 a rdfs:Class ;
rdfs:label "inverted_tandem_duplication" ;
rdfs:comment "A tandem duplication where the individual regions are not in the same orientation." ;
rdfs:subClassOf obo:SO_1000173 .
obo:GENO_0000918 a rdfs:Class ;
rdfs:label "organellar plasmy"@en ;
rdfs:comment "An allelic state that describes the number of different alleles of a gene from an organellar genome (i.e. mitochondrial, plastid) that may exist in a cell." ;
rdfs:subClassOf obo:GENO_0000875 .
obo:GENO_0000037 a rdfs:Class ;
rdfs:label "obsolete unspecified feature" ;
rdfs:comment "A genomic feature known to exist, but remaining uncharacterized with respect to its identity (e.g. which allele exists at a given gene locus)." .
obo:GENO_0000513 a rdfs:Class ;
rdfs:label "aneusomic"@en ;
rdfs:comment "a sequence attribute of a chromosome or chromosomal region that has been abnormally duplicated or lost, as the result of a non-disjunction event or unbalanced translocation." ;
rdfs:subClassOf obo:GENO_0000773 .
obo:GENO_0000680 a rdfs:Class ;
rdfs:label "obsolete null feature" ;
rdfs:comment "A genomic feature that has an extent of zero." .
obo:GENO_0000060 a rdfs:Class ;
rdfs:label "obsolete reference gene allele" ;
rdfs:comment "A version/allele of a gene that serves as a standard against which variant genes are compared." .
obo:GENO_0000770 a rdfs:Class ;
rdfs:label "phenotypic inheritance process"@en ;
rdfs:subClassOf obo:GENO_0000351 .
obo:GENO_0000815 a rdfs:Class ;
rdfs:label "sequence feature location"@en ;
rdfs:comment "The location of a sequence feature as defined by its start and end position on some reference coordinate system." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:SO_0001479 a rdfs:Class ;
rdfs:label "enhancer_trap_construct"@en ;
rdfs:comment "A construct which is designed to integrate into a genome and express a reporter when the expression from a basic minimal promoter is enhanced by genomic enhancer elements. Enhancer traps contain promoter elements and are not usually mutagenic." ;
rdfs:subClassOf obo:GENO_0000856 .
obo:NCBITaxon_32523 a rdfs:Class ;
rdfs:label "Tetrapoda" ;
rdfs:subClassOf obo:NCBITaxon_117571 .
obo:GENO_0000118 a rdfs:Class ;
rdfs:label "mus musculus strain" ;
rdfs:subClassOf obo:GENO_0000112 .
obo:CL_0000542 a rdfs:Class ;
rdfs:label "lymphocyte" ;
rdfs:comment "A lymphocyte is a leukocyte commonly found in the blood and lymph that has the characteristics of a large nucleus, a neutral staining cytoplasm, and prominent heterochromatin." ;
rdfs:subClassOf obo:CL_0000842 .
obo:OBI_0000707 a rdfs:Class ;
rdfs:label "decision tree building data transformation"@en ;
rdfs:comment "A decision tree building data transformation is a data transformation that has objective decision tree induction."@en ;
rdfs:subClassOf obo:OBI_0200000 .
obo:SO_1000023 a rdfs:Class ;
rdfs:label "purine_to_pyrimidine_transversion" ;
rdfs:comment "Change of a purine nucleotide, A or G , into a pyrimidine nucleotide C or T." ;
rdfs:subClassOf obo:SO_1000017 .
a rdfs:Class ;
rdfs:label "Exact position"@en ;
rdfs:comment "A position that is exactly known." ;
rdfs:subClassOf .
obo:GENO_0000495 a rdfs:Class ;
rdfs:label "expression construct"@en ;
rdfs:subClassOf obo:GENO_0000856 .
obo:IAO_0000096 a rdfs:Class ;
rdfs:label "source code module"@en ;
rdfs:comment "A source code module is a directive information entity that specifies, using a programming language, some algorithm."@en ;
rdfs:subClassOf obo:IAO_0000033 .
obo:SO_0000637 a rdfs:Class ;
rdfs:label "obsolete engineered_plasmid" .
obo:GENO_0000736 a rdfs:Class ;
rdfs:label "location-qualified sequence feature"@en ;
rdfs:comment "A sequence feature whose identity is additionally dependent on the cellular or anatomical location of the genetic material bearing the feature." ;
rdfs:subClassOf obo:GENO_0000714 .
obo:GENO_0000823 a rdfs:Class ;
rdfs:label "allelic genotype"@en ;
rdfs:comment "A genotype that specifies the 'allelic state' at a particular location in the genome - i.e. the set of alleles present at this locus across all homologous chromosomes." ;
rdfs:subClassOf obo:GENO_0000719 , obo:GENO_0000897 .
obo:IAO_8000016 a rdfs:Class ;
rdfs:label "taxonomic bridge ontology module"@en ;
rdfs:subClassOf obo:IAO_8000004 .
obo:SO_1000036 a rdfs:Class ;
rdfs:label "inversion" ;
rdfs:comment "A continuous nucleotide sequence is inverted in the same position." ;
rdfs:subClassOf obo:SO_0001059 .
obo:GENO_0000343 a rdfs:Class ;
rdfs:label "aneusomic chromosomal part" ;
rdfs:comment "A large deletion or terminal addition of part of some non-homologous chromsosome, as the result of an unbalanced translocation." ;
rdfs:subClassOf obo:SO_0000830 , obo:SO_0001059 .
obo:SO_0001410 a rdfs:Class ;
rdfs:label "experimental_feature" ;
rdfs:comment "A region which is the result of some arbitrary experimental procedure. The procedure may be carried out with biological material or inside a computer." ;
rdfs:subClassOf obo:SO_0000001 .
obo:NCBITaxon_9989 a rdfs:Class ;
rdfs:label "Rodentia" ;
rdfs:subClassOf obo:NCBITaxon_314146 .
obo:OBI_0000018 a rdfs:Class ;
rdfs:label "material supplier role"@en ;
rdfs:comment "a role realized through the process of supplying materials such as animal subjects, reagents or other materials used in an investigation."@en ;
rdfs:subClassOf obo:OBI_0000947 .
obo:GENO_0000477 a rdfs:Class ;
rdfs:label "polymorphic"@en ;
rdfs:comment "An attribute inhereing in a sequence feature for which there is more than one version fixed in a population at some significant percentage (typically 1% or greater), where the locus is not considered to be either reference or a variant." ;
rdfs:subClassOf obo:GENO_0000773 .
obo:CHEBI_33839 a rdfs:Class ;
rdfs:label "macromolecule" ;
rdfs:comment "A macromolecule is a molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass." ;
rdfs:subClassOf obo:CHEBI_23367 .
obo:SO_1000002 a rdfs:Class ;
rdfs:label "substitution" ;
rdfs:comment "Any change in genomic DNA caused by a single event." ;
rdfs:subClassOf obo:SO_0001059 .
obo:SO_0001744 a rdfs:Class ;
rdfs:label "UPD" ;
rdfs:comment "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from one parent and no copies of the same chromosome or region from the other parent." ;
rdfs:subClassOf obo:SO_0001059 .
obo:UPHENO_0001001 a rdfs:Class ;
rdfs:label "Phenotype" ;
rdfs:comment """1. From OGMS: A (combination of) quality(ies) of an organism determined by the interaction of its genetic make-up and environment that differentiates specific instances of a species from other instances of the same species (from OGMS, and used in OBI, but treatment as a quality is at odds with previous OBI discussions and their treatemnt of 'comparative phenotype assessment, where a phenotype is described as a quality or disposition)
2. From OBI calls: quality or disposition inheres in organism or part of an organism towards some growth environment""" ;
rdfs:subClassOf obo:PATO_0000001 .
obo:GENO_0000628 a rdfs:Class ;
rdfs:label "short chromosome arm"@en ;
rdfs:comment "A chromosome arm that is the shorter of the two arms of a given chromosome." ;
rdfs:subClassOf obo:SO_0000105 .
obo:NCBITaxon_2759 a rdfs:Class ;
rdfs:label "Eukaryota" ;
rdfs:subClassOf obo:OBI_0100026 .
obo:GENO_0000149 a rdfs:Class ;
rdfs:label "X-linked recessive inheritance"@en ;
rdfs:comment "An X-linked inheritance pattern wherein a trait caused by alleles of a gene on the X-chromosome manifests in homozygous but not heterozygote individuals." ;
rdfs:subClassOf obo:GENO_0000936 .
obo:CHEBI_33696 a rdfs:Class ;
rdfs:label "nucleic acid" ;
rdfs:comment "A macromolecule made up of nucleotide units and hydrolysable into certain pyrimidine or purine bases (usually adenine, cytosine, guanine, thymine, uracil), D-ribose or 2-deoxy-D-ribose and phosphoric acid." ;
rdfs:subClassOf obo:CHEBI_33839 .
obo:IAO_8000001 a rdfs:Class ;
rdfs:label "base ontology module"@en ;
rdfs:comment "An ontology module that comprises only of asserted axioms local to the ontology, excludes import directives, and excludes axioms or declarations from external ontologies."@en ;
rdfs:seeAlso ;
rdfs:subClassOf obo:IAO_8000000 .
obo:SO_1000025 a rdfs:Class ;
rdfs:label "A_to_T_transversion" ;
rdfs:comment "A transversion from adenine to thymine." ;
rdfs:subClassOf obo:SO_1000023 .
obo:GENO_0000701 a rdfs:Class ;
rdfs:label "sequence feature or set"@en ;
rdfs:comment "A sequence feature or a set of such features." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:IAO_8000012 a rdfs:Class ;
rdfs:label "species subset ontology module"@en ;
rdfs:comment "A subset ontology that is crafted to either include or exclude a taxonomic grouping of species."@en ;
rdfs:seeAlso ;
rdfs:subClassOf obo:IAO_8000006 .
obo:GENO_0000134 a rdfs:Class ;
rdfs:label "hemizygous" ;
rdfs:comment "A zygosity quality inhering in a 'single locus complement' with half the number of alleles than normal (e.g. a single allele in a diploid genome, for example, a locus on the Y chromosome in a eukaryotic male genome, or a transgene that is present only in one of the two parental chromosome sets)" ;
rdfs:subClassOf obo:GENO_0000391 .
obo:BFO_0000020 a rdfs:Class ;
rdfs:label "specifically dependent continuant" ;
rdfs:comment "A continuant that inheres in or is borne by other entities. Every instance of A requires some specific instance of B which must always be the same."@en ;
rdfs:subClassOf obo:BFO_0000002 .
obo:SO_1000018 a rdfs:Class ;
rdfs:label "pyrimidine_to_purine_transversion" ;
rdfs:comment "Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G." ;
rdfs:subClassOf obo:SO_1000017 .
obo:APOLLO_SV_00000796 a rdfs:Class ;
rdfs:label "dataset creating"@en ;
rdfs:comment "A planned process that has a data set as its specified output."@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:GENO_0000878 a rdfs:Class ;
rdfs:label "maternal allele origin"@en ;
rdfs:comment "Describes an allele that is inherited from a female parent in virtue of the allele being present in the mother's egg." ;
rdfs:subClassOf obo:GENO_0000888 .
a rdfs:Class ;
rdfs:label "association"@en ;
rdfs:subClassOf obo:IAO_0000030 .
obo:PATO_0000047 a rdfs:Class ;
rdfs:label "biological sex" ;
rdfs:comment "An organismal quality inhering in a bearer by virtue of the bearer's ability to undergo sexual reproduction in order to differentiate the individuals or types involved." ;
rdfs:subClassOf obo:PATO_0001995 .
obo:GENO_0000338 a rdfs:Class ;
rdfs:label "gained aneusomic chromosome" ;
rdfs:comment "A complete chromosome that has been abnormally duplicated in a genome, typically as the result of a meiotic non-disjunction event or unbalanced translocation" ;
rdfs:subClassOf obo:GENO_0000346 .
obo:GENO_0000029 a rdfs:Class ;
rdfs:label "obsolete reference single locus complement" ;
rdfs:comment "A single locus complement that serves as a standard against which 'variant' sequences are compared" .
obo:GENO_0000960 a rdfs:Class ;
rdfs:label "genomic sequence"@en ;
rdfs:comment "A biological sequence that is of genomic origin (i.e. carries sequence from the genome of a cell or organism)." ;
rdfs:subClassOf obo:GENO_0000702 .
obo:GENO_0000516 a rdfs:Class ;
rdfs:label "single locus complement" ;
rdfs:comment "A set representing the complement of all sequence features occupying a particular genomic location across all homologous chromosomes in the genome of a single organism." ;
rdfs:subClassOf obo:GENO_0000660 .
obo:PATO_0001894 a rdfs:Class ;
rdfs:label "phenotypic sex" ;
rdfs:comment "An organismal quality inhering in a bearer by virtue of the bearer's physical expression of sexual characteristics." ;
rdfs:subClassOf obo:PATO_0000047 .
obo:GENO_0000910 a rdfs:Class ;
rdfs:label "reporter"@en ;
rdfs:subClassOf obo:GENO_0000788 .
obo:GENO_0000646 a rdfs:Class ;
rdfs:label "male intrinsic genotype"@en ;
rdfs:comment "A genomic genotype here the genomic background specifies a male sex chromosome complement." ;
rdfs:subClassOf obo:GENO_0000645 .
obo:GENO_0000856 a rdfs:Class ;
rdfs:label "engineered genetic construct"@en ;
rdfs:comment "An engineered region that is used to transfer foreign genetic material into a host cell." ;
rdfs:subClassOf obo:SO_0000804 .
obo:GENO_0000899 a rdfs:Class ;
rdfs:label "genomic genotype"@en ;
rdfs:comment "A genotype that describes the total variation in heritable genomic sequence of a cell or organism, typically in terms of alterations from some reference or background genotype." ;
rdfs:subClassOf obo:GENO_0000719 , obo:GENO_0000897 .
obo:OBI_0000245 a rdfs:Class ;
rdfs:label "organization"@en ;
rdfs:comment "An entity that can bear roles, has members, and has a set of organization rules. Members of organizations are either organizations themselves or individual people. Members can bear specific organization member roles that are determined in the organization rules. The organization rules also determine how decisions are made on behalf of the organization by the organization members."@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:GENO_0000606 a rdfs:Class ;
rdfs:label "hemizygous insertion-linked"@en ;
rdfs:subClassOf obo:GENO_0000134 .
obo:OBI_0100060 a rdfs:Class ;
rdfs:label "cultured cell population" ;
rdfs:comment "A processed material comprised of a collection of cultured cells that has been continuously maintained together in culture and shares a common propagation history." ;
rdfs:subClassOf obo:OBI_0000047 .
obo:GENO_0000949 a rdfs:Class ;
rdfs:label "mitochondrial inheritance"@en ;
rdfs:comment "An inheritance pattern observed for traits related to a gene encoded on the mitochondrial genome." ;
rdfs:subClassOf obo:GENO_0000141 .
obo:SO_0001483 a rdfs:Class ;
rdfs:label "SNV" ;
rdfs:comment "SNVs are single base pair positions in genomic DNA at which different sequence alternatives exist." ;
rdfs:subClassOf obo:SO_1000002 .
obo:GENO_0000339 a rdfs:Class ;
rdfs:label "lost aneusomic chromosome" ;
rdfs:comment "A 'deletion' resulting from the loss of a complete chromosome, typically as the result of a meiotic non-disjunction event or unbalanced translocation." ;
rdfs:subClassOf obo:GENO_0000346 .
obo:IAO_8000005 a rdfs:Class ;
rdfs:label "import ontology module"@en ;
rdfs:comment "A subset ontology module that is intended to be imported from another ontology."@en ;
rdfs:seeAlso ;
rdfs:subClassOf obo:IAO_8000006 .
obo:SO_0000159 a rdfs:Class ;
rdfs:label "deletion" ;
rdfs:comment "The point at which one or more contiguous nucleotides were excised." ;
rdfs:subClassOf obo:SO_0001059 .
obo:OBI_0200050 a rdfs:Class ;
rdfs:label "dimensionality reduction"@en ;
rdfs:comment "A dimensionality reduction is data partitioning which transforms each input m-dimensional vector (x_1, x_2, ..., x_m) into an output n-dimensional vector (y_1, y_2, ..., y_n), where n is smaller than m."@en ;
rdfs:subClassOf obo:APOLLO_SV_00000796 , obo:OBI_0200175 .
obo:GENO_0000145 a rdfs:Class ;
rdfs:label "incomplete autosomal dominant inheritance" ;
rdfs:comment "An autosomal dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." ;
rdfs:subClassOf obo:GENO_0000147 .
obo:GENO_0000904 a rdfs:Class ;
rdfs:label "organismal entity"@en ;
rdfs:comment "A material entity that is an organism, derived from an organism, or composed of organisms (e.g. a cell line, biosample, tissue culture, population, etc)." ;
rdfs:subClassOf obo:BFO_0000040 .
obo:GENO_0000946 a rdfs:Class ;
rdfs:label "co-dominant Z-linked inheritance"@en ;
rdfs:comment "An Z-linked dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." ;
rdfs:subClassOf obo:GENO_0000943 .
obo:GENO_0000935 a rdfs:Class ;
rdfs:label "allosomal inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a sex chromosome." ;
rdfs:subClassOf obo:GENO_0000933 .
obo:GENO_0000915 a rdfs:Class ;
rdfs:label "obsolete haplotype" ;
rdfs:comment "A haplotype is an allele that represents one of many possible versions of a 'haplotype block', which defines a region of genomic sequence that is typically 'co-inherited' across generations due to a lack of historically observed recombination within it." .
obo:GENO_0000965 a rdfs:Class ;
rdfs:label "sequence interval" ;
rdfs:comment "A pair of integers representing start and end position of a location on a sequence coordinate system." ;
rdfs:subClassOf obo:IAO_0000030 .
obo:OBI_0000806 a rdfs:Class ;
rdfs:label "material maintenance objective" ;
rdfs:comment "An objective specification maintains some or all of the qualities of a material over time." ;
rdfs:subClassOf obo:IAO_0000005 .
obo:GENO_0000927 a rdfs:Class ;
rdfs:label "constitutional"@en ;
rdfs:comment "A cellular distribution in which an allele is found in all cells of an organism's body, typically in virtue of its germline origin." ;
rdfs:subClassOf obo:GENO_0000926 .
obo:GENO_0000976 a rdfs:Class ;
rdfs:label "biparental allele origin"@en ;
rdfs:comment "Describes an allele that is part of an allelic complement where one allele is maternally inherited and other paternally inherited." ;
rdfs:subClassOf obo:GENO_0000974 .
obo:IAO_0000003 a rdfs:Class ;
rdfs:label "measurement unit label"@en ;
rdfs:comment "A measurement unit label is as a label that is part of a scalar measurement datum and denotes a unit of measure."@en ;
rdfs:subClassOf obo:IAO_0000009 .
obo:GENO_0000138 a rdfs:Class ;
rdfs:label "heritabililty" ;
rdfs:comment "The disposition of an entity to be transmitted to subsequent generations following a genetic replication or organismal reproduction event." ;
rdfs:subClassOf obo:BFO_0000016 .
obo:GENO_0000938 a rdfs:Class ;
rdfs:label "incomplete X-linked dominant inheritance"@en ;
rdfs:comment "An X-linked dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." ;
rdfs:subClassOf obo:GENO_0000146 .
obo:GENO_0000848 a rdfs:Class ;
rdfs:label "obsolete coding sequence alteration" ;
rdfs:comment "A sequence alteration within the coding sequence of a gene." .
obo:GENO_0000512 a rdfs:Class ;
rdfs:label "allele" ;
rdfs:comment "One of a set of sequence features known to exist at a particular genomic location." ;
rdfs:subClassOf obo:GENO_0000481 .
obo:GENO_0000947 a rdfs:Class ;
rdfs:label "Z-linked reccessive inheritance"@en ;
rdfs:comment "A Z-linked inheritance pattern wherein a trait caused by alleles of a gene on the Z-chromosome manifests in homozygous but not heterozygote individuals." ;
rdfs:subClassOf obo:GENO_0000942 .
obo:GENO_0000618 a rdfs:Class ;
rdfs:label "chromosomal band intensity"@en ;
rdfs:subClassOf obo:GENO_0000788 .
obo:SO_0001785 a rdfs:Class ;
rdfs:label "structural_alteration" ;
rdfs:subClassOf obo:SO_0001059 .
obo:GENO_0000914 a rdfs:Class ;
rdfs:label "reference genome"@en ;
rdfs:comment "A genome whose sequence is identical to that of a genome sequence considered to be the reference." ;
rdfs:subClassOf obo:SO_0001026 .
obo:OBI_0200190 a rdfs:Class ;
rdfs:label "clustered data visualization" ;
rdfs:comment "A data visualization which has input of a clustered data set and produces an output of a report graph which is capable of rendering data of this type." ;
rdfs:subClassOf obo:OBI_0200111 .
obo:GENO_0000602 a rdfs:Class ;
rdfs:label "homoplasmic"@en ;
rdfs:comment "an allelic state where a single allele exists at a particular location in the organellar genome (mitochondrial or plastid) of a cell/organism." ;
rdfs:subClassOf obo:GENO_0000918 .
obo:IAO_8000009 a rdfs:Class ;
rdfs:label "single layer subset ontology module"@en ;
rdfs:comment "A subset ontology that is largely comprised of a single layer or strata in an ontology class hierarchy. The purpose is typically for rolling up for visualization. The classes in the layer need not be disjoint."@en ;
rdfs:subClassOf obo:IAO_8000006 .
obo:IAO_0000038 a rdfs:Class ;
rdfs:label "graph"@en ;
rdfs:comment "A diagram that presents one or more tuples of information by mapping those tuples in to a two dimensional space in a non arbitrary way."@en ;
rdfs:subClassOf obo:IAO_0000309 .
obo:GENO_0000773 a rdfs:Class ;
rdfs:label "variation attribute"@en ;
rdfs:comment "An attribute describing a type of variation inhering in a sequence feature or collection." ;
rdfs:subClassOf obo:GENO_0000788 .
obo:GENO_0000497 a rdfs:Class ;
rdfs:label "polymorphic allele" ;
rdfs:comment "An allele that is fixed in a population at some stable level, typically > 1%. Polymorphic alleles reside at loci where more than one version exists at some signifcant frequency in a population." ;
rdfs:subClassOf obo:GENO_0000512 .
obo:GENO_0000143 a rdfs:Class ;
rdfs:label "co-dominant autosomal inheritance" ;
rdfs:comment "An autosomal dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." ;
rdfs:subClassOf obo:GENO_0000147 .
obo:OBI_0200041 a rdfs:Class ;
rdfs:label "k-means clustering"@en ;
rdfs:comment "A k-means clustering is a data transformation which achieves a class discovery or partitioning objective, which takes as input a collection of objects (represented as points in multidimensional space) and which partitions them into a specified number k of clusters. The algorithm attempts to find the centers of natural clusters in the data. The most common form of the algorithm starts by partitioning the input points into k initial sets, either at random or using some heuristic data. It then calculates the mean point, or centroid, of each set. It constructs a new partition by associating each point with the closest centroid. Then the centroids are recalculated for the new clusters, and the algorithm repeated by alternate applications of these two steps until convergence, which is obtained when the points no longer switch clusters (or alternatively centroids are no longer changed)."@en ;
rdfs:subClassOf obo:APOLLO_SV_00000796 , obo:OBI_0200171 , obo:OBI_0200175 .
obo:IAO_0000102 a rdfs:Class ;
rdfs:label "data about an ontology part" ;
rdfs:comment "Data about an ontology part is a data item about a part of an ontology, for example a term"@en ;
rdfs:subClassOf obo:IAO_0000027 .
obo:SO_0000110 a rdfs:Class ;
rdfs:label "sequence_feature" ;
rdfs:comment "Any extent of continuous biological sequence." ;
rdfs:subClassOf obo:GENO_0000701 .
obo:OBI_0000648 a rdfs:Class ;
rdfs:label "clustered data set"@en ;
rdfs:comment "A data set that is produced as the output of a class discovery data transformation and consists of a data set with assigned discovered class labels."@en ;
rdfs:subClassOf obo:IAO_0000100 .
obo:IAO_8000004 a rdfs:Class ;
rdfs:label "bridge ontology module"@en ;
rdfs:comment "An ontology module that consists entirely of axioms that connect or bridge two distinct ontology modules. For example, the Uberon-to-ZFA bridge module."@en ;
rdfs:seeAlso ;
rdfs:subClassOf obo:IAO_8000000 .
obo:GENO_0000964 a rdfs:Class ;
rdfs:label "mosaic"@en ;
rdfs:comment "A clonal distribution in which an allele arose during embryogenesis and is present in a subset of tissues derived from some common developmental cell or tissue type." ;
rdfs:subClassOf obo:GENO_0000928 .
obo:SO_0001505 a rdfs:Class ;
rdfs:label "reference genome sequence" ;
rdfs:comment "A genome sequence that is used as a standard against which other genome sequences are compared, or into which alterations are intentionally introduced." ;
rdfs:subClassOf obo:GENO_0000017 .
obo:SO_0000667 a rdfs:Class ;
rdfs:label "insertion" ;
rdfs:comment "The sequence of one or more nucleotides added between two adjacent nucleotides in the sequence." ;
rdfs:subClassOf obo:SO_0001059 .
obo:GENO_0000926 a rdfs:Class ;
rdfs:label "allelic cellular distribution"@en ;
rdfs:comment "A quality inhering in an allele reflecting whether it is found in all cells of an organism's body, or just some clonal subset (e.g. in mosaicism)." ;
rdfs:subClassOf obo:GENO_0000788 .
obo:RO_0002577 a rdfs:Class ;
rdfs:label "system" ;
rdfs:comment "A material entity consisting of multiple components that are causally integrated." ;
rdfs:subClassOf obo:BFO_0000040 .
obo:GENO_0000529 a rdfs:Class ;
rdfs:label "expression-variant gene"@en ;
rdfs:comment "A gene altered in its expression level relative to some baseline of normal expression in the system under investigation (e.g. a cell line or model organism)." ;
rdfs:subClassOf obo:GENO_0000737 .
obo:ENVO_01000254 a rdfs:Class ;
rdfs:label "environmental system" ;
rdfs:comment "A system which has the disposition to environ one or more material entities." ;
rdfs:subClassOf obo:RO_0002577 .
obo:PATO_0000001 a rdfs:Class ;
rdfs:label "quality" ;
rdfs:comment "A dependent entity that inheres in a bearer by virtue of how the bearer is related to other entities" ;
rdfs:subClassOf obo:BFO_0000020 .
obo:IAO_0000010 a rdfs:Class ;
rdfs:label "software"@en ;
rdfs:comment """Software is a plan specification composed of a series of instructions that can be
interpreted by or directly executed by a processing unit."""@en ;
rdfs:subClassOf obo:IAO_0000104 .
obo:GENO_0000888 a rdfs:Class ;
rdfs:label "germline allele origin"@en ;
rdfs:comment "Describes an allele that is inherited from a parent in virtue of the allele being present in the germline of one of the parents." ;
rdfs:subClassOf obo:GENO_0000974 .
obo:GENO_0000942 a rdfs:Class ;
rdfs:label "Z-linked inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a Z-chromosome." ;
rdfs:subClassOf obo:GENO_0000935 .
obo:OBI_0001866 a rdfs:Class ;
rdfs:label "secondary cultured cell" ;
rdfs:comment "A cultured cell that has been passaged or derives from a cell that has been passaged in culture. " ;
rdfs:subClassOf obo:CL_0000010 .
obo:GENO_0000132 a rdfs:Class ;
rdfs:label "in trans" ;
rdfs:comment "A quality inhering in a collection of discontinuous sequence features in a single genome that reside on different macromolecules (e.g. different chromosomes)." ;
rdfs:subClassOf obo:GENO_0000886 .
obo:GENO_0000931 a rdfs:Class ;
rdfs:label "oligogenic inheritance"@en ;
rdfs:comment "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles in few genes." ;
rdfs:subClassOf obo:GENO_0000929 .
obo:SO_0000001 a rdfs:Class ;
rdfs:label "region" ;
rdfs:comment "A sequence_feature with an extent greater than zero. A nucleotide region is composed of bases and a polypeptide region is composed of amino acids." ;
rdfs:subClassOf obo:BFO_0000031 .
obo:SO_0000143 a rdfs:Class ;
rdfs:label "obsolete assembly_component" ;
rdfs:comment "A region of known length which may be used to manufacture a longer region." .
obo:GENO_0000171 a rdfs:Class ;
rdfs:label "obsolete enhancer trapping technique" .
obo:GENO_0000969 a rdfs:Class ;
rdfs:label "chromosomal inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by inheritance of extra, missing, or re-arranged chromosomes possibly together with environmental factors." ;
rdfs:subClassOf obo:GENO_0000141 .
a rdfs:Class ;
rdfs:label "homo sapiens SHH gene"@en ;
rdfs:comment """Equivalent to: http://www.ensembl.org/Gene/Summary?g=ENSG00000164690
Codes for: http://www.uniprot.org/uniprot/Q15465""" ;
rdfs:subClassOf obo:GENO_0000054 .
obo:GENO_0000970 a rdfs:Class ;
rdfs:label "chromosomal deletion inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by inheritance of missing sections of one or more chromosomes, encompassing either 0 or multiple genes, possibly together with environmental factors." ;
rdfs:subClassOf obo:GENO_0000969 .
obo:GENO_0000501 a rdfs:Class ;
rdfs:label "wild-type allele" ;
rdfs:comment "An allele representing a highly common varaint (typically >99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are often compared." ;
rdfs:subClassOf obo:GENO_0000512 .
obo:IAO_8000019 a rdfs:Class ;
rdfs:label "ontology module subsetted by OWL profile"@en ;
rdfs:subClassOf obo:IAO_8000017 .
obo:SO_0001478 a rdfs:Class ;
rdfs:label "promoter_trap_construct"@en ;
rdfs:comment "A construct which is designed to integrate into a genome and express a reporter when inserted in close proximity to a promoter element. Promoter traps typically do not contain promoter elements and are mutagenic." ;
rdfs:subClassOf obo:GENO_0000856 .
a rdfs:Class ;
rdfs:label "Negative strand"@en ;
rdfs:subClassOf .
obo:SO_0000034 a rdfs:Class ;
rdfs:label "morpholino_oligo" ;
rdfs:comment "Morpholino oligos are synthesized from four different Morpholino subunits, each of which contains one of the four genetic bases (A, C, G, T) linked to a 6-membered morpholine ring. Eighteen to 25 subunits of these four subunit types are joined in a specific order by non-ionic phosphorodiamidate intersubunit linkages to give a Morpholino." ;
rdfs:subClassOf obo:GENO_0000533 .
obo:GENO_0000725 a rdfs:Class ;
rdfs:label "obsolete biological sequence collection" .
obo:GENO_0000715 a rdfs:Class ;
rdfs:label "qualified genomic feature set"@en ;
rdfs:comment "A set of qualified sequence features that carry genomic sequence." ;
rdfs:subClassOf obo:GENO_0000897 , obo:GENO_0000920 .
obo:OBI_0002215 a rdfs:Class ;
rdfs:label "histologic grade for ovarian tumor" ;
rdfs:comment "A categorical value specification that is a histologic grade assigned to a ovarian tumor." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:GENO_0000629 a rdfs:Class ;
rdfs:label "long chromosome arm"@en ;
rdfs:comment "A chromosome arm that is the longer of the two arms of a given chromosome." ;
rdfs:subClassOf obo:SO_0000105 .
obo:PATO_0000384 a rdfs:Class ;
rdfs:label "male" ;
rdfs:comment "A biological sex quality inhering in an individual or a population whose sex organs contain only male gametes." ;
rdfs:subClassOf obo:PATO_0001894 .
obo:GENO_0000042 a rdfs:Class ;
rdfs:label "obsolete reference junction" ;
rdfs:comment "A junction found at a chromosomal position where an insertion has occurred on the homologous chromosome, such that the junction represents the reference feature paired with the hemizygously inserted feature." .
obo:APOLLO_SV_00000008 a rdfs:Class ;
rdfs:label "software development"@en ;
rdfs:comment "A planned process that has specified output a software product and that involves the creation of source code."@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:SO_1000011 a rdfs:Class ;
rdfs:label "C_to_T_transition" ;
rdfs:comment "A transition of a cytidine to a thymine." ;
rdfs:subClassOf obo:SO_1000010 .
obo:GENO_0000953 a rdfs:Class ;
rdfs:label "sex-limited autosomal recessive inheritance"@en ;
rdfs:comment "An autosomal recessive inheritance pattern wherein the trait manifests only in homozygotes, and in a sex-specific manner (i.e. only in males or only in females)." ;
rdfs:subClassOf obo:GENO_0000148 .
obo:GENO_0000772 a rdfs:Class ;
rdfs:label "obsolete unspecified" ;
rdfs:comment "A sequence attribute inhering in a feature whose identity is not specified." .
obo:GENO_0000922 a rdfs:Class ;
rdfs:label "biological sequence set"@en ;
rdfs:comment "A set of biological sequences." ;
rdfs:subClassOf obo:GENO_0000921 .
obo:OBI_0000112 a rdfs:Class ;
rdfs:label "specimen role"@en ;
rdfs:comment "a role borne by a material entity that is gained during a specimen collection process and that can be realized by use of the specimen in an investigation"@en ;
rdfs:subClassOf obo:BFO_0000023 .
obo:SO_1000173 a rdfs:Class ;
rdfs:label "tandem_duplication" ;
rdfs:comment "A duplication consisting of 2 identical adjacent regions." ;
rdfs:subClassOf obo:SO_1000035 .
obo:RO_0002533 a rdfs:Class ;
rdfs:label "sequence atomic unit" ;
rdfs:comment "Any individual unit of a collection of like units arranged in a linear order" ;
rdfs:subClassOf obo:RO_0002532 .
obo:OBI_0600037 a rdfs:Class ;
rdfs:label "cell culture splitting"@en ;
rdfs:comment "The act of taking part of a homogeneous cell culture and creating one or more additional separate cultures of similar qualities. input: cell_culture, output cell_culture min cardinality 2. part of cell culturing"@en ;
rdfs:subClassOf obo:OBI_0600014 .
obo:SO_0000105 a rdfs:Class ;
rdfs:label "chromosome arm"@en ;
rdfs:comment "A region of the chromosome between the centromere and the telomere. Human chromosomes have two arms, the p arm (short) and the q arm (long) which are separated from each other by the centromere." ;
rdfs:subClassOf obo:SO_0000830 .
obo:GENO_0000146 a rdfs:Class ;
rdfs:label "X-linked dominant inheritance" ;
rdfs:comment "An X-linked inheritance pattern wherein the trait manifests in heterozygotes." ;
rdfs:subClassOf obo:GENO_0000936 .
obo:NCBITaxon_7955 a rdfs:Class ;
rdfs:label "Danio rerio" ;
rdfs:subClassOf obo:NCBITaxon_117571 .
obo:OBI_0200175 a rdfs:Class ;
rdfs:label "class discovery data transformation"@en ;
rdfs:comment "A class discovery data transformation (sometimes called unsupervised classification) is a data transformation that has objective class discovery."@en ;
rdfs:subClassOf obo:OBI_0200000 .
obo:GENO_0000460 a rdfs:Class ;
rdfs:label "transgene part" ;
rdfs:comment "A structurally or functionally defined component of a transgene (e.g. a promoter, a region coding for a fluorescent protein tag, etc)" ;
rdfs:subClassOf obo:GENO_0000666 .
obo:CLO_0000031 a rdfs:Class ;
rdfs:label "cell line"@en , "细胞系"@zh ;
rdfs:comment """A cultured cell population that represents a genetically stable and homogenous population of cultured cells that shares a common propagation history (i.e. has been successively passaged together in culture).
""" ;
rdfs:subClassOf obo:GENO_0000904 , obo:OBI_0001905 .
obo:OBI_0200178 a rdfs:Class ;
rdfs:label "class discovery objective"@en ;
rdfs:comment "A class discovery objective (sometimes called unsupervised classification) is a data transformation objective where the aim is to organize input data (typically vectors of attributes) into classes, where the number of classes and their specifications are not known a priori. Depending on usage, the class assignment can be definite or probabilistic."@en ;
rdfs:subClassOf obo:OBI_0200166 .
obo:SO_0000248 a rdfs:Class ;
rdfs:label "sequence_length_variation" ;
rdfs:subClassOf obo:SO_1000002 .
obo:IAO_8000015 a rdfs:Class ;
rdfs:label "template generated ontology module"@en ;
rdfs:comment "An ontology module that is automatically generated from a template specification and fillers for slots in that template."@en ;
rdfs:seeAlso , , ;
rdfs:subClassOf obo:IAO_8000014 .
obo:GENO_0000780 a rdfs:Class ;
rdfs:label "DNA residue"@en ;
rdfs:subClassOf obo:GENO_0000779 .
obo:BFO_0000003 a rdfs:Class ;
rdfs:label "occurrent" ;
rdfs:comment "An entity that has temporal parts and that happens, unfolds or develops through time."@en ;
rdfs:subClassOf obo:BFO_0000001 .
obo:GENO_0000624 a rdfs:Class ;
rdfs:label "gpos50"@en ;
rdfs:subClassOf obo:GENO_0000619 .
obo:GENO_0000534 a rdfs:Class ;
rdfs:label "reagent-targeted gene subregion" ;
rdfs:comment "A region within a gene that is specifically targeted by a gene knockdown reagent, typically in virtue of bearing sequence complementary to the reagent." ;
rdfs:subClassOf obo:GENO_0000737 .
obo:NCBITaxon_33213 a rdfs:Class ;
rdfs:label "Bilateria" ;
rdfs:subClassOf obo:NCBITaxon_33208 .
obo:GENO_0000506 a rdfs:Class ;
rdfs:label "transiently-expressed transgene" ;
rdfs:comment "A transgene that is delivered as part of a DNA expression construct into a cell or organism in order to transiently express a specified product (i.e. it has not integrated into the host genome)." ;
rdfs:subClassOf obo:GENO_0000529 .
obo:RO_0002532 a rdfs:Class ;
rdfs:label "sequentially ordered entity" ;
rdfs:comment "Any entity that is ordered in discrete units along a linear axis." .
obo:GENO_0000939 a rdfs:Class ;
rdfs:label "co-dominant X-linked inheritance"@en ;
rdfs:comment "An X-linked dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." ;
rdfs:subClassOf obo:GENO_0000146 .
obo:OBI_0100051 a rdfs:Class ;
rdfs:label "specimen"@en ;
rdfs:comment "A material entity that has the specimen role."@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:GENO_0000106 a rdfs:Class ;
rdfs:label "genomic material" ;
rdfs:comment "A nucleic acid macromolecule that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or is capable of being replicated and inherited through successive generations of progeny." ;
rdfs:subClassOf obo:GENO_0000482 .
obo:GENO_0000324 a rdfs:Class ;
rdfs:label "obsolete chromosome complement" ;
rdfs:comment "A single locus complement that represents the collection of all chromosome sequences for a given chromosome in a single genome" .
obo:GENO_0000642 a rdfs:Class ;
rdfs:label "selectable marker transgene"@en ;
rdfs:comment "A transgene whose product is used as a selectable marker." ;
rdfs:subClassOf obo:SO_0000804 , obo:SO_0000902 .
obo:GENO_0000719 a rdfs:Class ;
rdfs:label "intrinsic genotype"@en ;
rdfs:comment """1. A genomic genotype is a short-hand specification of a genome that uses a representational syntax comprised of information about a reference genome ('genomic background'), and all specific variants from this reference (the 'genomic variation complement'). Conceptually, this variant genome sequence can be resolved by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the reference 'genomic background' sequence.
2. 'Heritable' genomic sequence is that which is passed on to subsequent generations of cells/organisms, and includes all chromosomal sequences, the mitochondrial genome, and any transmissable extrachromosomal replicons.""" ;
rdfs:subClassOf obo:GENO_0000536 .
obo:GENO_0000645 a rdfs:Class ;
rdfs:label "genomic genotype (sex-qualified)"@en ;
rdfs:comment "A genomic genotype where the genomic background specifies a male or female sex chromosome complement." ;
rdfs:subClassOf obo:GENO_0000899 .
obo:SO_0001745 a rdfs:Class ;
rdfs:label "maternal_uniparental_disomy" ;
rdfs:comment "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the mother and no copies of the same chromosome or region from the father." ;
rdfs:subClassOf obo:SO_0001744 .
obo:GENO_0000659 a rdfs:Class ;
rdfs:label "sequence feature set"@en ;
rdfs:comment "A set of sequence features." ;
rdfs:subClassOf obo:GENO_0000701 .
obo:OBI_0000456 a rdfs:Class ;
rdfs:label "material transformation objective"@en ;
rdfs:comment "an objective specifiction that creates an specific output object from input materials."@en ;
rdfs:subClassOf obo:IAO_0000005 .
obo:PCO_0000000 a rdfs:Class ;
rdfs:label "collection of organisms" ;
rdfs:comment "A material entity that consists of two or more organisms, viruses, or viroids." ;
rdfs:subClassOf obo:GENO_0000904 .
obo:GENO_0000625 a rdfs:Class ;
rdfs:label "gpos25"@en ;
rdfs:subClassOf obo:GENO_0000619 .
obo:OBI_0200179 a rdfs:Class ;
rdfs:label "class prediction objective"@en ;
rdfs:comment """A class prediction objective (sometimes called supervised classification) is a data transformation objective where the aim is to create a predictor from training data through a machine learning technique. The training data consist of pairs of objects (typically vectors of attributes) and
class labels for these objects. The resulting predictor can be used to attach class labels to any valid novel input object. Depending on usage, the prediction can be definite or probabilistic. A classification is learned from the training data and can then be tested on test data."""@en ;
rdfs:subClassOf obo:OBI_0200166 .
obo:GENO_0000170 a rdfs:Class ;
rdfs:label "obsolete targeted genetic insertion technique" .
obo:GENO_0000391 a rdfs:Class ;
rdfs:label "disomic zygosity" ;
rdfs:comment "A zygosity quality inhering in a 'single locus complement' in a genome with a normal ploidy of two (i.e. two copies of autosomal chromosomes). Disomic zygosity terms describe the degree of similarity of the two sequence features that reside at a particular location across homozygous chromosomes (or the state of being the only feature at a given locus in the case of hemizygosity)." ;
rdfs:subClassOf obo:GENO_0000133 .
obo:SO_0000694 a rdfs:Class ;
rdfs:label "SNP" ;
rdfs:comment "SNPs are single base pair positions in genomic DNA at which different sequence alternatives exist in normal individuals in some population(s), wherein the least frequent variant has an abundance of 1% or greater." ;
rdfs:subClassOf obo:SO_0001483 .
obo:GENO_0000621 a rdfs:Class ;
rdfs:label "gvar"@en ;
rdfs:subClassOf obo:GENO_0000618 .
obo:BFO_0000031 a rdfs:Class ;
rdfs:label "generically dependent continuant" ;
rdfs:comment "A continuant that is dependent on one or other independent continuant bearers. For every instance of A requires some instance of (an independent continuant type) B but which instance of B serves can change from time to time."@en ;
rdfs:subClassOf obo:BFO_0000002 .
obo:IAO_8000020 a rdfs:Class ;
rdfs:label "EL++ ontology module"@en ;
rdfs:subClassOf obo:IAO_8000019 .
obo:SO_0001477 a rdfs:Class ;
rdfs:label "gene_trap_construct"@en ;
rdfs:comment "A construct which is designed to integrate into a genome and produce a fusion transcript between exons of the gene into which it inserts and a reporter element in the construct. Gene traps contain a splice acceptor, do not contain promoter elements for the reporter, and are mutagenic. Gene traps may be bicistronic with the second cassette containing a promoter driving an a selectable marker." ;
rdfs:subClassOf obo:GENO_0000856 .
obo:SO_0001013 a rdfs:Class ;
rdfs:label "MNP" ;
rdfs:comment "A multiple nucleotide polymorphism with alleles of common length > 1, for example AAA/TTT." ;
rdfs:subClassOf obo:SO_1000002 .
obo:GENO_0000928 a rdfs:Class ;
rdfs:label "clonal"@en ;
rdfs:comment "A cellular distribuution in which an allele is found only in some clonal subset of cells in an organism, typically in virtue of its somatic origin." ;
rdfs:subClassOf obo:GENO_0000926 .
obo:SO_1000026 a rdfs:Class ;
rdfs:label "G_to_C_transversion" ;
rdfs:comment "A transversion from guanine to cytidine." ;
rdfs:subClassOf obo:SO_1000023 .
obo:GENO_0000632 a rdfs:Class ;
rdfs:label "gpos66" ;
rdfs:subClassOf obo:GENO_0000619 .
obo:GENO_0000614 a rdfs:Class ;
rdfs:label "chromosomal region"@en ;
rdfs:comment "An extended part of a chromosome representing a term of convenience in order to hierarchically organize morphologically defined chromosome features: chromosome > arm > region > band > sub-band." ;
rdfs:subClassOf obo:SO_0000830 .
obo:OBI_0200000 a rdfs:Class ;
rdfs:label "data transformation"@en ;
rdfs:comment "A planned process that produces output data from input data."@en ;
rdfs:subClassOf obo:OBI_0000011 .
obo:GENO_0000482 a rdfs:Class ;
rdfs:label "genetic material"@en ;
rdfs:comment "A nucleic acid molecule that contains one or more sequences serving as a template for gene expression in a biological system (ie a cell or virion)." ;
rdfs:subClassOf obo:CHEBI_33696 .
obo:HsapDv_0000000 a rdfs:Class ;
rdfs:label "human life cycle stage"@en ;
rdfs:subClassOf obo:GENO_0000351 .
obo:OBI_0000659 a rdfs:Class ;
rdfs:label "specimen collection process" ;
rdfs:comment "A planned process with the objective of collecting a specimen." ;
rdfs:subClassOf obo:OBI_0000011 .
obo:GENO_0000135 a rdfs:Class ;
rdfs:label "heterozygous" ;
rdfs:comment "A zygosity quality inhering in a 'single locus complement' where the copies of the feature at this location have at least one difference in sequence (in a eukaryotic diploid genome, this means having two distinct alleles on each of the two homologous chromosomes, one inherited from each parent)." ;
rdfs:subClassOf obo:GENO_0000391 .
obo:GENO_0000019 a rdfs:Class ;
rdfs:label "obsolete sequence feature collection" ;
rdfs:comment "a collection more than one sequence features (ie a collection of discontinuous sequence features)" .
obo:GENO_0000491 a rdfs:Class ;
rdfs:label "obsolete mutant allele" ;
rdfs:comment "An allele that is variant with respect to some wild-type allele, in virtue of its being very rare in a population (typically <1%), or being an experimentally-induced alteration that derives from a wild-type feature in a given strain." .
obo:GENO_0000651 a rdf:Property ;
rdfs:label "is_mutant_allele_of"@en ;
rdfs:comment "A relation between a mutant allele (ie rare variant present in less than 1% of a population, or an experimentally-altered variant such as a knocked-out gene in a model organism), and the gene it is a variant of." ;
rdfs:domain obo:GENO_0000491 ;
rdfs:range ;
rdfs:subPropertyOf obo:GENO_0000641 .
obo:GENO_0000779 a rdfs:Class ;
rdfs:label "biological sequence unit"@en ;
rdfs:subClassOf obo:GENO_0000702 .
a rdfs:Class ;
rdfs:comment "An unconstrained type or object" .
obo:SO_0000165 a rdfs:Class ;
rdfs:label "enhancer" ;
rdfs:subClassOf obo:SO_0005836 .
obo:SO_1000008 a rdfs:Class ;
rdfs:label "point_mutation" ;
rdfs:comment "A single nucleotide change which has occurred at the same position of a corresponding nucleotide in a reference sequence." ;
rdfs:subClassOf obo:SO_0001483 .
obo:IAO_0000005 a rdfs:Class ;
rdfs:label "objective specification"@en ;
rdfs:comment "A directive information entity that describes an intended process endpoint. When part of a plan specification the concretization is realized in a planned process in which the bearer tries to effect the world so that the process endpoint is achieved."@en ;
rdfs:subClassOf obo:IAO_0000033 .
obo:GENO_0000777 a rdfs:Class ;
rdfs:label "variant genomic genotype"@en ;
rdfs:comment "An intrinsic genotype that specifies variation from a defined reference genome." ;
rdfs:subClassOf obo:GENO_0000899 .
obo:IAO_8000008 a rdfs:Class ;
rdfs:label "analysis subset ontology module"@en ;
rdfs:comment "An ontology module that is intended for usage in analysis or discovery applications."@en ;
rdfs:subClassOf obo:IAO_8000006 .
obo:OBI_0000727 a rdfs:Class ;
rdfs:label "k-nearest neighbors"@en ;
rdfs:comment "A k-nearest neighbors is a data transformation which achieves a class discovery or partitioning objective, in which an input data object with vector y is assigned to a class label based upon the k closest training data set points to y; where k is the largest value that class label is assigned."@en ;
rdfs:subClassOf obo:APOLLO_SV_00000796 , obo:OBI_0200171 , obo:OBI_0200175 .
obo:SO_1000019 a rdfs:Class ;
rdfs:label "C_to_A_transversion" ;
rdfs:comment "A transversion from cytidine to adenine." ;
rdfs:subClassOf obo:SO_1000018 .
obo:GENO_0000883 a rdfs:Class ;
rdfs:label "obsolete gametic" ;
rdfs:comment "a quality inhering in a feature in virtue of its presence only in the genome of gametes (germ cells)." .
obo:GENO_0000879 a rdfs:Class ;
rdfs:label "paternal allele origin"@en ;
rdfs:comment "Describes an allele that is inherited from a male parent in virtue of the allele being present in the father's sperm." ;
rdfs:subClassOf obo:GENO_0000888 .
obo:SO_0000577 a rdfs:Class ;
rdfs:label "centromere"@en ;
rdfs:subClassOf obo:SO_0000830 .
obo:GENO_0000874 a rdfs:Class ;
rdfs:label "repeat region alteration"@en ;
rdfs:subClassOf obo:SO_0001059 .
obo:NCBITaxon_40674 a rdfs:Class ;
rdfs:label "Mammalia" ;
rdfs:subClassOf obo:NCBITaxon_32524 .
obo:GENO_0000575 a rdfs:Class ;
rdfs:label "zebrafish phenotype" ;
rdfs:comment """ZFIN do not annotate with a pre-composed phenotype ontology - all annotations compose phenotypes on-the-fly using a combination of PATO, ZFA, GO and other ontologies. So while there is no manually curated zebrafish phenotype ontology, the Upheno pipeline generates one automatically here: http://purl.obolibrary.org/obo/upheno/zp.owl
This ontology does not have a root 'phenotype' class, however, and so we generate our own in GENO as a stub placeholder for import of needed zebrafish phenotype classes.""" ;
rdfs:subClassOf obo:UPHENO_0001001 .
obo:GENO_0000492 a rdfs:Class ;
rdfs:label "mutation"@en ;
rdfs:comment "A sequence alteration that is very rare allele in a population (typically <1%), or an experimentally-induced variation that derives from a wild-type feature in a given strain." ;
rdfs:subClassOf obo:SO_0001059 .
obo:GENO_0000160 a rdfs:Class ;
rdfs:label "unspecified life cycle stage" ;
rdfs:subClassOf obo:UBERON_0000105 .
obo:GENO_0000788 a rdfs:Class ;
rdfs:label "sequence feature attribute" ;
rdfs:comment "An attribute, quality, or state of a sequence feature or collection." ;
rdfs:subClassOf obo:BFO_0000020 .
obo:GENO_0000603 a rdfs:Class ;
rdfs:label "heteroplasmic"@en ;
rdfs:comment "an allelic state where more than one type of allele exists at a particular location in the organellar genome (mitochondrial or plastid) of a cell/organism." ;
rdfs:subClassOf obo:GENO_0000918 .
obo:GENO_0000975 a rdfs:Class ;
rdfs:label "uniparental allele origin"@en ;
rdfs:comment "Describes an allele that is part of an allelic complement where both alleles are inherited from the same parent." ;
rdfs:subClassOf obo:GENO_0000974 .
obo:GENO_0000889 a rdfs:Class ;
rdfs:label "undetermined inheritance" ;
rdfs:comment "An inheritance pattern that is not determined or not known." ;
rdfs:subClassOf obo:GENO_0000141 .
obo:OBI_0000086 a rdfs:Class ;
rdfs:label "reagent role"@en ;
rdfs:comment "A role inhering in a biological or chemical entity that is intended to be applied in a scientific technique to participate (or have molecular components that participate) in a chemical reaction that facilitates the generation of data about some entity distinct from the bearer, or the generation of some specified material output distinct from the bearer."@en ;
rdfs:subClassOf obo:BFO_0000023 .
obo:SO_1000022 a rdfs:Class ;
rdfs:label "T_to_G_transversion" ;
rdfs:comment "A transversion from T to G." ;
rdfs:subClassOf obo:SO_1000018 .
obo:GENO_0000346 a rdfs:Class ;
rdfs:label "aneusomic chromosome" ;
rdfs:comment "A complete chromosome that has been abnormally duplicated, or the absense of a chromosome that has been lost, typically as the result of a non-disjunction event or unbalanced translocation" ;
rdfs:subClassOf obo:SO_0000340 , obo:SO_0001059 .
obo:IAO_0000179 a rdfs:Class ;
rdfs:label "histogram"@en ;
rdfs:comment """A histogram is a report graph which is a statistical description of a
distribution in terms of occurrence frequencies of different event classes."""@en ;
rdfs:subClassOf obo:IAO_0000038 .
obo:GENO_0000737 a rdfs:Class ;
rdfs:label "expression-qualified sequence feature"@en ;
rdfs:comment "A sequence feature whose identity is additionally dependent on factors specifically influencing its level of expression in the context of a biological system (e.g. being targeted by gene-knockdown reagents, or driven from exogneous expression system like recombinant construct)" ;
rdfs:subClassOf obo:GENO_0000714 .
obo:SO_0000340 a rdfs:Class ;
rdfs:label "chromosome" ;
rdfs:comment "Structural unit composed of a nucleic acid molecule which controls its own replication through the interaction of specific proteins at one or more origins of replication." ;
rdfs:subClassOf obo:GENO_0000481 .
obo:GENO_0000722 a rdfs:Class ;
rdfs:label "amino acid sequence"@en ;
rdfs:subClassOf obo:GENO_0000702 .
obo:NCBITaxon_10239 a rdfs:Class ;
rdfs:label "Viruses" ;
rdfs:comment "Stub class to serve as root of hierarchy for imports of virus types from relevant ontologies or terminologies." ;
rdfs:subClassOf obo:OBI_0100026 .
obo:IAO_0000027 a rdfs:Class ;
rdfs:label "data item"@en ;
rdfs:comment "An information content entity that is intended to be a truthful statement about something (modulo, e.g., measurement precision or other systematic errors) and is constructed/acquired by a method which reliably tends to produce (approximately) truthful statements."@en ;
rdfs:subClassOf obo:IAO_0000030 .
obo:GENO_0000936 a rdfs:Class ;
rdfs:label "X-linked inheritance"@en ;
rdfs:comment "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on an X-chromosome." ;
rdfs:subClassOf obo:GENO_0000935 .
obo:NCBITaxon_2 a rdfs:Class ;
rdfs:label "Bacteria" ;
rdfs:subClassOf obo:OBI_0100026 .
obo:OBI_0002076 a rdfs:Class ;
rdfs:label "collection of specimens"@en ;
rdfs:comment "A material entity that has two or more specimens as its parts."@en ;
rdfs:subClassOf obo:BFO_0000040 .
obo:NCBITaxon_32524 a rdfs:Class ;
rdfs:label "Amniota" ;
rdfs:subClassOf obo:NCBITaxon_32523 .
obo:GENO_0000458 a rdfs:Class ;
rdfs:label "simple heterozygous" ;
rdfs:comment "a heterozygous quality inhering in a single locus complement comprised of one variant allele and one wild-type/reference allele (e.g.fgf8a)" ;
rdfs:subClassOf obo:GENO_0000135 .
obo:IAO_0000310 a rdfs:Class ;
rdfs:label "document"@en ;
rdfs:comment "A collection of information content entities intended to be understood together as a whole"@en ;
rdfs:subClassOf obo:IAO_0000030 .
obo:GENO_0000165 a rdfs:Class ;
rdfs:label "obsolete mutagen treatment technique" .
a rdf:Property ;
rdfs:label "location"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000708 .
a rdf:Property ;
rdfs:label "position"@en ;
rdfs:comment "The position value is the offset along the reference where this position is found. Thus the only the position value in combination with the reference determines where a position is." ;
rdfs:range .
a rdf:Property ;
rdfs:label "reference (faldo)" ;
rdfs:comment "The reference is the resource that the position value is anchored to. For example, a contig or chromosome in a genome assembly." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000708 .
obo:GENO_0000211 a rdf:Property ;
rdfs:label "bears_concretization_of" ;
rdfs:comment "A relation between a material information bearer or material genetic sequence bearer and generically dependent continuant that carries information or sequence content that the bearer encodes" ;
rdfs:range .
obo:GENO_0000220 a rdf:Property ;
rdfs:label "is_genotype_of" ;
rdfs:range .
obo:GENO_0000222 a rdf:Property ;
rdfs:label "has_genotype" ;
rdfs:comment "A relationship that holds between a biological entity and some level of genetic variation present in its genome." ;
rdfs:range .
obo:GENO_0000242 a rdf:Property ;
rdfs:label "obsolete_specifies" ;
rdfs:comment "A relationship between an information content entity representing a specification, and the entity it specifies." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000243 a rdf:Property ;
rdfs:label "obsolete_approximates_sequence" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000244 a rdf:Property ;
rdfs:label "obsolete_resolves_to_sequence" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000252 a rdf:Property ;
rdfs:label "is_subject_of" ;
rdfs:range .
obo:GENO_0000253 a rdf:Property ;
rdfs:label "obsolete_is_specified_by" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000359 a rdf:Property ;
rdfs:label "obsolete_is_phenotype_of_genotype" ;
rdfs:comment "shortcut relation used to link a phenotype directly to a genotype of an organism" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000368 a rdf:Property ;
rdfs:label "obsolete_participates_in_inheritance_process" ;
rdfs:comment "A relation to link variant loci, phenotypes, or disease to the type of inheritance process they are involved in, based on how the genetic interactions between alleles at the causative locus determine the pattern of inheritance of a specific phenotype/disease from one generation to the next." ;
rdfs:range obo:GENO_0000141 ;
rdfs:subPropertyOf .
obo:GENO_0000383 a rdf:Property ;
rdfs:label "is_variant_part_of"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000655 .
obo:GENO_0000387 a rdf:Property ;
rdfs:label "is_reference_part_of" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000655 .
obo:GENO_0000410 a rdf:Property ;
rdfs:label "obsolete_is_genetic_variant_of" ;
rdfs:comment "A relation used to link a variant locus instance to the gene class it is a variant of (in terms of its sequence or expression level)." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000411 a rdf:Property ;
rdfs:label "obsolete_has_genetic_variant" ;
rdfs:comment "A relation linking a gene class to a sequence-varaint or expression-variant of the gene." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000413 a rdf:Property ;
rdfs:label "has_allele" ;
rdfs:comment "A relation linking a gene class to one of its sequence-variant alleles." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000445 .
obo:GENO_0000414 a rdf:Property ;
rdfs:label "targets_gene" ;
rdfs:comment "A relation between a gene targeting reagent (e.g. a morpholino or RNAi) and the class of gene it targets." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000418 .
obo:GENO_0000418 a rdf:Property ;
rdfs:label "has_affected_feature" ;
rdfs:comment "A relation that holds between an instance of a geneetic variation and a genomic feature (typically a gene class) that is affected in its sequence or expression." ;
rdfs:range .
obo:GENO_0000445 a rdf:Property ;
rdfs:label "is_feature_affected_by" ;
rdfs:comment "A relation between a genomic feature class (typically a gene class) and an instance of a sequence feature or qualified sequence feature that represents or affects some change in the sequence or expression of the genomic feature." ;
rdfs:range .
obo:GENO_0000449 a rdf:Property ;
rdfs:label "has_expression_variant" ;
rdfs:comment "A relation linking a gene class to one of an expression-variant of that gene.." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000445 .
obo:GENO_0000486 a rdf:Property ;
rdfs:label "obsolete_is_variant_with"@en ;
rdfs:comment "A relation between two sequence features at a given genomic locus that vary in their sequence or level of expression." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000488 a rdf:Property ;
rdfs:label "obsolete_is_expression_variant_with"@en ;
rdfs:comment "A relation between two instances of a given gene that vary in their level of expression as a result of external factors influencing expression (e.g. gnee-knockdown reagents, epigenetic modification, alteration of endogenous gene-regulation pathways)." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000626 a rdf:Property ;
rdfs:label "has_staining_intensity" ;
rdfs:comment "Used to link a gross chromosomal sequence feature (chromosome part) to a color value quality that inheres in the sequence feature in virtue of the staining pattern of the chromosomal DNA in which the sequence is materialized." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000207 .
obo:GENO_0000634 a rdf:Property ;
rdfs:label "is_targeted_by"@en ;
rdfs:comment "relation between an molecular agent and its molecular target" ;
rdfs:range .
obo:GENO_0000639 a rdf:Property ;
rdfs:label "sequence_derives_from"@en ;
rdfs:comment "Relationship between a sequence feature and a distinct, non-overlapping feature from which it derives part or all of its sequence." ;
rdfs:range .
obo:GENO_0000654 a rdf:Property ;
rdfs:label "has_sequence_part"@en ;
rdfs:comment "An organizational class to hold relations of parthood between sequences/features." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:GENO_0000655 a rdf:Property ;
rdfs:label "is_sequence_part_of"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:BFO_0000050 .
obo:GENO_0000661 a rdf:Property ;
rdfs:label "is_sex_agnostic_part_of"@en ;
rdfs:comment "Relationship between an intrinsic genotype and a sex-qualified genotype, created specifically to support propagation of phenotypes asserted on the latter to the former for Monarch Initiative use cases." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000655 .
obo:GENO_0000708 a rdf:Property ;
rdfs:label "faldo properties"@en ;
rdfs:comment "organizational property to hold imports from faldo." ;
rdfs:range .
obo:GENO_0000712 a rdf:Property ;
rdfs:label "ObsoleteDataProperty"@en ;
rdfs:range .
obo:GENO_0000740 a rdf:Property ;
rdfs:label "has_inferred_phenotype"@en ;
rdfs:range .
obo:GENO_0000741 a rdf:Property ;
rdfs:label "obsolete_has_regulatory_part"@en ;
rdfs:comment "Proposal for a property linking variants to smaller components that are regulatory, and therefore should not inherit phenotypes." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000742 a rdf:Property ;
rdfs:label "obsolete_is_alteration_within"@en ;
rdfs:comment "A relation linking a sequence_alteration to the gene it alters." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000743 a rdf:Property ;
rdfs:label "has_asserted_phenotype"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002200 .
obo:GENO_0000761 a rdf:Property ;
rdfs:label "is_regulatory_part_of"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000655 .
obo:GENO_0000767 a rdf:Property ;
rdfs:label "obsolete_has_position_component"@en ;
rdfs:comment "A relation linking a sequence feature to its component Position that represents an identifying criteria for sequence feature instances." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf .
obo:GENO_0000790 a rdf:Property ;
rdfs:label "related_condition"@en ;
rdfs:range .
obo:GENO_0000791 a rdf:Property ;
rdfs:label "inferred_to_cause_condition"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000790 .
obo:GENO_0000793 a rdf:Property ;
rdfs:label "inferred_to_contribute_to_condition"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000790 .
obo:GENO_0000794 a rdf:Property ;
rdfs:label "inferred_to_correlate_with_condition"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000790 .
obo:GENO_0000834 a rdf:Property ;
rdfs:label "is_identity_criteria"@en ;
rdfs:comment "Used to annotation axioms that define identity criteria for instances of a class." ;
rdfs:range xsd:boolean .
obo:GENO_0000840 a rdf:Property ;
rdfs:label "pathogenic_for_condition"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0003303 .
obo:GENO_0000841 a rdf:Property ;
rdfs:label "likely_pathogenic_for_condition"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0003303 .
obo:GENO_0000842 a rdf:Property ;
rdfs:label "non-causal_for_condition"@en ;
rdfs:comment "Relation between an entity and a condition (disease, phenotype) which it does not cause or contribute to." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000790 .
obo:GENO_0000843 a rdf:Property ;
rdfs:label "benign_for_condition"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000842 .
obo:GENO_0000844 a rdf:Property ;
rdfs:label "likely_benign_for_condition"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000842 .
obo:GENO_0000845 a rdf:Property ;
rdfs:label "has_uncertain_significance_for_condition"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000790 .
obo:GENO_0000846 a rdf:Property ;
rdfs:label "has_qualifying_process"@en ;
rdfs:comment "A relation used to describe a process contextualizing the identity of an entity." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000580 .
obo:GENO_0000847 a rdf:Property ;
rdfs:label "has_qualifying_environment"@en ;
rdfs:comment "A relation used to describe an environment contextualizing the identity of an entity." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000580 .
obo:GENO_0000849 a rdf:Property ;
rdfs:label "is_candidate_variant_for"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:GENO_0000790 .
obo:GENO_0000866 a rdf:Property ;
rdfs:label "has_quantifier"@en ;
rdfs:comment "Property to link an assertion or association with some value quantifying its relevance or ranking." ;
rdfs:range .
obo:GENO_0000867 a rdf:Property ;
rdfs:label "proabalistic_quantifier"@en ;
rdfs:range xsd:string .
obo:GENO_0000894 a rdf:Property ;
rdfs:label "start_position" ;
rdfs:comment "The starting position of a sequence feature or interval." ;
rdfs:range .
obo:GENO_0000895 a rdf:Property ;
rdfs:label "end_position" ;
rdfs:comment "The ending position of a sequence feature or interval." ;
rdfs:range .
obo:GENO_0000905 a rdf:Property ;
rdfs:label "mixin"@en ;
rdfs:comment "Used to flag terms that are created for organizational purposes, e.g. to support groupings useful for defining GENO-based data models." ;
rdfs:range xsd:boolean .
obo:GENO_0000906 a rdf:Property ;
rdfs:label "on strand"@en ;
rdfs:comment "Can be used to a genomic feature to the chromosomal strand it resides on in the genome (+ or - strand, or both strands). Commonly used to link a gene to the strand it is transcribed from." ;
rdfs:range .
obo:GENO_0000909 a rdf:Property ;
rdfs:label "gene symbol"@en ;
rdfs:range xsd:string .
obo:GENO_0000967 a rdf:Property ;
rdfs:label "has_reference_sequence" ;
rdfs:comment "Relates a 'sequence feature location' to a sequence that it is anchored to." ;
rdfs:range .
obo:IAO_0000111 a rdf:Property ;
rdfs:label "editor preferred label" ;
rdfs:comment "The concise, meaningful, and human-friendly name for a class or property preferred by the ontology developers. (US-English)"@en ;
rdfs:range xsd:string .
obo:IAO_0000112 a rdf:Property ;
rdfs:label "example of usage" ;
rdfs:comment "A phrase describing how a term should be used and/or a citation to a work which uses it. May also include other kinds of examples that facilitate immediate understanding, such as widely know prototypes or instances of a class, or cases where a relation is said to hold."@en ;
rdfs:range xsd:string .
obo:IAO_0000113 a rdf:Property ;
rdfs:label "in branch"@en ;
rdfs:comment "An annotation property indicating which module the terms belong to. This is currently experimental and not implemented yet."@en ;
rdfs:range xsd:string .
obo:IAO_0000114 a rdf:Property ;
rdfs:label "has curation status"@en ;
rdfs:range xsd:string .
obo:IAO_0000115 a rdf:Property ;
rdfs:label "textual definition" ;
rdfs:comment "The official OBI definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions."@en ;
rdfs:range xsd:string .
obo:IAO_0000116 a rdf:Property ;
rdfs:label "editor note"@en ;
rdfs:comment "An administrative note intended for its editor. It may not be included in the publication version of the ontology, so it should contain nothing necessary for end users to understand the ontology."@en ;
rdfs:range xsd:string .
obo:IAO_0000117 a rdf:Property ;
rdfs:label "term editor"@en ;
rdfs:comment "Name of editor entering the term in the file. The term editor is a point of contact for information regarding the term. The term editor may be, but is not always, the author of the definition, which may have been worked upon by several people"@en ;
rdfs:range xsd:string .
obo:IAO_0000118 a rdf:Property ;
rdfs:label "alternative label"@en ;
rdfs:comment "A label for a class or property that can be used to refer to the class or property instead of the preferred rdfs:label. Alternative labels should be used to indicate community- or context-specific labels, abbreviations, shorthand forms and the like."@en ;
rdfs:range xsd:string .
obo:IAO_0000119 a rdf:Property ;
rdfs:label "definition source"@en ;
rdfs:comment "Formal citation, e.g. identifier in external database to indicate / attribute source(s) for the definition. Free text indicate / attribute source(s) for the definition. EXAMPLE: Author Name, URI, MeSH Term C04, PUBMED ID, Wiki uri on 31.01.2007"@en ;
rdfs:range xsd:string .
obo:IAO_0000231 a rdf:Property ;
rdfs:label "has obsolescence reason"@en ;
rdfs:comment "Relates an annotation property to an obsolescence reason. The values of obsolescence reasons come from a list of predefined terms, instances of the class obsolescence reason specification."@en ;
rdfs:range xsd:string .
obo:IAO_0000232 a rdf:Property ;
rdfs:label "curator note"@en ;
rdfs:comment "An administrative note of use for a curator but of no use for a user"@en ;
rdfs:range xsd:string .
obo:IAO_0000233 a rdf:Property ;
rdfs:label "term tracker item"@en ;
rdfs:comment "An IRI or similar locator for a request or discussion of an ontology term."@en ;
rdfs:range xsd:string .
obo:IAO_0000234 a rdf:Property ;
rdfs:label "ontology term requester"@en ;
rdfs:comment "The name of the person, project, or organization that motivated inclusion of an ontology term by requesting its addition."@en ;
rdfs:range xsd:string .
obo:IAO_0000411 a rdf:Property ;
rdfs:label "is denotator type"@en ;
rdfs:comment "Relates an class defined in an ontology, to the type of it's denotator"@en ;
rdfs:range xsd:string .
obo:IAO_0000412 a rdf:Property ;
rdfs:label "imported from"@en ;
rdfs:comment "For external terms/classes, the ontology from which the term was imported"@en ;
rdfs:range xsd:string .
obo:IAO_0000424 a rdf:Property ;
rdfs:label "expand expression to"@en ;
rdfs:comment "A macro expansion tag applied to an object property (or possibly a data property) which can be used by a macro-expansion engine to generate more complex expressions from simpler ones"@en ;
rdfs:range xsd:string .
obo:IAO_0000425 a rdf:Property ;
rdfs:label "expand assertion to"@en ;
rdfs:comment "A macro expansion tag applied to an annotation property which can be expanded into a more detailed axiom."@en ;
rdfs:range xsd:string .
obo:IAO_0000426 a rdf:Property ;
rdfs:label "first order logic expression"@en ;
rdfs:range xsd:string .
obo:IAO_0000427 a rdf:Property ;
rdfs:label "antisymmetric property"@en ;
rdfs:comment "Use boolean value xsd:true to indicate that the property is an antisymmetric property"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:OMO_0001001 .
obo:IAO_0000589 a rdf:Property ;
rdfs:label "OBO foundry unique label"@en ;
rdfs:comment "An alternative name for a class or property which is unique across the OBO Foundry."@en ;
rdfs:range xsd:string .
obo:IAO_0000596 a rdf:Property ;
rdfs:label "has ID digit count"@en ;
rdfs:comment "Relates an ontology used to record id policy to the number of digits in the URI. The URI is: the 'has ID prefix\" annotation property value concatenated with an integer in the id range (left padded with \"0\"s to make this many digits)"@en ;
rdfs:range xsd:string .
obo:IAO_0000597 a rdf:Property ;
rdfs:label "has ID range allocated to"@en ;
rdfs:comment "Relates a datatype that encodes a range of integers to the name of the person or organization who can use those ids constructed in that range to define new terms"@en ;
rdfs:range xsd:string .
obo:IAO_0000598 a rdf:Property ;
rdfs:label "has ID policy for"@en ;
rdfs:comment "Relating an ontology used to record id policy to the ontology namespace whose policy it manages"@en ;
rdfs:range xsd:string .
obo:IAO_0000599 a rdf:Property ;
rdfs:label "has ID prefix"@en ;
rdfs:comment "Relates an ontology used to record id policy to a prefix concatenated with an integer in the id range (left padded with \"0\"s to make this many digits) to construct an ID for a term being created."@en ;
rdfs:range xsd:string .
obo:IAO_0000600 a rdf:Property ;
rdfs:label "elucidation"@en ;
rdfs:range xsd:string .
obo:IAO_0000601 a rdf:Property ;
rdfs:label "has associated axiom(nl)"@en ;
rdfs:range xsd:string .
obo:IAO_0000602 a rdf:Property ;
rdfs:label "has associated axiom(fol)"@en ;
rdfs:range xsd:string .
obo:IAO_0000603 a rdf:Property ;
rdfs:label "is allocated id range"@en ;
rdfs:comment "Relates an ontology IRI to an (inclusive) range of IRIs in an OBO name space. The range is give as, e.g. \"IAO_0020000-IAO_0020999\""@en ;
rdfs:range xsd:string .
obo:IAO_0000700 a rdf:Property ;
rdfs:label "has ontology root term"@en ;
rdfs:comment "Ontology annotation property. Relates an ontology to a term that is a designated root term of the ontology. Display tools like OLS can use terms annotated with this property as the starting point for rendering the ontology class hierarchy. There can be more than one root."@en ;
rdfs:range xsd:string .
obo:IAO_0006011 a rdf:Property ;
rdfs:label "may be identical to"@en ;
rdfs:comment "A annotation relationship between two terms in an ontology that may refer to the same (natural) type but where more evidence is required before terms are merged."@en ;
rdfs:range xsd:string .
obo:IAO_0006012 a rdf:Property ;
rdfs:label "scheduled for obsoletion on or after"@en ;
rdfs:comment "Used when the class or object is scheduled for obsoletion/deprecation on or after a particular date."@en ;
rdfs:range xsd:dateTime .
obo:IAO_0010000 a rdf:Property ;
rdfs:label "has axiom label"@en ;
rdfs:range xsd:string .
obo:IAO_0100001 a rdf:Property ;
rdfs:label "term replaced by"@en ;
rdfs:comment "Use on obsolete terms, relating the term to another term that can be used as a substitute"@en ;
rdfs:range xsd:string .
obo:OBI_0000295 a rdf:Property ;
rdfs:label "is_specified_input_of"@en ;
rdfs:comment "A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of."@en ;
rdfs:range obo:OBI_0000011 ;
rdfs:subPropertyOf obo:RO_0000056 .
obo:OMO_0001001 a rdf:Property ;
rdfs:label "logical characteristic of object property" ;
rdfs:comment "This is an annotation used on an object property to indicate a logical characterstic beyond what is possible in OWL." ;
rdfs:range xsd:string .
obo:OMO_0002000 a rdf:Property ;
rdfs:label "defined by construct" ;
rdfs:comment "Links an annotation property to a SPARQL CONSTRUCT query which is meant to provide semantics for a shortcut relation." ;
rdfs:range xsd:string .
obo:RO_0000053 a rdf:Property ;
rdfs:label "has characteristic"@en ;
rdfs:comment "a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence" ;
rdfs:range obo:BFO_0000020 .
obo:RO_0000080 a rdf:Property ;
rdfs:label "quality of"@en ;
rdfs:comment "a relation between a quality and an independent continuant (the bearer), in which the quality specifically depends on the bearer for its existence"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0000052 .
obo:RO_0000081 a rdf:Property ;
rdfs:label "role of"@en ;
rdfs:comment "a relation between a role and an independent continuant (the bearer), in which the role specifically depends on the bearer for its existence"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0000052 .
obo:RO_0000086 a rdf:Property ;
rdfs:label "has quality" ;
rdfs:comment "a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence" ;
rdfs:range obo:BFO_0000019 ;
rdfs:subPropertyOf obo:RO_0000053 .
obo:RO_0000092 a rdf:Property ;
rdfs:label "disposition of"@en ;
rdfs:comment "inverse of has disposition" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0000052 .
obo:RO_0001001 a rdf:Property ;
rdfs:label "derives into"@en ;
rdfs:comment "a relation between two distinct material entities, the old entity and the new entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity"@en ;
rdfs:range .
obo:RO_0002013 a rdf:Property ;
rdfs:label "has regulatory component activity" ;
rdfs:comment "A 'has regulatory component activity' B if A and B are GO molecular functions (GO_0003674), A has_component B and A is regulated by B." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002334 , obo:RO_0002017 .
obo:RO_0002014 a rdf:Property ;
rdfs:label "has negative regulatory component activity" ;
rdfs:comment "A relationship that holds between a GO molecular function and a component of that molecular function that negatively regulates the activity of the whole. More formally, A 'has regulatory component activity' B iff :A and B are GO molecular functions (GO_0003674), A has_component B and A is negatively regulated by B." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002335 , obo:RO_0002013 .
obo:RO_0002015 a rdf:Property ;
rdfs:label "has positive regulatory component activity" ;
rdfs:comment "A relationship that holds between a GO molecular function and a component of that molecular function that positively regulates the activity of the whole. More formally, A 'has regulatory component activity' B iff :A and B are GO molecular functions (GO_0003674), A has_component B and A is positively regulated by B." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002336 , obo:RO_0002013 .
obo:RO_0002017 a rdf:Property ;
rdfs:label "has component activity" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002018 .
obo:RO_0002022 a rdf:Property ;
rdfs:label "directly regulated by" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002334 .
obo:RO_0002023 a rdf:Property ;
rdfs:label "directly negatively regulated by" ;
rdfs:comment "Process(P2) is directly negatively regulated by process(P1) iff: P1 negatively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding negatively regulates the kinase activity (P2) of protein B then P2 directly negatively regulated by P1." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002022 .
obo:RO_0002024 a rdf:Property ;
rdfs:label "directly positively regulated by" ;
rdfs:comment "Process(P2) is directly postively regulated by process(P1) iff: P1 positively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding positively regulates the kinase activity (P2) of protein B then P2 is directly postively regulated by P1." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002022 .
obo:RO_0002025 a rdf:Property ;
rdfs:label "has effector activity" ;
rdfs:comment "A 'has effector activity' B if A and B are GO molecular functions (GO_0003674), A 'has component activity' B and B is the effector (output function) of B. Each compound function has only one effector activity." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002017 .
obo:RO_0002084 a rdf:Property ;
rdfs:label "during which ends"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002222 .
obo:RO_0002086 a rdf:Property ;
rdfs:label "ends after"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002222 .
obo:RO_0002087 a rdf:Property ;
rdfs:label "immediately preceded by"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:BFO_0000062 .
obo:RO_0002088 a rdf:Property ;
rdfs:label "during which starts"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002222 .
obo:RO_0002090 a rdf:Property ;
rdfs:label "immediately precedes"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:BFO_0000063 .
obo:RO_0002093 a rdf:Property ;
rdfs:label "ends during" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002222 .
obo:RO_0002131 a rdf:Property ;
rdfs:label "overlaps"@en ;
rdfs:comment "x overlaps y if and only if there exists some z such that x has part z and z part of y" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002323 .
obo:RO_0002180 a rdf:Property ;
rdfs:label "has component"@en ;
rdfs:comment "w 'has component' p if w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:BFO_0000051 .
obo:RO_0002203 a rdf:Property ;
rdfs:label "develops into"@en ;
rdfs:comment "inverse of develops from" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002387 , obo:RO_0002388 , obo:RO_0002286 .
obo:RO_0002212 a rdf:Property ;
rdfs:label "negatively regulates"@en ;
rdfs:comment "p negatively regulates q iff p regulates q, and p decreases the rate or magnitude of execution of q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002305 , obo:RO_0002211 .
obo:RO_0002213 a rdf:Property ;
rdfs:label "positively regulates"@en ;
rdfs:comment "p positively regulates q iff p regulates q, and p increases the rate or magnitude of execution of q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002304 , obo:RO_0002211 .
obo:RO_0002216 a rdf:Property ;
rdfs:label "capable of part of"@en ;
rdfs:comment "c stands in this relationship to p if and only if there exists some p' such that c is capable_of p', and p' is part_of p." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002500 , obo:RO_0002328 .
obo:RO_0002234 a rdf:Property ;
rdfs:label "has output"@en ;
rdfs:comment "p has output c iff c is a participant in p, c is present at the end of p, and c is not present in the same state at the beginning of p." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0000057 .
obo:RO_0002255 a rdf:Property ;
rdfs:label "developmentally contributes to"@en ;
rdfs:comment "inverse of has developmental contribution from" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002385 , obo:RO_0002286 .
obo:RO_0002263 a rdf:Property ;
rdfs:label "acts upstream of" ;
rdfs:comment "c acts upstream of p if and only if c enables some f that is involved in p' and p' occurs chronologically before p, is not part of p, and affects the execution of p. c is a material entity and f, p, p' are processes." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002264 .
obo:RO_0002264 a rdf:Property ;
rdfs:label "acts upstream of or within" ;
rdfs:comment "c acts upstream of or within p if c is enables f, and f is causally upstream of or within p. c is a material entity and p is an process." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002500 .
obo:RO_0002286 a rdf:Property ;
rdfs:label "developmentally succeeded by"@en ;
rdfs:comment "Inverse of developmentally preceded by" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002384 .
obo:RO_0002297 a rdf:Property ;
rdfs:label "results in formation of anatomical entity"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002295 , obo:RO_0002234 .
obo:RO_0002304 a rdf:Property ;
rdfs:label "causally upstream of, positive effect" ;
rdfs:comment "p is causally upstream of, positive effect q iff p is casually upstream of q, and the execution of p is required for the execution of q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0004047 , obo:RO_0002411 .
obo:RO_0002305 a rdf:Property ;
rdfs:label "causally upstream of, negative effect" ;
rdfs:comment "p is causally upstream of, negative effect q iff p is casually upstream of q, and the execution of p decreases the execution of q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0004046 , obo:RO_0002411 .
obo:RO_0002314 a rdf:Property ;
rdfs:label "characteristic of part of"@en ;
rdfs:comment "q characteristic of part of w if and only if there exists some p such that q inheres in p and p part of w." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002502 .
obo:RO_0002320 a rdf:Property ;
rdfs:label "evolutionarily related to"@en ;
rdfs:comment "A relationship that holds via some environmental process" ;
rdfs:range .
obo:RO_0002323 a rdf:Property ;
rdfs:label "mereotopologically related to"@en ;
rdfs:comment "A mereological relationship or a topological relationship" ;
rdfs:range .
obo:RO_0002324 a rdf:Property ;
rdfs:label "developmentally related to"@en ;
rdfs:comment "A relationship that holds between entities participating in some developmental process (GO:0032502)" ;
rdfs:range .
obo:RO_0002327 a rdf:Property ;
rdfs:label "enables"@en ;
rdfs:comment "c enables p iff c is capable of p and c acts to execute p." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002215 .
obo:RO_0002328 a rdf:Property ;
rdfs:label "functionally related to"@en ;
rdfs:comment "A grouping relationship for any relationship directly involving a function, or that holds because of a function of one of the related entities." ;
rdfs:range .
obo:RO_0002329 a rdf:Property ;
rdfs:label "part of structure that is capable of"@en ;
rdfs:comment "this relation holds between c and p when c is part of some c', and c' is capable of p." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002328 .
obo:RO_0002331 a rdf:Property ;
rdfs:label "involved in"@en ;
rdfs:comment "c involved_in p if and only if c enables some process p', and p' is part of p" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002431 , obo:RO_0000056 .
obo:RO_0002333 a rdf:Property ;
rdfs:label "enabled by"@en ;
rdfs:comment "inverse of enables" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002328 , obo:RO_0000057 .
obo:RO_0002335 a rdf:Property ;
rdfs:label "negatively regulated by"@en ;
rdfs:comment "inverse of negatively regulates" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002334 .
obo:RO_0002336 a rdf:Property ;
rdfs:label "positively regulated by"@en ;
rdfs:comment "inverse of positively regulates" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002334 .
obo:RO_0002350 a rdf:Property ;
rdfs:label "is member of" ;
rdfs:comment "is member of is a mereological relation between a item and a collection." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:BFO_0000050 .
obo:RO_0002352 a rdf:Property ;
rdfs:label "input of"@en ;
rdfs:comment "inverse of has input" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002328 , obo:RO_0000056 .
obo:RO_0002353 a rdf:Property ;
rdfs:label "output of"@en ;
rdfs:comment "inverse of has output" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002328 , obo:RO_0000056 .
obo:RO_0002354 a rdf:Property ;
rdfs:label "formed as result of"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf , obo:RO_0002353 .
obo:RO_0002385 a rdf:Property ;
rdfs:label "has potential to developmentally contribute to"@en ;
rdfs:comment "x has potential to developmentrally contribute to y iff x developmentally contributes to y or x is capable of developmentally contributing to y"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002384 .
obo:RO_0002387 a rdf:Property ;
rdfs:label "has potential to develop into"@en ;
rdfs:comment "x has the potential to develop into y iff x develops into y or if x is capable of developing into y"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002384 .
obo:RO_0002388 a rdf:Property ;
rdfs:label "has potential to directly develop into"@en ;
rdfs:comment "x has potential to directly develop into y iff x directly develops into y or x is capable of directly developing into y"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002387 .
obo:RO_0002404 a rdf:Property ;
rdfs:label "causally downstream of"@en ;
rdfs:comment "inverse of upstream of" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002427 , obo:BFO_0000062 .
obo:RO_0002405 a rdf:Property ;
rdfs:label "immediately causally downstream of"@en ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002404 , obo:RO_0002087 .
obo:RO_0002407 a rdf:Property ;
rdfs:label "indirectly positively regulates"@en ;
rdfs:comment "p indirectly positively regulates q iff p is indirectly causally upstream of q and p positively regulates q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0012012 , obo:RO_0002213 .
obo:RO_0002409 a rdf:Property ;
rdfs:label "indirectly negatively regulates"@en ;
rdfs:comment "p indirectly negatively regulates q iff p is indirectly causally upstream of q and p negatively regulates q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0012012 , obo:RO_0002212 .
obo:RO_0002410 a rdf:Property ;
rdfs:label "causally related to"@en ;
rdfs:comment "relation that links two events, processes, states, or objects such that one event, process, state, or object (a cause) contributes to the production of another event, process, state, or object (an effect) where the cause is partly or wholly responsible for the effect, and the effect is partly or wholly dependent on the cause." ;
rdfs:range .
obo:RO_0002411 a rdf:Property ;
rdfs:label "causally upstream of"@en ;
rdfs:comment "p is causally upstream of q iff p is causally related to q, the end of p precedes the end of q, and p is not an occurrent part of q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002418 , obo:BFO_0000063 .
obo:RO_0002412 a rdf:Property ;
rdfs:label "immediately causally upstream of"@en ;
rdfs:comment "p is immediately causally upstream of q iff p is causally upstream of q, and the end of p is coincident with the beginning of q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002411 , obo:RO_0002090 .
obo:RO_0002413 a rdf:Property ;
rdfs:label "provides input for"@en ;
rdfs:comment "p provides input for q iff p is immediately causally upstream of q, and there exists some c such that p has_output c and q has_input c." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002414 , obo:RO_0002412 .
obo:RO_0002418 a rdf:Property ;
rdfs:label "causally upstream of or within" ;
rdfs:comment "p is 'causally upstream or within' q iff p is causally related to q, and the end of p precedes, or is coincident with, the end of q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002501 .
obo:RO_0002427 a rdf:Property ;
rdfs:label "causally downstream of or within" ;
rdfs:comment "inverse of causally upstream of or within" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002501 .
obo:RO_0002428 a rdf:Property ;
rdfs:label "involved in regulation of" ;
rdfs:comment "c involved in regulation of p if c is involved in some p' and p' regulates some p" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002431 , obo:RO_0002263 .
obo:RO_0002429 a rdf:Property ;
rdfs:label "involved in positive regulation of" ;
rdfs:comment "c involved in regulation of p if c is involved in some p' and p' positively regulates some p" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002428 .
obo:RO_0002430 a rdf:Property ;
rdfs:label "involved in negative regulation of" ;
rdfs:comment "c involved in regulation of p if c is involved in some p' and p' negatively regulates some p" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002428 .
obo:RO_0002431 a rdf:Property ;
rdfs:label "involved in or involved in regulation of" ;
rdfs:comment "c involved in or regulates p if and only if either (i) c is involved in p or (ii) c is involved in regulation of p" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002328 , obo:RO_0002500 , obo:RO_0002264 .
obo:RO_0002436 a rdf:Property ;
rdfs:label "molecularly interacts with" ;
rdfs:comment "An interaction relationship in which the two partners are molecular entities that directly physically interact with each other for example via a stable binding interaction or a brief interaction during which one modifies the other." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002434 .
obo:RO_000244 a rdf:Property ;
rdfs:label "molecularly controls"@en ;
rdfs:comment "Holds between molecular entities a and b when the execution of a activates or inhibits the activity of b" ;
rdfs:range .
obo:RO_0002447 a rdf:Property ;
rdfs:label "phosphorylates" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002436 .
obo:RO_0002464 a rdf:Property ;
rdfs:label "helper property (not for use in curation)" ;
rdfs:range .
obo:RO_0002481 a rdf:Property ;
rdfs:label "is kinase activity" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002564 .
obo:RO_0002500 a rdf:Property ;
rdfs:label "causal agent in process" ;
rdfs:comment "A relationship between a material entity and a process where the material entity has some causal role that influences the process" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002595 .
obo:RO_0002502 a rdf:Property ;
rdfs:label "depends on" ;
rdfs:range .
obo:RO_0002522 a rdf:Property ;
rdfs:label "bounds sequence of" ;
rdfs:comment "x bounds the sequence of y iff the upstream-most part of x is upstream of or coincident with the upstream-most part of y, and the downstream-most part of x is downstream of or coincident with the downstream-most part of y" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002514 , obo:GENO_0000654 .
obo:RO_0002523 a rdf:Property ;
rdfs:label "is bound by sequence of" ;
rdfs:comment "inverse of bounds sequence of" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002514 .
obo:RO_0002526 a rdf:Property ;
rdfs:label "overlaps sequence of" ;
rdfs:comment "x overlaps the sequence of y if and only if x has a subsequence z and z is a subsequence of y." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002514 , obo:RO_0002131 .
obo:RO_0002527 a rdf:Property ;
rdfs:label "does not overlap sequence of" ;
rdfs:comment "x does not overlap the sequence of y if and only if there is no z such that x has a subsequence z and z is a subsequence of y." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002514 .
obo:RO_0002528 a rdf:Property ;
rdfs:label "is upstream of sequence of" ;
rdfs:comment "inverse of downstream of sequence of" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002527 .
obo:RO_0002529 a rdf:Property ;
rdfs:label "is downstream of sequence of" ;
rdfs:comment "x is downstream of the sequence of y iff either (1) x and y have sequence units, and all units of x are downstream of all units of y, or (2) x and y are sequence units, and x is either immediately downstream of y, or transitively downstream of y." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002527 .
obo:RO_0002559 a rdf:Property ;
rdfs:label "causally influenced by" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002506 .
obo:RO_0002563 a rdf:Property ;
rdfs:label "interaction relation helper property" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002464 .
obo:RO_0002564 a rdf:Property ;
rdfs:label "molecular interaction relation helper property" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002563 .
obo:RO_0002578 a rdf:Property ;
rdfs:label "directly regulates" ;
rdfs:comment "p directly regulates q iff p is immediately causally upstream of q and p regulates q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002412 , obo:RO_0002211 .
obo:RO_0002584 a rdf:Property ;
rdfs:label "has part structure that is capable of" ;
rdfs:comment "s 'has part structure that is capable of' p if and only if there exists some part x such that s 'has part' x and x 'capable of' p" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002595 , obo:RO_0002328 .
obo:RO_0002596 a rdf:Property ;
rdfs:label "capable of regulating" ;
rdfs:comment "Holds between c and p if and only if c is capable of some activity a, and a regulates p." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002500 .
obo:RO_0002597 a rdf:Property ;
rdfs:label "capable of negatively regulating" ;
rdfs:comment "Holds between c and p if and only if c is capable of some activity a, and a negatively regulates p." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002596 .
obo:RO_0002598 a rdf:Property ;
rdfs:label "capable of positively regulating" ;
rdfs:comment "Holds between c and p if and only if c is capable of some activity a, and a positively regulates p." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002596 .
obo:RO_0002608 a rdf:Property ;
rdfs:label "process has causal agent" ;
rdfs:comment "Inverse of 'causal agent in process'" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002410 .
obo:RO_0002610 a rdf:Property ;
rdfs:label "correlated with" ;
rdfs:comment "A relationship that holds between two entities, where the entities exhibit a statistical dependence relationship. The entities may be statistical variables, or they may be other kinds of entities such as diseases, chemical entities or processes." ;
rdfs:range .
obo:RO_0002615 a rdf:Property ;
rdfs:label "has model" ;
rdfs:comment "Inverse of is-model-of" ;
rdfs:range .
obo:RO_0002629 a rdf:Property ;
rdfs:label "directly positively regulates" ;
rdfs:comment "p directly positively regulates q iff p is immediately causally upstream of q, and p positively regulates q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002578 , obo:RO_0002213 .
obo:RO_0002630 a rdf:Property ;
rdfs:label "directly negatively regulates" ;
rdfs:comment "p directly negatively regulates q iff p is immediately causally upstream of q, and p negatively regulates q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002578 , obo:RO_0002212 .
obo:RO_0003301 a rdf:Property ;
rdfs:label "is model of"@en ;
rdfs:comment "Relation between a research artifact and an entity it is used to study, in virtue of its replicating or approximating features of the studied entity." ;
rdfs:range .
obo:RO_0003302 a rdf:Property ;
rdfs:label "causes or contributes to condition"@en ;
rdfs:comment "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has some causal or contributing role that influences the condition." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002410 , obo:GENO_0000790 .
obo:RO_0003303 a rdf:Property ;
rdfs:label "causes condition"@en ;
rdfs:comment "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity has some causal role for the condition." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0003302 .
obo:RO_0003304 a rdf:Property ;
rdfs:label "contributes to condition"@en ;
rdfs:comment "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has some contributing role in the manifestation of the condition." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0003302 .
obo:RO_0003305 a rdf:Property ;
rdfs:label "contributes to severity of condition"@en ;
rdfs:comment "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity influences the severity with which a condition manifests in an individual." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0003304 .
obo:RO_0003306 a rdf:Property ;
rdfs:label "contributes to frequency of condition"@en ;
rdfs:comment "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity influences the frequency of the condition in a population." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0003304 .
obo:RO_0003307 a rdf:Property ;
rdfs:label "ameliorates condition"@en ;
rdfs:comment "A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity prevents or reduces the severity of a condition." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0003305 , obo:GENO_0000790 .
obo:RO_0003308 a rdf:Property ;
rdfs:label "correlated with condition"@en ;
rdfs:comment "A relationship between an entity and a condition (phenotype or disease) with which it exhibits a statistical dependence relationship." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002610 , obo:GENO_0000790 .
obo:RO_0004031 a rdf:Property ;
rdfs:label "enables subfunction" ;
rdfs:comment "Holds between an entity and an process P where the entity enables some larger compound process, and that larger process has-part P." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002328 .
obo:RO_0004032 a rdf:Property ;
rdfs:label "acts upstream of or within, positive effect" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002264 .
obo:RO_0004033 a rdf:Property ;
rdfs:label "acts upstream of or within, negative effect" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002264 .
obo:RO_0004034 a rdf:Property ;
rdfs:label "acts upstream of, positive effect" ;
rdfs:comment "c 'acts upstream of, positive effect' p if c is enables f, and f is causally upstream of p, and the direction of f is positive" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0004032 , obo:RO_0002263 .
obo:RO_0004035 a rdf:Property ;
rdfs:label "acts upstream of, negative effect" ;
rdfs:comment "c 'acts upstream of, negative effect' p if c is enables f, and f is causally upstream of p, and the direction of f is negative" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0004033 , obo:RO_0002263 .
obo:RO_0004046 a rdf:Property ;
rdfs:label "causally upstream of or within, negative effect" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002418 .
obo:RO_0004047 a rdf:Property ;
rdfs:label "causally upstream of or within, positive effect" ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002418 .
obo:RO_0012011 a rdf:Property ;
rdfs:label "indirectly causally upstream of"@en ;
rdfs:comment "p is indirectly causally upstream of q iff p is causally upstream of q and there exists some process r such that p is causally upstream of r and r is causally upstream of q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0002411 .
obo:RO_0012012 a rdf:Property ;
rdfs:label "indirectly regulates"@en ;
rdfs:comment "p indirectly regulates q iff p is indirectly causally upstream of q and p regulates q." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0012011 , obo:RO_0002211 .
obo:RO_0016001 a rdf:Property ;
rdfs:label "has phenotype or disease" ;
rdfs:range .
obo:RO_0017001 a rdf:Property ;
rdfs:label "device utilizes material"@en ;
rdfs:comment "X device utilizes material Y means X and Y are material entities, and X is capable of some process P that has input Y." ;
rdfs:range .
obo:RO_0019001 a rdf:Property ;
rdfs:label "positively regulates characteristic" ;
rdfs:comment "A relationship that holds between a process and a characteristic in which process (P) positively regulates characteristic (C) iff: P results in an increase in the intensity or magnitude of C." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0019000 .
obo:RO_0019002 a rdf:Property ;
rdfs:label "negatively regulates characteristic" ;
rdfs:comment "A relationship that holds between a process and a characteristic in which process (P) negatively regulates characteristic (C) iff: P results in a decrease in the intensity or magnitude of C." ;
rdfs:range xsd:string ;
rdfs:subPropertyOf obo:RO_0019000 .
a rdf:Property ;
rdfs:label "agr_zyg" ;
rdfs:comment "Set of zygosity terms for the Alliance of Genome Resources, used for AGM metadata" ;
rdfs:range xsd:string .
a rdf:Property ;
rdfs:label "association has predicate"@en ;
rdfs:range .
a rdf:Property ;
rdfs:label "association has subject"@en ;
rdfs:range .
a rdf:Property ;
rdfs:range .
obo:OBI_0002310 a rdfs:Class ;
rdfs:label "pathologic distant metastases stage for ovary according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002311 a obo:OBI_0002310 ;
rdfs:label "cM0 (ovary)" ;
rdfs:comment "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is no distant metastasis." .
obo:OBI_0002312 a obo:OBI_0002310 ;
rdfs:label "cM1 (ovary)" ;
rdfs:comment "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is distant metastasis except peritoneal metastasis based on clinical assessment." .
obo:OBI_0002313 a obo:OBI_0002310 ;
rdfs:label "pM1 (ovary)" ;
rdfs:comment "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is distant metastasis except peritoneal metastasis that is histologically confirmed." .
obo:OBI_0002314 a rdfs:Class ;
rdfs:label "clinical tumor stage group according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is an assessment of the stage of a cancer according to the American Joint Committee on Cancer (AJCC) v7 staging systems." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002315 a obo:OBI_0002314 ;
rdfs:label "Occult Carcinoma (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating a small carcinoma, either asymptomatic or giving rise to metastases without symptoms due to the primary carcinoma." .
obo:OBI_0002316 a obo:OBI_0002314 ;
rdfs:label "Stage 0 (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating a carcinoma in situ (or melanoma in situ for melanoma of the skin or germ cell neoplasia in situ for testicular germ cell tumors) and generally is considered to have no metastatic potential. " .
obo:OBI_0002317 a obo:OBI_0002314 ;
rdfs:label "Stage I (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers that are smaller or less deeply invasive without regional disease or nodes." .
obo:OBI_0002318 a obo:OBI_0002314 ;
rdfs:label "Stage IIA (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIB and IIC." .
obo:OBI_0002319 a obo:OBI_0002314 ;
rdfs:label "Stage IIB (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIA and IIC." .
obo:OBI_0002320 a obo:OBI_0002314 ;
rdfs:label "Stage IIC (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIA and IIB." .
obo:OBI_0002321 a obo:OBI_0002314 ;
rdfs:label "Stage IIIA (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIB and IIIC." .
obo:OBI_0002322 a obo:OBI_0002314 ;
rdfs:label "Stage IIIB (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIA and IIIC." .
obo:OBI_0002323 a obo:OBI_0002314 ;
rdfs:label "Stage IIIC (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIA and IIIB." .
obo:OBI_0002324 a obo:OBI_0002314 ;
rdfs:label "Stage IVA (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers in patients who present with distant metastases at diagnosis and with differing characteristics from IVB." .
obo:OBI_0002325 a obo:OBI_0002314 ;
rdfs:label "Stage IVB (AJCC 7th)" ;
rdfs:comment "A clinical tumor stage group according to AJCC 7th edition indicating cancers in patients who present with distant metastases at diagnosis and with differing characteristics from IVA." .
obo:OBI_0002341 a rdfs:Class ;
rdfs:label "International Federation of Gynecology and Obstetrics ovarian cancer stage value specification" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the FIGO classification system." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002342 a obo:OBI_0002341 ;
rdfs:label "Stage 1 (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1, N0, and M0." .
obo:OBI_0002343 a obo:OBI_0002341 ;
rdfs:label "Stage 1A (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1a, N0, and M0." .
obo:OBI_0002344 a obo:OBI_0002341 ;
rdfs:label "Stage 1B (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1b, N0, and M0." .
obo:OBI_0002345 a obo:OBI_0002341 ;
rdfs:label "Stage 1C (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1c, N0, and M0." .
obo:OBI_0002346 a obo:OBI_0002341 ;
rdfs:label "Stage 2 (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2, N0, and M0." .
obo:OBI_0002347 a obo:OBI_0002341 ;
rdfs:label "Stage 2A (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2a, N0, and M0." .
obo:OBI_0002348 a obo:OBI_0002341 ;
rdfs:label "Stage 2B (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2b, N0, and M0." .
obo:OBI_0002349 a obo:OBI_0002341 ;
rdfs:label "Stage 2C (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2c, N0, and M0." .
obo:OBI_0002350 a obo:OBI_0002341 ;
rdfs:label "Stage 3 (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T3, N0, and M0) or (T3,3a,3b, NX, and M0)." .
obo:OBI_0002351 a obo:OBI_0002341 ;
rdfs:label "Stage 3A (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T3a, N0, and M0 ." .
obo:OBI_0002352 a obo:OBI_0002341 ;
rdfs:label "Stage 3B (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T3b, N0, and M0 ." .
obo:OBI_0002353 a obo:OBI_0002341 ;
rdfs:label "Stage 3C (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T3c, N0,X and M0) or (any T, N1 and M0)." .
obo:OBI_0002354 a obo:OBI_0002341 ;
rdfs:label "Stage 4 (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of any T, any N, and M1." .
obo:OBI_0002355 a obo:OBI_0002341 ;
rdfs:label "Stage Unknown (FIGO)" ;
rdfs:comment "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T0, N0, and M0) or (T1,1a-1c,2,2a-2c, NX, and M0) or (TX, N0,X, M0)." .
obo:OBI_0002287 a rdfs:Class ;
rdfs:label "pathologic lymph node stage for ovary according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002288 a obo:OBI_0002287 ;
rdfs:label "pN0 (ovary)" ;
rdfs:comment "A pathologic lymph node stage for ovary according to AJCC 7th edition indicating that there is no regional lymph node metastasis." .
obo:OBI_0002289 a obo:OBI_0002287 ;
rdfs:label "pN1 (ovary)" ;
rdfs:comment "A pathologic lymph node stage for ovary according to AJCC 7th edition indicating that there is regional lymph node metastasis." .
obo:UO_0000105 a rdfs:Class ;
rdfs:label "frequency unit" ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000106 a obo:UO_0000105 ;
rdfs:label "hertz" ;
rdfs:comment "A frequency unit which is equal to 1 complete cycle of a recurring phenomenon in 1 second." .
obo:OBI_0002224 a rdfs:Class ;
rdfs:label "pathologic primary tumor stage for colon and rectum according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of colorectal cancer following the rules of the TNM American Joint Committee on Cancer (AJCC) version 7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002225 a obo:OBI_0002224 ;
rdfs:label "pT0 (colon)" ;
rdfs:comment "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that there is no evidence of primary tumor." .
obo:OBI_0002226 a obo:OBI_0002224 ;
rdfs:label "pTis (colon)" ;
rdfs:comment "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating carcinoma in situ (intraepithelial or invasion of lamina propria)." .
obo:OBI_0002227 a obo:OBI_0002224 ;
rdfs:label "pT1 (colon)" ;
rdfs:comment "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades submucosa." .
obo:OBI_0002228 a obo:OBI_0002224 ;
rdfs:label "pT2 (colon)" ;
rdfs:comment "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades muscularis propria." .
obo:OBI_0002229 a obo:OBI_0002224 ;
rdfs:label "pT3 (colon)" ;
rdfs:comment "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades subserosa or into non-peritionealized pericolic or perirectal tissues." .
obo:OBI_0002230 a obo:OBI_0002224 ;
rdfs:label "pT4a (colon)" ;
rdfs:comment "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor perforates visceral peritoneum." .
obo:OBI_0002231 a obo:OBI_0002224 ;
rdfs:label "pT4b (colon)" ;
rdfs:comment "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor directly invades other organs or structures." .
obo:OBI_0002357 a rdfs:Class ;
rdfs:label "Eastern Cooperative Oncology Group score value specification" ;
rdfs:comment "A performance status value specification designed by the Eastern Cooperative Oncology Group to assess disease progression and its affect on the daily living abilities of the patient." ;
rdfs:subClassOf obo:OBI_0002356 .
obo:OBI_0002358 a obo:OBI_0002357 ;
rdfs:label "3: symptomatic in bed more than 50% of the day but not bed ridden" ;
rdfs:comment "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic and in bed for more than 50% of the day but is not bed ridden." .
obo:OBI_0002359 a obo:OBI_0002357 ;
rdfs:label "2: symptomatic but in bed less than 50% of the day" ;
rdfs:comment "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic but is in bed for less than 50% of the day." .
obo:OBI_0002360 a obo:OBI_0002357 ;
rdfs:label "4: bed ridden" ;
rdfs:comment "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic and is bed ridden." .
obo:OBI_0002361 a obo:OBI_0002357 ;
rdfs:label "0: asymptomatic" ;
rdfs:comment "An Eastern Cooperative Oncology Group score value specification indicating a patient is asymptomatic." .
obo:OBI_0002362 a obo:OBI_0002357 ;
rdfs:label "1: symptomatic but fully ambulatory" ;
rdfs:comment "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic but is fully ambulatory." .
obo:OBI_0002290 a rdfs:Class ;
rdfs:label "pathologic distant metastases stage for colon according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of colon cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002291 a obo:OBI_0002290 ;
rdfs:label "cM0 (colon)" ;
rdfs:comment "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there are no symptoms or signs of distant metastasis." .
obo:OBI_0002292 a obo:OBI_0002290 ;
rdfs:label "cM1 (colon)" ;
rdfs:comment "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there is clinical evidence of distant metastases by history, physical examination, imaging studies, or invasive procedures, but without microscopic evidence of the presumed distant metastases." .
obo:OBI_0002293 a obo:OBI_0002290 ;
rdfs:label "cM1a (colon)" ;
rdfs:comment "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is confined to one organ based on clinical assessment." .
obo:OBI_0002294 a obo:OBI_0002290 ;
rdfs:label "cM1b (colon)" ;
rdfs:comment "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is in more than one organ or the peritoneum based on clinical assessment." .
obo:OBI_0002295 a obo:OBI_0002290 ;
rdfs:label "pM1 (colon)" ;
rdfs:comment "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there is microscopic evidence confirming distant metastatic disease." .
obo:OBI_0002296 a obo:OBI_0002290 ;
rdfs:label "pM1a (colon)" ;
rdfs:comment "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is confined to one organ and histologically confirmed." .
obo:OBI_0002297 a obo:OBI_0002290 ;
rdfs:label "pM1b (colon)" ;
rdfs:comment "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is in more than one organ or the peritoneum and histologically confirmed." .
obo:UO_0000005 a rdfs:Class ;
rdfs:label "temperature unit" ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000027 a obo:UO_0000005 ;
rdfs:label "degree Celsius" ;
rdfs:comment "A temperature unit which is equal to one kelvin degree. However, they have their zeros at different points. The centigrade scale has its zero at 273.15 K." .
obo:UO_0000195 a obo:UO_0000005 ;
rdfs:label "degree Fahrenheit" ;
rdfs:comment "A temperature unit which is equal to 5/9ths of a kelvin. Negative 40 degrees Fahrenheit is equal to negative 40 degrees Celsius." .
obo:OBI_0000963 a rdfs:Class ;
rdfs:label "categorical label" ;
rdfs:comment "A label that is part of a categorical datum and that indicates the value of the data item on the categorical scale." ;
rdfs:subClassOf obo:IAO_0000009 .
obo:OBI_0000958 a obo:OBI_0000963 ;
rdfs:label "right handed" .
obo:OBI_0000979 a obo:OBI_0000963 ;
rdfs:label "ambidexterous" .
obo:OBI_0000998 a obo:OBI_0000963 ;
rdfs:label "left handed" .
obo:OBI_0002279 a rdfs:Class ;
rdfs:label "pathologic lymph node stage for lung according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002280 a obo:OBI_0002279 ;
rdfs:label "pN0 (lung)" ;
rdfs:comment "A pathologic lymph node stage for lung according to AJCC 7th edition indicating no regional lymph node metastasis." .
obo:OBI_0002281 a obo:OBI_0002279 ;
rdfs:label "pN1 (lung)" ;
rdfs:comment "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in ipsilateral peribronchial and/or ipsilateral hilar lymph nodes and intrapulmonary nodes, including involvement by direct extension." .
obo:OBI_0002282 a obo:OBI_0002279 ;
rdfs:label "pN2 (lung)" ;
rdfs:comment "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in ipsilateral mediastinal and/or subcarinal lymph node(s)." .
obo:OBI_0002283 a obo:OBI_0002279 ;
rdfs:label "pN3 (lung)" ;
rdfs:comment "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in contralateral mediastinal, contralateral hilar, ipsilateral or contralateral scalene, or supraclavicular lymph node(s)." .
obo:OBI_0002219 a rdfs:Class ;
rdfs:label "histologic grade for ovarian tumor according to the World Health Organization" ;
rdfs:comment "A histologic grade for ovarian tumor that is from a histological classification by the World Health Organization (WHO)." ;
rdfs:subClassOf obo:OBI_0002215 .
obo:OBI_0002220 a obo:OBI_0002219 ;
rdfs:label "G1 (WHO)" ;
rdfs:comment "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is well differentiated." .
obo:OBI_0002221 a obo:OBI_0002219 ;
rdfs:label "G2 (WHO)" ;
rdfs:comment "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is moderately differentiated." .
obo:OBI_0002222 a obo:OBI_0002219 ;
rdfs:label "G3 (WHO)" ;
rdfs:comment "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is poorly differentiated." .
obo:OBI_0002223 a obo:OBI_0002219 ;
rdfs:label "G4 (WHO)" ;
rdfs:comment "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is undifferentiated." .
obo:OBI_0002306 a rdfs:Class ;
rdfs:label "pathologic distant metastases stage for kidney according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002307 a obo:OBI_0002306 ;
rdfs:label "cM0 (kidney)" ;
rdfs:comment "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there is no distant metastasis." .
obo:OBI_0002308 a obo:OBI_0002306 ;
rdfs:label "cM1 (kidney)" ;
rdfs:comment "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there are distant metastases based on clinical assessment." .
obo:OBI_0002309 a obo:OBI_0002306 ;
rdfs:label "pM1 (kidney)" ;
rdfs:comment "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed." .
obo:OBI_0002243 a rdfs:Class ;
rdfs:label "pathologic primary tumor stage for kidney according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002244 a obo:OBI_0002243 ;
rdfs:label "pT0 (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that there is no evidence of primary tumor." .
obo:OBI_0002245 a obo:OBI_0002243 ;
rdfs:label "pT1 (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is 7 cm or less in greatest dimension and limited to the kidney." .
obo:OBI_0002246 a obo:OBI_0002243 ;
rdfs:label "pT1a (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is 4 cm or less." .
obo:OBI_0002247 a obo:OBI_0002243 ;
rdfs:label "pT1b (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 4 cm but not more than 7 cm." .
obo:OBI_0002248 a obo:OBI_0002243 ;
rdfs:label "pT2 (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 7 cm in greatest dimension and limited to the kidney." .
obo:OBI_0002249 a obo:OBI_0002243 ;
rdfs:label "pT2a (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 7 cm but not more than 10 cm." .
obo:OBI_0002250 a obo:OBI_0002243 ;
rdfs:label "pT2b (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 10 cm and limited to the kidney." .
obo:OBI_0002251 a obo:OBI_0002243 ;
rdfs:label "pT3 (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor extends into major veins or perinephric tissues but not into the ipsilateral adrenal gland and not beyond the Gerota fascia." .
obo:OBI_0002252 a obo:OBI_0002243 ;
rdfs:label "pT3a (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into the renal vein or its segmental (muscle containing) branches, or the tumor invades perirenal and/or renal sinus fat (peripelvic) fat but not beyond Gerota fascia." .
obo:OBI_0002253 a obo:OBI_0002243 ;
rdfs:label "pT3b (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into vena cava below diaphragm." .
obo:OBI_0002254 a obo:OBI_0002243 ;
rdfs:label "pT3c (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into vena cava above the diaphragm or Invades the wall of the vena cava." .
obo:OBI_0002255 a obo:OBI_0002243 ;
rdfs:label "pT4 (kidney)" ;
rdfs:comment "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor invades beyond Gerota fascia (including contiguous extension into the ipsilateral adrenal gland)." .
obo:UO_0000280 a rdfs:Class ;
rdfs:label "rate unit" ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000281 a obo:UO_0000280 ;
rdfs:label "count per nanomolar second" ;
rdfs:comment "A rate unit which is equal to one over one nanomolar second." .
obo:UO_0000282 a obo:UO_0000280 ;
rdfs:label "count per molar second" ;
rdfs:comment "A rate unit which is equal to one over one molar second." .
obo:UO_0000284 a obo:UO_0000280 ;
rdfs:label "count per nanomolar" ;
rdfs:comment "A rate unit which is equal to one over one nanomolar." .
obo:UO_0000285 a obo:UO_0000280 ;
rdfs:label "count per molar" ;
rdfs:comment "A rate unit which is equal to one over one molar." .
obo:UO_0000006 a rdfs:Class ;
rdfs:label "substance unit" ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000039 a obo:UO_0000006 ;
rdfs:label "micromole" ;
rdfs:comment "A substance unit equal to a millionth of a mol or 10^[-6] mol." .
obo:UO_0000041 a obo:UO_0000006 ;
rdfs:label "nanomole" ;
rdfs:comment "A substance unit equal to one thousandth of one millionth of a mole or 10^[-9] mol." .
obo:UO_0000042 a obo:UO_0000006 ;
rdfs:label "picomole" ;
rdfs:comment "A substance unit equal to 10^[-12] mol." .
obo:IAO_0000409 a rdfs:Class ;
rdfs:label "denotator type"@en ;
rdfs:comment "A denotator type indicates how a term should be interpreted from an ontological perspective."@en ;
rdfs:subClassOf obo:IAO_0000102 .
obo:IAO_0000410 a obo:IAO_0000409 ;
rdfs:label "universal"@en .
obo:IAO_0000420 a obo:IAO_0000409 ;
rdfs:label "defined class"@en ;
rdfs:comment "A defined class is a class that is defined by a set of logically necessary and sufficient conditions but is not a universal"@en .
obo:IAO_0000421 a obo:IAO_0000409 ;
rdfs:label "named class expression"@en ;
rdfs:comment "A named class expression is a logical expression that is given a name. The name can be used in place of the expression."@en .
obo:OBI_0002216 a rdfs:Class ;
rdfs:label "histologic grade for ovarian tumor according to a two-tier grading system" ;
rdfs:comment "A histologic grade for ovarian tumor that is from a two-tier histological classification of tumors. " ;
rdfs:subClassOf obo:OBI_0002215 .
obo:OBI_0002217 a obo:OBI_0002216 ;
rdfs:label "Low grade ovarian tumor" ;
rdfs:comment "A histologic grade for ovarian tumor according to a two-tier grading system indicating that the tumor is low grade." .
obo:OBI_0002218 a obo:OBI_0002216 ;
rdfs:label "High grade ovarian tumor" ;
rdfs:comment "A histologic grade for ovarian tumor according to a two-tier grading system indicating that the tumor is high grade." .
obo:OBI_0000713 a rdfs:Class ;
rdfs:label "GenePattern software" ;
rdfs:comment "a software that provides access to more than 100 tools for gene expression analysis, proteomics, SNP analysis and common data processing tasks." ;
rdfs:subClassOf obo:IAO_0000010 .
obo:OBI_0000761 a obo:OBI_0000713 ;
rdfs:label "GenePattern module SVM" ;
rdfs:comment "GenePattern module SVM is a GenePattern software module which is used to run a support vector machine data transformation." .
obo:OBI_0000766 a obo:OBI_0000713 ;
rdfs:label "GenePattern module KMeansClustering" ;
rdfs:comment "GenePattern module KMeansClustering is a GenePattern software module which is used to perform a k Means clustering data transformation." .
obo:OBI_0000768 a obo:OBI_0000713 ;
rdfs:label "GenePattern module CARTXValidation" ;
rdfs:comment "GenePattern module CARTXValidation is a GenePattern software module which uses a CART decision tree induction with a leave one out cross validation data transformations." .
obo:OBI_0000771 a obo:OBI_0000713 ;
rdfs:label "GenePattern module KNNXValidation" ;
rdfs:comment "GenePattern module KNNXValidation is a GenePattern software module which uses a k-nearest neighbours clustering with a leave one out cross validation data transformations." .
obo:OBI_0000772 a obo:OBI_0000713 ;
rdfs:label "GenePattern module PeakMatch" .
obo:OBI_0000773 a obo:OBI_0000713 ;
rdfs:label "GenePattern module KNN" ;
rdfs:comment "GenePattern module KNN is a GenePattern software module which perform a k-nearest neighbors data transformation." .
obo:OBI_0000774 a obo:OBI_0000713 ;
rdfs:label "GenePattern module HierarchicalClustering" ;
rdfs:comment "GenePattern module HierarchicalClustering is a GenePattern software module which is used to perform a hierarchical clustering data transformation." .
obo:OBI_0000777 a obo:OBI_0000713 ;
rdfs:label "GenePattern module PCA" ;
rdfs:comment "GenePattern module PCA is a GenePattern software module which is used to perform a principal components analysis dimensionality reduction data transformation." .
obo:OBI_0000782 a obo:OBI_0000713 ;
rdfs:label "GenePattern module HeatMapViewer" ;
rdfs:comment "A GenePattern software module which is used to generate a heatmap view of data." .
obo:OBI_0000783 a obo:OBI_0000713 ;
rdfs:label "GenePattern module HierarchicalClusteringViewer" ;
rdfs:comment "A GenePattern software module which is used to generate a view of data that has been hierarchically clustered." .
obo:OBI_0002205 a rdfs:Class ;
rdfs:label "histologic grade according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a histologic grade assigned to a tumor slide specimen according to the American Joint Committee on Cancer (AJCC) 7th Edition grading system." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002206 a obo:OBI_0002205 ;
rdfs:label "G1: Well differentiated" ;
rdfs:comment "A histologic grade according to AJCC 7th edition indicating that the tumor cells and the organization of the tumor tissue appear close to normal." .
obo:OBI_0002207 a obo:OBI_0002205 ;
rdfs:label "G2: Moderately differentiated" ;
rdfs:comment "A histologic grade according to AJCC 7th edition indicating that the tumor cells are moderately differentiated and reflect an intermediate grade." .
obo:OBI_0002208 a obo:OBI_0002205 ;
rdfs:label "G3: Poorly differentiated" ;
rdfs:comment "A histologic grade according to AJCC 7th edition indicating that the tumor cells are poorly differentiated and do not look like normal cells and tissue." .
obo:OBI_0002209 a obo:OBI_0002205 ;
rdfs:label "G4: Undifferentiated" ;
rdfs:comment "A histologic grade according to AJCC 7th edition indicating that the tumor cells are undifferentiated and do not look like normal cells and tissue." .
obo:UO_0000003 a rdfs:Class ;
rdfs:label "time unit" ;
rdfs:comment "A unit which is a standard measure of the dimension in which events occur in sequence." ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000010 a obo:UO_0000003 ;
rdfs:label "second" ;
rdfs:comment "A time unit which is equal to the duration of 9 192 631 770 periods of the radiation corresponding to the transition between the two hyperfine levels of the ground state of the caesium 133 atom." .
obo:UO_0000031 a obo:UO_0000003 ;
rdfs:label "minute" ;
rdfs:comment "A time unit which is equal to 60 seconds." .
obo:UO_0000032 a obo:UO_0000003 ;
rdfs:label "hour" ;
rdfs:comment "A time unit which is equal to 3600 seconds or 60 minutes." .
obo:UO_0000033 a obo:UO_0000003 ;
rdfs:label "day" ;
rdfs:comment "A time unit which is equal to 24 hours." .
obo:UO_0000034 a obo:UO_0000003 ;
rdfs:label "week" ;
rdfs:comment "A time unit which is equal to 7 days." .
obo:UO_0000035 a obo:UO_0000003 ;
rdfs:label "month" ;
rdfs:comment "A time unit which is approximately equal to the length of time of one of cycle of the moon's phases which in science is taken to be equal to 30 days." .
obo:UO_0000036 a obo:UO_0000003 ;
rdfs:label "year" ;
rdfs:comment "A time unit which is equal to 12 months which is science is taken to be equal to 365.25 days." .
obo:OBI_0002270 a rdfs:Class ;
rdfs:label "pathologic lymph node stage for colon and rectum according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of colorectal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002271 a obo:OBI_0002270 ;
rdfs:label "pN0 (colon)" ;
rdfs:comment "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating no regional lymph node metastsis." .
obo:OBI_0002272 a obo:OBI_0002270 ;
rdfs:label "pN1 (colon)" ;
rdfs:comment "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 1-3 regional lymph nodes." .
obo:OBI_0002273 a obo:OBI_0002270 ;
rdfs:label "pN1a (colon)" ;
rdfs:comment "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 1 regional lymph node." .
obo:OBI_0002274 a obo:OBI_0002270 ;
rdfs:label "pN1b (colon)" ;
rdfs:comment "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 2-3 regional lymph nodes." .
obo:OBI_0002275 a obo:OBI_0002270 ;
rdfs:label "pN1c (colon)" ;
rdfs:comment "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating tumor deposit(s), i.e., satellites in the subserosa, or in non-peritonealized pericolic or perirectal soft tissue without regional lymph node metastasis." .
obo:OBI_0002276 a obo:OBI_0002270 ;
rdfs:label "pN2 (colon)" ;
rdfs:comment "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 4 or more regional lymph nodes." .
obo:OBI_0002277 a obo:OBI_0002270 ;
rdfs:label "pN2a (colon)" ;
rdfs:comment "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 4 to 6 regional lymph nodes." .
obo:OBI_0002278 a obo:OBI_0002270 ;
rdfs:label "pN2b (colon)" ;
rdfs:comment "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 7 or more regional lymph nodes." .
obo:IAO_0000098 a rdfs:Class ;
rdfs:label "data format specification"@en ;
rdfs:comment """A data format specification is the information content borne by the document published defining the specification.
Example: The ISO document specifying what encompasses an XML document; The instructions in a XSD file"""@en ;
rdfs:subClassOf obo:IAO_0000033 .
obo:OBI_0000317 a obo:IAO_0000098 ;
rdfs:label "Transformation-ML"@en ;
rdfs:comment "Transformation-ML is a format standard of a digital entity that is conformant with the Transformation-ML standard.(http://wiki.ficcs.org/ficcs/Transformation-ML?action=AttachFile&do=get&target=Transformation-ML_v1.0.26.pdf)"@en .
obo:OBI_0000321 a obo:IAO_0000098 ;
rdfs:label "ACS"@en ;
rdfs:comment "ACS is a format standard of a digital entity that is conformant with the Analytical Cytometry Standard. (http://www.isac-net.org/content/view/607/150/)"@en .
obo:OBI_0000322 a obo:IAO_0000098 ;
rdfs:label "XML"@en ;
rdfs:comment "XML is a format standard of a digital entity that is conformant with the W3C Extensible Markup Language Recommendation.(http://www.w3.org/XML/)"@en .
obo:OBI_0000324 a obo:IAO_0000098 ;
rdfs:label "RDF"@en ;
rdfs:comment "RDF is a format standard of a digital entity that is conformant with the W3C Resource Description Framework RDF/XML Syntax specification.(http://www.w3.org/RDF/)"@en .
obo:OBI_0000325 a obo:IAO_0000098 ;
rdfs:label "zip"@en ;
rdfs:comment "zip is a format standard of a digital entity that is conformant with the PKWARE .ZIP file format specification (http://www.pkware.com/index.php?option=com_content&task=view&id=59&Itemid=103/)"@en .
obo:OBI_0000326 a obo:IAO_0000098 ;
rdfs:label "tar"@en ;
rdfs:comment "tar is a format standard of a digital entity that is conformant with the tape archive file format as standardized by POSIX.1-1998, POSIX.1-2001, or any other tar format compliant with the GNU tar specification. (http://www.gnu.org/software/tar/manual/)"@en .
obo:OBI_0000327 a obo:IAO_0000098 ;
rdfs:label "FCS"@en ;
rdfs:comment "FCS is a format standard of a digital entity that is conformant with the Flow Cytometry Data File Standard.(http://www.fcspress.com/)"@en .
obo:OBI_0000329 a obo:IAO_0000098 ;
rdfs:label "Compensation-ML"@en ;
rdfs:comment "Compensation-ML is a format standard of a digital entity that is conformant with the Compensation-ML standard. (http://wiki.ficcs.org/ficcs/Compensation-ML?action=AttachFile&do=get&target=Compensation-ML_v1.0.24.pdf)"@en .
obo:OBI_0000330 a obo:IAO_0000098 ;
rdfs:label "Gating-ML"@en ;
rdfs:comment "Gating-ML is a format standard of a digital entity that is conformant with the Gating-ML standard. (http://www.flowcyt.org/gating/)"@en .
obo:OBI_0000332 a obo:IAO_0000098 ;
rdfs:label "OWL"@en ;
rdfs:comment "OWL is a format standard of a digital entity that is conformant with the W3C Web Ontology Language specification.(http://www.w3.org/2004/OWL/)"@en .
obo:OBI_0002298 a rdfs:Class ;
rdfs:label "pathologic distant metastases stage for lung according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002299 a obo:OBI_0002298 ;
rdfs:label "cM0 (lung)" ;
rdfs:comment "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is no distant metastasis." .
obo:OBI_0002300 a obo:OBI_0002298 ;
rdfs:label "cM1 (lung)" ;
rdfs:comment "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there are distant metastases based on clinical assessment." .
obo:OBI_0002301 a obo:OBI_0002298 ;
rdfs:label "cM1a (lung)" ;
rdfs:comment "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that metastasis is based on clinical assessment and a separate tumor nodule(s) in a contralateral lobe; tumor with pleural nodules OR malignant pleural or pericardial effusion." .
obo:OBI_0002302 a obo:OBI_0002298 ;
rdfs:label "cM1b (lung)" ;
rdfs:comment "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases based on clinical assessment." .
obo:OBI_0002303 a obo:OBI_0002298 ;
rdfs:label "pM1 (lung)" ;
rdfs:comment "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed." .
obo:OBI_0002304 a obo:OBI_0002298 ;
rdfs:label "pM1a (lung)" ;
rdfs:comment "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that metastasis is histologically confirmed and a separate tumor nodule(s) in a contralateral lobe; tumor with pleural nodules OR malignant pleural or pericardial effusion." .
obo:OBI_0002305 a obo:OBI_0002298 ;
rdfs:label "pM1b (lung)" ;
rdfs:comment "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed and associated with distant lymph nodes or carcinomatosis." .
obo:UO_0000095 a rdfs:Class ;
rdfs:label "volume unit" ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000097 a obo:UO_0000095 ;
rdfs:label "cubic centimeter" ;
rdfs:comment "A volume unit which is equal to one millionth of a cubic meter or 10^[-9] m^[3], or to 1 ml." .
obo:UO_0000098 a obo:UO_0000095 ;
rdfs:label "milliliter" ;
rdfs:comment "A volume unit which is equal to one thousandth of a liter or 10^[-3] L, or to 1 cubic centimeter." .
obo:UO_0000099 a obo:UO_0000095 ;
rdfs:label "liter" ;
rdfs:comment "A volume unit which is equal to one thousandth of a cubic meter or 10^[-3] m^[3], or to 1 decimeter." .
obo:UO_0000100 a obo:UO_0000095 ;
rdfs:label "cubic decimeter" ;
rdfs:comment "A volume unit which is equal to one thousand of a cubic meter or 10^[-3] m^[3], or to 1 L." .
obo:UO_0000101 a obo:UO_0000095 ;
rdfs:label "microliter" ;
rdfs:comment "A volume unit which is equal to one millionth of a liter or 10^[-6] L." .
obo:UO_0000102 a obo:UO_0000095 ;
rdfs:label "nanoliter" ;
rdfs:comment "A volume unit which is equal to one thousandth of one millionth of a liter or 10^[-9] L." .
obo:UO_0000103 a obo:UO_0000095 ;
rdfs:label "picoliter" ;
rdfs:comment "A volume unit which is equal to 10^[-12] L." .
obo:OBI_0000639 a rdfs:Class ;
rdfs:label "material separation objective" ;
rdfs:comment "is an objective to transform a material entity into spatially separated components." ;
rdfs:subClassOf obo:OBI_0000456 .
obo:OBI_0000678 a obo:OBI_0000639 ;
rdfs:label "portioning objective" ;
rdfs:comment "A material separation objective aiming to separate material into multiple portions, each of which contains a similar composition of the input material." .
obo:OBI_0000681 a obo:OBI_0000639 ;
rdfs:label "separation into different composition objective" ;
rdfs:comment "A material separation objective aiming to separate a material entity that has parts of different types, and end with at least one output that is a material with parts of fewer types (modulo impurities)." .
obo:UO_0000051 a rdfs:Class ;
rdfs:label "concentration unit" ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000062 a obo:UO_0000051 ;
rdfs:label "molar" ;
rdfs:comment "A unit of concentration which expresses a concentration of 1 mole of solute per liter of solution (mol/L)." .
obo:UO_0000063 a obo:UO_0000051 ;
rdfs:label "millimolar" ;
rdfs:comment "A unit of molarity which is equal to one thousandth of a molar or 10^[-3] M." .
obo:UO_0000064 a obo:UO_0000051 ;
rdfs:label "micromolar" ;
rdfs:comment "A unit of molarity which is equal to one millionth of a molar or 10^[-6] M." .
obo:UO_0000065 a obo:UO_0000051 ;
rdfs:label "nanomolar" ;
rdfs:comment "A unit of molarity which is equal to one thousandth of one millionth of a molar or 10^[-9] M." .
obo:UO_0000066 a obo:UO_0000051 ;
rdfs:label "picomolar" ;
rdfs:comment "A unit of molarity which is equal to 10^[-12] M." .
obo:UO_0000163 a obo:UO_0000051 ;
rdfs:label "mass percentage" ;
rdfs:comment "A dimensionless concentration unit which denotes the mass of a substance in a mixture as a percentage of the mass of the entire mixture." .
obo:UO_0000164 a obo:UO_0000051 ;
rdfs:label "mass volume percentage" ;
rdfs:comment "A dimensionless concentration unit which denotes the mass of the substance in a mixture as a percentage of the volume of the entire mixture." .
obo:UO_0000165 a obo:UO_0000051 ;
rdfs:label "volume percentage" ;
rdfs:comment "A dimensionless concentration unit which denotes the volume of the solute in mL per 100 mL of the resulting solution." .
obo:UO_0000175 a obo:UO_0000051 ;
rdfs:label "gram per liter" ;
rdfs:comment "A mass unit density which is equal to mass of an object in grams divided by the volume in liters." .
obo:UO_0000176 a obo:UO_0000051 ;
rdfs:label "milligram per milliliter" ;
rdfs:comment "A mass unit density which is equal to mass of an object in milligrams divided by the volume in milliliters." .
obo:UO_0000196 a obo:UO_0000051 ;
rdfs:label "pH" ;
rdfs:comment "A dimensionless concentration notation which denotes the acidity of a solution in terms of activity of hydrogen ions (H+)." .
obo:UO_0000207 a obo:UO_0000051 ;
rdfs:label "milliliter per liter" ;
rdfs:comment "A volume per unit volume unit which is equal to one millionth of a liter of solute in one liter of solution." .
obo:UO_0000208 a obo:UO_0000051 ;
rdfs:label "gram per deciliter" ;
rdfs:comment "A mass density unit which is equal to mass of an object in grams divided by the volume in deciliters." .
obo:UO_0000212 a obo:UO_0000051 ;
rdfs:label "colony forming unit per volume" ;
rdfs:comment "A concentration unit which a measure of viable bacterial numbers in a given volume." .
obo:UO_0000301 a obo:UO_0000051 ;
rdfs:label "microgram per liter" ;
rdfs:comment "A mass unit density which is equal to mass of an object in micrograms divided by the volume in liters." .
obo:OBI_0001000 a rdfs:Class ;
rdfs:label "questionnaire" ;
rdfs:comment "A document with a set of printed or written questions with a choice of answers, devised for the purposes of a survey or statistical study."@en ;
rdfs:subClassOf obo:IAO_0000310 .
obo:OBI_0001004 a obo:OBI_0001000 ;
rdfs:label "Edingburgh handedness inventory" ;
rdfs:comment "The Edinburgh Handedness Inventory is a set of questions used to assess the dominance of a person's right or left hand in everyday activities. "@en .
obo:UO_0000001 a rdfs:Class ;
rdfs:label "length unit" ;
rdfs:comment "A unit which is a standard measure of the distance between two points." ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000008 a obo:UO_0000001 ;
rdfs:label "meter" ;
rdfs:comment "A length unit which is equal to the length of the path traveled by light in vacuum during a time interval of 1/299 792 458 of a second." .
obo:UO_0000015 a obo:UO_0000001 ;
rdfs:label "centimeter" ;
rdfs:comment "A length unit which is equal to one hundredth of a meter or 10^[-2] m." .
obo:UO_0000016 a obo:UO_0000001 ;
rdfs:label "millimeter" ;
rdfs:comment "A length unit which is equal to one thousandth of a meter or 10^[-3] m." .
obo:UO_0000017 a obo:UO_0000001 ;
rdfs:label "micrometer" ;
rdfs:comment "A length unit which is equal to one millionth of a meter or 10^[-6] m." .
obo:UO_0000018 a obo:UO_0000001 ;
rdfs:label "nanometer" ;
rdfs:comment "A length unit which is equal to one thousandth of one millionth of a meter or 10^[-9] m." .
obo:UO_0000019 a obo:UO_0000001 ;
rdfs:label "angstrom" ;
rdfs:comment "A length unit which is equal to 10 [-10] m." .
obo:OBI_0200051 a rdfs:Class ;
rdfs:label "principal components analysis dimensionality reduction"@en ;
rdfs:comment "A principal components analysis dimensionality reduction is a dimensionality reduction achieved by applying principal components analysis and by keeping low-order principal components and excluding higher-order ones."@en ;
rdfs:subClassOf obo:OBI_0200050 .
obo:OBI_0000760 a obo:OBI_0200051 ;
rdfs:label "GenePattern PCA" .
obo:OBI_0002326 a rdfs:Class ;
rdfs:label "International Federation of Gynecology and Obstetrics cervical cancer stage value specification" ;
rdfs:comment "A categorical value specification that is an assessment of the stage of a gynecologic cancer according to the International Federation of Gynecology and Obstetrics (FIGO) staging systems." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002327 a obo:OBI_0002326 ;
rdfs:label "Stage IA (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating invasive carcinoma which can be diagnosed only by microscopy, with deepest invasion <5 mm and the largest extension <7 mm." .
obo:OBI_0002328 a obo:OBI_0002326 ;
rdfs:label "Stage IA1 (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating measured stromal invasion of <3.0 mm in depth and extension of <7.0 mm." .
obo:OBI_0002329 a obo:OBI_0002326 ;
rdfs:label "Stage IA2 (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating measured stromal invasion of >3.0 mm and not >5.0 mm with an extension of not >7.0 mm." .
obo:OBI_0002330 a obo:OBI_0002326 ;
rdfs:label "Stage IB (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesions limited to the cervix uteri or pre-clinical cancers greater than stage IA" .
obo:OBI_0002331 a obo:OBI_0002326 ;
rdfs:label "Stage IB1 (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesion limited to the cervix uteri or pre-clinical cancers greater than stage IA <4.0 cm in greatest dimension." .
obo:OBI_0002332 a obo:OBI_0002326 ;
rdfs:label "Stage IB2 (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesion limited to the cervix uteri or pre-clinical cancers greater than stage IA >4.0 cm in greatest dimension." .
obo:OBI_0002333 a obo:OBI_0002326 ;
rdfs:label "Stage IIA (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion. " .
obo:OBI_0002334 a obo:OBI_0002326 ;
rdfs:label "Stage IIA1 (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion and clinically visible lesion <4.0 cm in greatest dimension. " .
obo:OBI_0002335 a obo:OBI_0002326 ;
rdfs:label "Stage IIA2 (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion and clinically visible lesion >4.0 cm in greatest dimension. " .
obo:OBI_0002336 a obo:OBI_0002326 ;
rdfs:label "Stage IIB (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina with obvious parametrial invasion. " .
obo:OBI_0002337 a obo:OBI_0002326 ;
rdfs:label "Stage IIIA (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating tumour involves lower third of the vagina, with no extension to the pelvic wall." .
obo:OBI_0002338 a obo:OBI_0002326 ;
rdfs:label "Stage IIIB (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating extension to the pelvic wall and/or hydronephrosis or non-functioning kidney." .
obo:OBI_0002339 a obo:OBI_0002326 ;
rdfs:label "Stage IVA (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating spread of the growth to adjacent organs." .
obo:OBI_0002340 a obo:OBI_0002326 ;
rdfs:label "Stage IVB (FIGO)" ;
rdfs:comment "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating spread to distant organs." .
obo:OBI_0002284 a rdfs:Class ;
rdfs:label "pathologic lymph node stage for kidney according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002285 a obo:OBI_0002284 ;
rdfs:label "pN0 (kidney)" ;
rdfs:comment "A pathologic lymph node stage for kidney according to AJCC 7th edition indicating that there is no regional lymph node metastasis." .
obo:OBI_0002286 a obo:OBI_0002284 ;
rdfs:label "pN1 (kidney)" ;
rdfs:comment "A pathologic lymph node stage for kidney according to AJCC 7th edition indicating that there is regional lymph node metastasis." .
obo:OBI_0000726 a rdfs:Class ;
rdfs:label "peak matching" ;
rdfs:comment "Peak matching is a data transformation performed on a dataset of a graph of ordered data points (e.g. a spectrum) with the objective of pattern matching local maxima above a noise threshold" ;
rdfs:subClassOf obo:OBI_0200000 .
obo:OBI_0000778 a obo:OBI_0000726 ;
rdfs:label "GenePattern peak matching" .
obo:OBI_0002363 a rdfs:Class ;
rdfs:label "Karnofsky score vaue specification" ;
rdfs:comment "A performance status value specification designed for classifying patients 16 years of age or older by their functional impairment." ;
rdfs:subClassOf obo:OBI_0002356 .
obo:OBI_0002364 a obo:OBI_0002363 ;
rdfs:label "100: asymptomatic" ;
rdfs:comment "A Karnofsky score vaue specification indicating that a patient is asymptomatic." .
obo:OBI_0002365 a obo:OBI_0002363 ;
rdfs:label "80-90: symptomatic but fully ambulatory" ;
rdfs:comment "A Karnofsky score vaue specification indicating that a patient is symptomatic but fully ambulatory." .
obo:OBI_0002366 a obo:OBI_0002363 ;
rdfs:label "60-70: symptomatic but in bed less than 50% of the day" ;
rdfs:comment "A Karnofsky score vaue specification indicating that a patient is symptomatic but in bed less than 50% of the day." .
obo:OBI_0002367 a obo:OBI_0002363 ;
rdfs:label "40-50: symptomatic, in bed more than 50% of the day, but not bed ridden" ;
rdfs:comment "A Karnofsky score vaue specification indicating that a patient is symptomatic, in bed more than 50% of the day, but not bed ridden." .
obo:UO_0000270 a rdfs:Class ;
rdfs:label "volumetric flow rate unit" ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000271 a obo:UO_0000270 ;
rdfs:label "microliters per minute" ;
rdfs:comment "A volumetric flow rate unit which is equal to one microliter volume through a given surface in one minute." .
obo:OBI_0000749 a rdfs:Class ;
rdfs:label "CART"@en ;
rdfs:comment "A CART (classification and regression trees) is a data transformation method for producing a classification or regression model with a tree-based structure."@en ;
rdfs:subClassOf obo:OBI_0000707 .
obo:OBI_0000767 a obo:OBI_0000749 ;
rdfs:label "GenePattern CART" .
obo:OBI_0002210 a rdfs:Class ;
rdfs:label "histologic grade according to the Fuhrman Nuclear Grading System" ;
rdfs:comment "A categorical value specification that is a histologic grade assigned to a tumor slide specimen according to the Fuhrman Nuclear Grading System." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002211 a obo:OBI_0002210 ;
rdfs:label "G1 (Fuhrman)" ;
rdfs:comment "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are round, uniform, approximately 10um and that nucleoli are inconspicuous or absent." .
obo:OBI_0002212 a obo:OBI_0002210 ;
rdfs:label "G2 (Fuhrman)" ;
rdfs:comment "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are slightly irregular, approximately 15um and nucleoli are evident." .
obo:OBI_0002213 a obo:OBI_0002210 ;
rdfs:label "G3 (Fuhrman)" ;
rdfs:comment "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are very irregular, approximately 20um and nucleoli large and prominent." .
obo:OBI_0002214 a obo:OBI_0002210 ;
rdfs:label "G4 (Fuhrman)" ;
rdfs:comment "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei arei bizarre and multilobulated, 20um or greater and nucleoli are prominent and chromatin clumped." .
obo:UO_0000002 a rdfs:Class ;
rdfs:label "mass unit" ;
rdfs:comment "A unit which is a standard measure of the amount of matter/energy of a physical object." ;
rdfs:subClassOf obo:IAO_0000003 .
obo:UO_0000009 a obo:UO_0000002 ;
rdfs:label "kilogram" ;
rdfs:comment "A mass unit which is equal to the mass of the International Prototype Kilogram kept by the BIPM at Svres, France." .
obo:UO_0000021 a obo:UO_0000002 ;
rdfs:label "gram" ;
rdfs:comment "A mass unit which is equal to one thousandth of a kilogram or 10^[-3] kg." .
obo:UO_0000022 a obo:UO_0000002 ;
rdfs:label "milligram" ;
rdfs:comment "A mass unit which is equal to one thousandth of a gram or 10^[-3] g." .
obo:UO_0000023 a obo:UO_0000002 ;
rdfs:label "microgram" ;
rdfs:comment "A mass unit which is equal to one millionth of a gram or 10^[-6] g." .
obo:UO_0000024 a obo:UO_0000002 ;
rdfs:label "nanogram" ;
rdfs:comment "A mass unit which is equal to one thousandth of one millionth of a gram or 10^[-9] g." .
obo:UO_0000025 a obo:UO_0000002 ;
rdfs:label "picogram" ;
rdfs:comment "A mass unit which is equal to 10^[-12] g." .
obo:OBI_0200033 a rdfs:Class ;
rdfs:label "leave one out cross validation method"@en ;
rdfs:comment "is a data transformation : leave-one-out cross-validation (LOOCV) involves using a single observation from the original sample as the validation data, and the remaining observations as the training data. This is repeated such that each observation in the sample is used once as the validation data" ;
rdfs:subClassOf obo:OBI_0000792 .
obo:OBI_0000763 a obo:OBI_0200033 ;
rdfs:label "GenePattern LOOCV" .
obo:IAO_0000225 a rdfs:Class ;
rdfs:label "obsolescence reason specification"@en ;
rdfs:comment "The reason for which a term has been deprecated. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value."@en ;
rdfs:subClassOf obo:IAO_0000102 .
obo:IAO_0000103 a obo:IAO_0000225 ;
rdfs:label "failed exploratory term"@en ;
rdfs:comment "The term was used in an attempt to structure part of the ontology but in retrospect failed to do a good job"@en .
obo:IAO_0000226 a obo:IAO_0000225 ;
rdfs:label "placeholder removed"@en .
obo:IAO_0000227 a obo:IAO_0000225 ;
rdfs:label "terms merged"@en .
obo:IAO_0000228 a obo:IAO_0000225 ;
rdfs:label "term imported"@en .
obo:IAO_0000229 a obo:IAO_0000225 ;
rdfs:label "term split"@en .
obo:IAO_0000078 a rdfs:Class ;
rdfs:label "curation status specification"@en ;
rdfs:comment "The curation status of the term. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value."@en ;
rdfs:subClassOf obo:IAO_0000102 .
obo:IAO_0000002 a obo:IAO_0000078 ;
rdfs:label "example to be eventually removed"@en .
obo:IAO_0000120 a obo:IAO_0000078 ;
rdfs:label "metadata complete"@en ;
rdfs:comment "Class has all its metadata, but is either not guaranteed to be in its final location in the asserted IS_A hierarchy or refers to another class that is not complete."@en .
obo:IAO_0000121 a obo:IAO_0000078 ;
rdfs:label "organizational term"@en ;
rdfs:comment "Term created to ease viewing/sort terms for development purpose, and will not be included in a release"@en .
obo:IAO_0000122 a obo:IAO_0000078 ;
rdfs:label "ready for release"@en ;
rdfs:comment "Class has undergone final review, is ready for use, and will be included in the next release. Any class lacking \"ready_for_release\" should be considered likely to change place in hierarchy, have its definition refined, or be obsoleted in the next release. Those classes deemed \"ready_for_release\" will also derived from a chain of ancestor classes that are also \"ready_for_release.\""@en .
obo:IAO_0000123 a obo:IAO_0000078 ;
rdfs:label "metadata incomplete"@en ;
rdfs:comment "Class is being worked on; however, the metadata (including definition) are not complete or sufficiently clear to the branch editors."@en .
obo:IAO_0000124 a obo:IAO_0000078 ;
rdfs:label "uncurated"@en ;
rdfs:comment "Nothing done yet beyond assigning a unique class ID and proposing a preferred term."@en .
obo:IAO_0000125 a obo:IAO_0000078 ;
rdfs:label "pending final vetting"@en ;
rdfs:comment "All definitions, placement in the asserted IS_A hierarchy and required minimal metadata are complete. The class is awaiting a final review by someone other than the term editor."@en .
obo:IAO_0000423 a obo:IAO_0000078 ;
rdfs:label "to be replaced with external ontology term"@en ;
rdfs:comment "Terms with this status should eventually replaced with a term from another ontology."@en .
obo:IAO_0000428 a obo:IAO_0000078 ;
rdfs:label "requires discussion"@en ;
rdfs:comment "A term that is metadata complete, has been reviewed, and problems have been identified that require discussion before release. Such a term requires editor note(s) to identify the outstanding issues."@en .
obo:OBI_0002256 a rdfs:Class ;
rdfs:label "pathologic primary tumor stage for ovary according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002257 a obo:OBI_0002256 ;
rdfs:label "pT0 (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that there is no evidence of primary tumor." .
obo:OBI_0002258 a obo:OBI_0002256 ;
rdfs:label "pT1 (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to the ovaries (one or both)." .
obo:OBI_0002259 a obo:OBI_0002256 ;
rdfs:label "pT1a (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to one ovary; capsule intact, no tumor on ovarian surface and no malignant cells in ascites or peritoneal washings." .
obo:OBI_0002260 a obo:OBI_0002256 ;
rdfs:label "pT1b (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to both ovaries; capsule intact, no tumor on ovarian surface and no malignant cells in ascites or peritoneal washings." .
obo:OBI_0002261 a obo:OBI_0002256 ;
rdfs:label "pT1c (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to one or both ovaries with capsule ruptured, tumor on ovarian surface, or malignant cells in ascites or peritoneal washings." .
obo:OBI_0002262 a obo:OBI_0002256 ;
rdfs:label "pT2 (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor involves one or both ovaries with pelvic extension." .
obo:OBI_0002263 a obo:OBI_0002256 ;
rdfs:label "pT2a (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has extension and/or implants on uterus and/or tube(s) and no malignant cells in ascites or peritoneal washings." .
obo:OBI_0002264 a obo:OBI_0002256 ;
rdfs:label "pT2b (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has extension to other pelvic tissues and no malignant cells in ascites or peritoneal washings." .
obo:OBI_0002265 a obo:OBI_0002256 ;
rdfs:label "pT2c (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has pelvic extension with malignant cells in ascites or peritoneal washings." .
obo:OBI_0002266 a obo:OBI_0002256 ;
rdfs:label "pT3 (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor involves one or both ovaries with microscopically confirmed peritoneal metastasis outside the pelvis and/or regional lymph node metastasis." .
obo:OBI_0002267 a obo:OBI_0002256 ;
rdfs:label "pT3a (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has microscopic peritoneal metastasis beyond pelvis." .
obo:OBI_0002268 a obo:OBI_0002256 ;
rdfs:label "pT3b (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has macroscopic peritoneal, metastatasis beyond pelvis, 2 cm or less in greatest dimension." .
obo:OBI_0002269 a obo:OBI_0002256 ;
rdfs:label "pT3c (ovary)" ;
rdfs:comment "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has peritoneal metastasis beyond pelvis, more than 2 cm in greatest dimension and/or regional lymph node metastasis." .
obo:OBI_0002232 a rdfs:Class ;
rdfs:label "pathologic primary tumor stage for lung according to AJCC 7th edition" ;
rdfs:comment "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM American Joint Committee on Cancer (AJCC) version 7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." ;
rdfs:subClassOf obo:OBI_0001930 .
obo:OBI_0002233 a obo:OBI_0002232 ;
rdfs:label "pT0 (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that there is no evidence of primary tumor." .
obo:OBI_0002234 a obo:OBI_0002232 ;
rdfs:label "pTis (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating carcinoma in situ." .
obo:OBI_0002235 a obo:OBI_0002232 ;
rdfs:label "pT1 (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is 3 cm or less in greatest dimension, surrounded by lung or visceral pleura without bronchoscopic evidence of invasion more proximal than the lobar bronchus (i.e., not in the main bronchus)." .
obo:OBI_0002236 a obo:OBI_0002232 ;
rdfs:label "pT1a (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is 2 cm or less in greatest dimension." .
obo:OBI_0002237 a obo:OBI_0002232 ;
rdfs:label "pT1b (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 2 cm but not more than 3 cm in greatest dimension." .
obo:OBI_0002238 a obo:OBI_0002232 ;
rdfs:label "pT2 (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 3 cm but not more than 7 cm or the tumor has any of the following features: involves main bronchus, 2 cm or more distal to the carina, invades visceral pleura, associated with atelectasis or obstructive pneumonitis that extends to the hilar region but does not involve the entire lung." .
obo:OBI_0002239 a obo:OBI_0002232 ;
rdfs:label "pT2a (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 3 cm but not more than 5 cm in greatest dimension." .
obo:OBI_0002240 a obo:OBI_0002232 ;
rdfs:label "pT2b (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 5 cm but not more than 7 cm in greatest dimension." .
obo:OBI_0002241 a obo:OBI_0002232 ;
rdfs:label "pT3 (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 7 cm or one that directly invades any of: parietal pleura, chest wall (including superior sulcus tumors), diaphragm, phrenic nerve, mediastinal pleura, parietal pericardiu or the tumor is in the main bronchus less than 2 cm distal to the carina but without involvement of the carina or there is associated atelectasis or obstructive pneumonitis of the entire lung or there is separate tumor nodule(s) in the same lobe as the primary." .
obo:OBI_0002242 a obo:OBI_0002232 ;
rdfs:label "pT4 (lung)" ;
rdfs:comment "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor of any size that invades any of the following: mediastinum, heart, great vessels, trachea, recurrent laryngeal nerve, esophagus, vertebral body, carina or there is separate tumor nodule(s) in a different ipsilateral lobe to that of the primary." .