PREFIX owl: <http://www.w3.org/2002/07/owl#>
PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#>
PREFIX xsd: <http://www.w3.org/2001/XMLSchema#>
PREFIX MIXS: <https://w3id.org/mixs/>
PREFIX NCIT: <http://purl.obolibrary.org/obo/NCIT_>
PREFIX SO: <http://purl.obolibrary.org/obo/SO_>
PREFIX chrono: <http://rs.tdwg.org/chrono/terms/>
PREFIX dc: <http://purl.org/dc/elements/1.1/>
PREFIX linkml: <https://w3id.org/linkml/>
PREFIX schema: <http://schema.org/>
PREFIX shex: <http://www.w3.org/ns/shex#>
PREFIX skos: <http://www.w3.org/2004/02/skos/core#>
PREFIX pav: <http://purl.org/pav/>
PREFIX sh: <http://www.w3.org/ns/shacl#>
PREFIX vann: <http://purl.org/vocab/vann/>

<https://w3id.org/mixs> a owl:Ontology ;
  rdfs:comment "MIxS, the Minimum Information about any (x) Sequence, is a standard from the Genomic Standards Consortium (GSC, https://www.gensc.org/) for reporting contextual metadata about sequenced samples. It defines checklists for genomic sequence types (for example genomes, metagenomes, and marker genes), environmental extensions, and the terms that populate them. See https://genomicsstandardsconsortium.github.io/mixs/." ;
  skos:note "slot titles that are associated with more than one slot name/SCN: host sex" ;
  rdfs:seeAlso <https://doi.org/10.1038/nbt.1823> ;
  pav:version "7.0.1" ;
  vann:preferredNamespacePrefix "MIXS" ;
  vann:preferredNamespaceUri "https://w3id.org/mixs/"^^xsd:anyURI ;
  sh:declare [
    sh:prefix "MIXS" ;
    sh:namespace "https://w3id.org/mixs/"^^xsd:anyURI
  ] , [
    sh:prefix "NCIT" ;
    sh:namespace "http://purl.obolibrary.org/obo/NCIT_"^^xsd:anyURI
  ] , [
    sh:prefix "SO" ;
    sh:namespace "http://purl.obolibrary.org/obo/SO_"^^xsd:anyURI
  ] , [
    sh:prefix "chrono" ;
    sh:namespace "http://rs.tdwg.org/chrono/terms/"^^xsd:anyURI
  ] , [
    sh:prefix "dc" ;
    sh:namespace "http://purl.org/dc/elements/1.1/"^^xsd:anyURI
  ] , [
    sh:prefix "linkml" ;
    sh:namespace "https://w3id.org/linkml/"^^xsd:anyURI
  ] , [
    sh:prefix "schema" ;
    sh:namespace "http://schema.org/"^^xsd:anyURI
  ] , [
    sh:prefix "shex" ;
    sh:namespace "http://www.w3.org/ns/shex#"^^xsd:anyURI
  ] , [
    sh:prefix "xsd" ;
    sh:namespace "http://www.w3.org/2001/XMLSchema#"^^xsd:anyURI
  ] .

MIXS:0016018 a owl:Class ;
  rdfs:label "agriculture" ;
  rdfs:comment "A collection of terms appropriate when sequencing samples obtained in an agricultural environment. Suitable to capture metadata appropriate to enhance crop productivity and agroecosystem health with the aim to facilitate research of agricultural microbiomes and their relationships to plant productivity and sustainable crop production from diverse crop management contexts." ;
  skos:altLabel "MIxS-Ag (agriculture)" ;
  MIXS:use_cases "Agricultural Microbiomes Research Coordination Network, model cropping and plant systems focused on agricultural plant and soil microbe; microbiome studies in agricultural sites; long-term ecological research in croplands; eDNA in manure samples; describing agricultural microbiome studies" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001296 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001296 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001336 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001163 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001163 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001160 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001160 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001158 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001158 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001161 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001161 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001159 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001159 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000211 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000211 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000335 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000335 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000336 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000336 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000819 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000819 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001115 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001110 ;
    owl:allValuesFrom MIXS:FarmWaterSourceEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001176 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001175 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001175 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000829 ;
    owl:allValuesFrom MIXS:SeasonEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000829 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000112 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001148 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001148 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000100 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000100 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001121 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001211 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001147 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001127 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001127 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001138 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001124 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001126 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001123 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001133 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001060 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001170 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000735 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000735 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000736 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000736 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001153 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000578 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000578 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000577 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000577 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001062 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:allValuesFrom MIXS:BioticRelationshipEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000590 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000591 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000558 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000557 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001040 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000561 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000571 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000573 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001056 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000582 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001068 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000030 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000030 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:allValuesFrom MIXS:TrophicLevelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000046 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000046 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000044 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000044 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000045 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000045 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000049 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000049 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000051 ;
    owl:allValuesFrom MIXS:SeqQualityCheckEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000051 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000052 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000052 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001083 ;
    owl:allValuesFrom MIXS:FaoClassEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001083 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000330 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000330 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000331 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000331 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000332 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000332 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000334 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000334 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001082 ;
    owl:allValuesFrom MIXS:SoilHorizonEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001082 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000321 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000329 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000329 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000315 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000315 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000316 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000316 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000318 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000639 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001081 ;
    owl:allValuesFrom MIXS:TillageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001086 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001086 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000319 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000319 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000320 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000320 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000328 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000328 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000642 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000642 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000643 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000643 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000644 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000644 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000645 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000645 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001080 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001080 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000646 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000646 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000647 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000647 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001084 ;
    owl:allValuesFrom MIXS:ProfilePositionEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001084 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001085 ;
    owl:allValuesFrom MIXS:DrainageClassEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001085 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001106 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001106 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000312 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000312 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000314 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000314 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000337 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000337 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000338 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000338 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000650 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000650 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000339 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000339 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000343 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000343 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000525 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000525 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000689 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000689 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000322 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016000 a owl:Class ;
  rdfs:label "air" ;
  rdfs:comment "A collection of terms appropriate when collecting and sequencing samples obtained from a gaseous environment." ;
  skos:altLabel "MIxS-air" ;
  MIXS:use_cases "bioaerosol samples, pathogen load in urban air, aerosols" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000096 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000096 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000097 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000097 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000098 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000098 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000100 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000100 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000101 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000101 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000104 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000104 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000108 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000112 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000114 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000114 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000756 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000115 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000757 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000757 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000118 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000118 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016024 a owl:Class ;
  rdfs:label "ancient" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples  of data containing ancient nucleic acids, i.e., degraded molecules not from living organisms." ;
  skos:altLabel "minas" ;
  skos:note "This extension that is intended to be used in very specific cases but almost always in conjunction with other MIxS checklists and extensions. It does not therefore (currently) include additional common terms from checklists." ;
  MIXS:use_cases "ancient dna samples" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o351 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o366 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o394 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o401 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o412 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

_:o351 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o366 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o394 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o401 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o412 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0016001 a owl:Class ;
  rdfs:label "built environment" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained in the built-up environment, which includes terms for surface material, humidity, temperature, moisture and occupancy type along with specific metadata terms describing the indoor air, building and sample properties." ;
  skos:altLabel "MIxS-BE (built environment)" ;
  MIXS:use_cases "microbiology studies of the built environment, NASA space station sampling, MetaSUB transit system sampling, home, hospitals, office buildings" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000758 ;
    owl:allValuesFrom MIXS:SurfMaterialEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000758 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000759 ;
    owl:allValuesFrom MIXS:SurfAirContEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000121 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000121 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000122 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000122 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000123 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000123 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000124 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000124 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000125 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000125 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000760 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000760 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000761 ;
    owl:allValuesFrom MIXS:BuildOccupTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000761 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000128 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000128 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000129 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000129 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000097 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000097 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000756 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000756 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000763 ;
    owl:allValuesFrom MIXS:IndoorSpaceEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000763 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000764 ;
    owl:allValuesFrom MIXS:IndoorSurfEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000764 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000765 ;
    owl:allValuesFrom MIXS:FilterTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000765 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000766 ;
    owl:allValuesFrom MIXS:HeatCoolTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000766 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000767 ;
    owl:allValuesFrom MIXS:SubstructureTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000768 ;
    owl:allValuesFrom MIXS:BuildingSettingEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000768 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000769 ;
    owl:allValuesFrom MIXS:LightTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000769 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000216 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000770 ;
    owl:allValuesFrom MIXS:SpaceTypStateEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000770 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000771 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000771 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000772 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000772 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000217 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000217 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000218 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000218 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000219 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000219 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000773 ;
    owl:allValuesFrom MIXS:AeroStrucEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000773 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000140 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000140 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000774 ;
    owl:allValuesFrom MIXS:ArchStrucEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000774 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000775 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000775 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000141 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000141 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000142 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000142 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000776 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000776 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000777 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000777 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000145 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000145 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000778 ;
    owl:allValuesFrom MIXS:BuiltStrucSetEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000778 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000721 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000721 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000148 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000148 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000779 ;
    owl:allValuesFrom MIXS:DamagedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000779 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000780 ;
    owl:allValuesFrom MIXS:CeilFinishMatEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000780 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000781 ;
    owl:allValuesFrom MIXS:MoldVisibilityEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000781 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000782 ;
    owl:allValuesFrom MIXS:CeilStrucEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000782 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000783 ;
    owl:allValuesFrom MIXS:CeilingWallTextureEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000783 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000143 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000143 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000784 ;
    owl:allValuesFrom MIXS:CeilTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000784 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000785 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000785 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000786 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000786 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000787 ;
    owl:allValuesFrom MIXS:BuildDocsEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000787 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000158 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000158 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000788 ;
    owl:allValuesFrom MIXS:DamagedRupturedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000788 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000789 ;
    owl:allValuesFrom MIXS:DoorDirectEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000789 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000790 ;
    owl:allValuesFrom MIXS:CompassDirections8Enum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000790 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000791 ;
    owl:allValuesFrom MIXS:DoorMatEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000791 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000792 ;
    owl:allValuesFrom MIXS:DoorMoveEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000792 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000793 ;
    owl:allValuesFrom MIXS:MoldVisibilityEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000793 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000794 ;
    owl:allValuesFrom MIXS:DoorTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000794 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000795 ;
    owl:allValuesFrom MIXS:DoorCompTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000795 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000796 ;
    owl:allValuesFrom MIXS:DoorTypeMetalEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000796 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000797 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000797 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000798 ;
    owl:allValuesFrom MIXS:DrawingsEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000798 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000799 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000799 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000800 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000800 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000144 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000144 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000220 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000220 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000170 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000170 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000802 ;
    owl:allValuesFrom MIXS:FireplaceTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000802 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000164 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000164 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000165 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000165 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000803 ;
    owl:allValuesFrom MIXS:DamagedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000803 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000225 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000804 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000804 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000805 ;
    owl:allValuesFrom MIXS:FloorWaterMoldEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000805 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000806 ;
    owl:allValuesFrom MIXS:FloorStrucEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000806 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000166 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000166 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000226 ;
    owl:allValuesFrom MIXS:FreqCleanEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000226 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000227 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000227 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000807 ;
    owl:allValuesFrom MIXS:FurnitureEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000807 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000808 ;
    owl:allValuesFrom MIXS:GenderRestroomEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000808 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000228 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000228 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000809 ;
    owl:allValuesFrom MIXS:HandidnessEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000809 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000810 ;
    owl:allValuesFrom MIXS:CompassDirections8Enum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000810 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000812 ;
    owl:allValuesFrom MIXS:HeatSysDelivMethEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000812 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000833 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000833 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000167 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000167 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000168 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000168 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000813 ;
    owl:allValuesFrom MIXS:DamagedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000813 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000814 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000814 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000229 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000229 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000815 ;
    owl:allValuesFrom MIXS:MechStrucEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000815 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000230 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000230 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000231 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000231 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000232 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000232 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000816 ;
    owl:allValuesFrom MIXS:OccupDocumentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000816 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000817 ;
    owl:allValuesFrom MIXS:CompassDirections8Enum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000817 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000818 ;
    owl:allValuesFrom MIXS:CompassDirections8Enum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000818 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000188 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000188 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000819 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000819 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000820 ;
    owl:allValuesFrom MIXS:QuadPosEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000820 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000821 ;
    owl:allValuesFrom MIXS:RelSampLocEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000821 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000169 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000169 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000233 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000233 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000822 ;
    owl:allValuesFrom MIXS:RoomCondtEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000822 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000234 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000234 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000192 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000192 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000193 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000193 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000823 ;
    owl:allValuesFrom MIXS:RoomLocEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000823 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000235 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000235 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000194 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000194 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000236 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000236 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000824 ;
    owl:allValuesFrom MIXS:RoomSampPosEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000824 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000825 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000825 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000195 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000195 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000237 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000237 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000826 ;
    owl:allValuesFrom MIXS:RoomConnectedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000826 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000238 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000238 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000242 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000242 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000243 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000243 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000827 ;
    owl:allValuesFrom MIXS:SampWeatherEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000827 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000828 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o665 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000828 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000244 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000244 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000196 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000196 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000829 ;
    owl:allValuesFrom MIXS:SeasonEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000829 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000830 ;
    owl:allValuesFrom MIXS:SeasonUseEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000830 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000831 ;
    owl:allValuesFrom MIXS:DamagedRupturedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000831 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000832 ;
    owl:allValuesFrom MIXS:ShadingDeviceLocEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000832 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000245 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000245 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000834 ;
    owl:allValuesFrom MIXS:MoldVisibilityEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000834 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000835 ;
    owl:allValuesFrom MIXS:ShadingDeviceTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000835 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000214 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000214 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000836 ;
    owl:allValuesFrom MIXS:SpecificEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000836 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000197 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000197 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000837 ;
    owl:allValuesFrom MIXS:TrainLineEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000837 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000838 ;
    owl:allValuesFrom MIXS:TrainStatLocEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000838 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000839 ;
    owl:allValuesFrom MIXS:TrainStopLocEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000839 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000840 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000840 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000198 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000198 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000841 ;
    owl:allValuesFrom MIXS:WallConstTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000841 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000842 ;
    owl:allValuesFrom MIXS:WallFinishMatEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000842 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000221 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000221 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000843 ;
    owl:allValuesFrom MIXS:CompassDirections8Enum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000843 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000844 ;
    owl:allValuesFrom MIXS:MoldVisibilityEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000844 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000845 ;
    owl:allValuesFrom MIXS:WallSurfTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000845 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000846 ;
    owl:allValuesFrom MIXS:CeilingWallTextureEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000846 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000222 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000222 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000223 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000223 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000847 ;
    owl:allValuesFrom MIXS:WaterFeatTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000847 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000848 ;
    owl:allValuesFrom MIXS:WeekdayEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000848 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000224 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000224 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000849 ;
    owl:allValuesFrom MIXS:DamagedRupturedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000849 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000850 ;
    owl:allValuesFrom MIXS:WindowCoverEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000850 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000851 ;
    owl:allValuesFrom MIXS:WindowHorizPosEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000851 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000852 ;
    owl:allValuesFrom MIXS:CompassDirections8Enum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000852 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000853 ;
    owl:allValuesFrom MIXS:WindowMatEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000853 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000246 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000246 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000854 ;
    owl:allValuesFrom MIXS:MoldVisibilityEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000854 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000855 ;
    owl:allValuesFrom MIXS:WindowStatusEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000855 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000856 ;
    owl:allValuesFrom MIXS:WindowTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000856 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000857 ;
    owl:allValuesFrom MIXS:WindowVertPosEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000857 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

_:o665 xsd:pattern "(?:(?:\\d*1[1-3]th|\\d*1st|\\d*2nd|\\d*3rd|\\d*[04-9]th) floor|basement|lobby)" .

MIXS:Checklist a owl:Class ;
  rdfs:comment "A collection of metadata terms (slots) to minimally describe the sampling and sequencing method of a specimen used to generate a nucleotide sequence." .

MIXS:Extension a owl:Class ;
  rdfs:comment "A collection of recommended metadata terms (slots) developed by community experts, describing the specific context under which a sample was collected." ;
  skos:altLabel "EnvironmentalPackage" .

MIXS:0016019 a owl:Class ;
  rdfs:label "food-animal and animal feed" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and performing sequencing of samples obtained from farm animals and their feed." ;
  skos:altLabel "MIxS-Food (animal and animal feed)" ;
  skos:note "This extension is intended to work alongside the other food extensions (farm environment, food production facility, and human foods) for capturing contextual data across the food supply-chain environment." ;
  MIXS:use_cases "Microbiome of farm animals, their feed, and pet food." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o763 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001335 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001335 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001230 ;
    owl:allValuesFrom MIXS:SampTransportContEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001230 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001183 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001207 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001207 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001211 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001211 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001179 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001144 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001144 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001151 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001151 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001243 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001243 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001244 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001244 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001245 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001245 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001246 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001246 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001247 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001247 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001248 ;
    owl:allValuesFrom MIXS:AnimalBodyCondEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001248 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001130 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001129 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001129 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001180 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001249 ;
    owl:allValuesFrom MIXS:AnimalSexEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001249 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001194 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001194 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001195 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001195 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001196 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001196 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001197 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001197 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001198 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001198 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001117 ;
    owl:allValuesFrom MIXS:CultResultEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001117 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001118 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001200 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001131 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001132 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001132 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001202 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001203 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001208 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001208 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001209 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001134 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001135 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001210 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001212 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001213 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001213 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001178 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001251 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001251 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001214 ;
    owl:allValuesFrom MIXS:FoodTraceListEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001214 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001138 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001140 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001215 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001147 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001216 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001216 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001149 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001152 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001153 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001226 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001226 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001227 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001227 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001154 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001154 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001228 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001228 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001229 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001229 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001231 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001231 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001232 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001232 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001155 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001155 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001157 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001235 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001171 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001169 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001172 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001167 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001168 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001170 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001236 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001237 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001237 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001238 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001238 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001239 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001239 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001240 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001173 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001173 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

_:o763 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0016020 a owl:Class ;
  rdfs:label "food-farm environment" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and performing sequencing of samples obtained from the farm environment, including soil, manure, and food harvesting equipment." ;
  skos:altLabel "MIxS-Food (farm environment)" ;
  skos:note "This extension is intended to work alongside the other food extensions (animals and animal feed, food production facility, and human foods) for capturing contextual data across the food supply-chain environment." ;
  MIXS:use_cases "Microbiome of farm and field crops as well as environmental samples including irrigation, soil amendments, and farm equipment." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000100 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000100 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001335 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001335 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000112 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000114 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000114 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000118 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000118 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000315 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000315 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000318 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000334 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000334 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000337 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000337 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000338 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000338 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000577 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000577 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000578 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000578 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000579 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000579 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000643 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000643 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000645 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000645 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000692 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000692 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000735 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000735 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000736 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000736 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000756 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000757 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000757 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001038 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001044 ;
    owl:allValuesFrom MIXS:GrowthHabitEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001044 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001052 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001062 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001081 ;
    owl:allValuesFrom MIXS:TillageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001106 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001106 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001108 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001108 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000829 ;
    owl:allValuesFrom MIXS:SeasonEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000829 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000998 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000998 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001110 ;
    owl:allValuesFrom MIXS:FarmWaterSourceEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000108 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001114 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001115 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001117 ;
    owl:allValuesFrom MIXS:CultResultEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001117 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001118 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001120 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001120 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001121 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001122 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001123 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001124 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001125 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001125 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001126 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001127 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001127 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001128 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001128 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001129 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001129 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001130 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001131 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001132 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001132 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001133 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001134 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001135 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001136 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001337 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001138 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001140 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001141 ;
    owl:allValuesFrom MIXS:ExtrWeatherEventEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001142 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001144 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001146 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001147 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001148 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001148 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001149 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001150 ;
    owl:allValuesFrom MIXS:PlantReprodCropEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001151 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001151 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001152 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001153 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001154 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001154 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001155 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001155 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001157 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001158 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001158 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001159 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001159 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001160 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001160 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001161 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001161 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001162 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001162 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001163 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001163 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001164 ;
    owl:allValuesFrom MIXS:SoilTextureClassEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001164 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000336 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000336 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000332 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000332 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001167 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001168 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001169 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001170 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001171 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001172 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001173 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001173 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001174 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001174 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001175 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001175 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001176 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001178 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001179 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001180 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001182 ;
    owl:allValuesFrom MIXS:FoodCleanProcEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001182 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016021 a owl:Class ;
  rdfs:label "food-food production facility" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and performing sequencing of samples obtained from food production facilities." ;
  skos:altLabel "MIxS-Food(food production facility)" ;
  skos:note "This extension is intended to work alongside the other food extensions (animals and animal feed, farm environment, and human foods) for capturing contextual data across the food supply-chain environment." ;
  MIXS:use_cases "Microbiome of food production facilities/factories" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o1162 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000124 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000124 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000192 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000192 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000226 ;
    owl:allValuesFrom MIXS:FreqCleanEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000226 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000244 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000244 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000758 ;
    owl:allValuesFrom MIXS:SurfMaterialEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000758 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000764 ;
    owl:allValuesFrom MIXS:IndoorSurfEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000764 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000775 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000775 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000828 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o1192 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000828 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001183 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001154 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001154 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000998 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000998 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001229 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001229 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001228 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001228 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001179 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001213 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001213 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001131 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001131 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001252 ;
    owl:allValuesFrom MIXS:FacilityTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001138 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001231 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001231 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001232 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001232 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001224 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001224 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001147 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001253 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001253 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001254 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001254 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001256 ;
    owl:allValuesFrom MIXS:SampSurfMoistureEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001257 ;
    owl:allValuesFrom MIXS:SampLocConditionEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001257 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001258 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001259 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001216 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001216 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001173 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001173 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001194 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001194 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001117 ;
    owl:allValuesFrom MIXS:CultResultEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001117 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001118 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001153 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001151 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001151 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001227 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001227 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001226 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001226 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001230 ;
    owl:allValuesFrom MIXS:SampTransportContEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001230 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001236 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001223 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001155 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001155 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001238 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001238 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001237 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001237 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001239 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001239 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001240 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001203 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001207 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001207 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001212 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001200 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001214 ;
    owl:allValuesFrom MIXS:FoodTraceListEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001214 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001149 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001234 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001215 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001199 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001201 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001136 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001337 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001206 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001206 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001135 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001202 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001140 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001132 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001132 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001208 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001208 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001134 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001210 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001211 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001178 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001152 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001144 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001209 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

_:o1162 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o1192 xsd:pattern "(?:(?:\\d*1[1-3]th|\\d*1st|\\d*2nd|\\d*3rd|\\d*[04-9]th) floor|basement|lobby)" .

MIXS:0016022 a owl:Class ;
  rdfs:label "food-human foods" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and performing sequencing of samples obtained from human food products." ;
  skos:altLabel "MIxS-Food (human foods)" ;
  skos:note "This extension is intended to work alongside the other food extensions (animals and animal feed, farm environment, and food production facilities) for capturing contextual data across the food supply-chain environment." ;
  MIXS:use_cases "Microbiome of foods intended for human consumption." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o1331 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001335 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001335 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001183 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001184 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001179 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001185 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001186 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001187 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001187 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001188 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001188 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001189 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001189 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001190 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001190 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001191 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001191 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001192 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001192 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001193 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001193 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001194 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001194 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001195 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001195 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001196 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001196 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001197 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001197 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001198 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001198 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001181 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001117 ;
    owl:allValuesFrom MIXS:CultResultEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001117 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001118 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001199 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001200 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001201 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001131 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001132 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001132 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001202 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001203 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001206 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001206 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001207 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001207 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001208 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001208 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001209 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001134 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001135 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001210 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001211 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001212 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001213 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001213 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001178 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001139 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001214 ;
    owl:allValuesFrom MIXS:FoodTraceListEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001214 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001138 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001140 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001215 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001144 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001145 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001147 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001216 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001216 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001217 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001217 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001218 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001218 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001219 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001219 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001220 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001220 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001221 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001221 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001222 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001222 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001223 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001224 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001224 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001149 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001152 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001153 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001226 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001226 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001227 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001227 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001154 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001154 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001228 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001228 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001229 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001229 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001230 ;
    owl:allValuesFrom MIXS:SampTransportContEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001230 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001231 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001231 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001232 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001232 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001151 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001151 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001155 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001155 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001156 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001157 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001235 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001171 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001169 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001172 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001167 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001168 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001170 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001236 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001237 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001237 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001238 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001238 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001239 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001239 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001240 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001173 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001173 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

_:o1331 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0016002 a owl:Class ;
  rdfs:label "host-associated" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from a non-human host, to examine the host-associated microbiome or genome." ;
  skos:altLabel "MIxS-host-associated" ;
  skos:note "This is a very broad package, intended to capture many kinds of sequences derived from the bodies of or derived from an organism. Where possible, please use a more specific package. For example, consider using food-animal and animal feed extension for sampling of farm animals reared for consumption. For human stool microbiomes, consider MIxS-human-gut. Incidental associations of environmental material with an organism may also be better served by other packages. For example, nucleic acids derived from soil that was sampled from the hoof of a cow may be better described by terms from the soil extension; however, soil embedded in a wound on a cow’s leg would be best described by terms in this extension" ;
  MIXS:use_cases "elephant fecal matter or cat oral cavity" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000858 ;
    owl:allValuesFrom MIXS:BiolStatEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000858 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000860 ;
    owl:allValuesFrom MIXS:SampCaptStatusEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000860 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000249 ;
    owl:allValuesFrom MIXS:SampDisStageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000249 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000866 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000866 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000871 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000871 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000252 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000252 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000258 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000258 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000259 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000259 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000260 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000260 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000261 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000261 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000875 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000875 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016003 a owl:Class ;
  rdfs:label "human-associated" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from a person to examine their human-associated microbiome or genome, that does not have a specific extension (e.g., skin, gut, vaginal)." ;
  skos:altLabel "MIxS-human-associated" ;
  skos:note "For stool samples use MIxS-human-gut extension." ;
  MIXS:use_cases "blood samples or biopsy samples." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000262 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000262 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000265 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000265 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000894 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000266 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000266 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000295 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000295 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000267 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000268 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000326 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000326 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000898 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000898 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000269 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000270 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000271 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000272 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000272 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000273 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000273 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000275 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000275 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000276 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000276 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000277 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000278 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000899 ;
    owl:allValuesFrom MIXS:UrineCollectMethEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000899 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016004 a owl:Class ;
  rdfs:label "human-gut" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from a person to examine their gut-associated microbiome." ;
  skos:altLabel "MIxS-human-gut" ;
  MIXS:use_cases "human stool or fecal samples, or samples collected directly from the gut." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000280 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000282 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000905 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016005 a owl:Class ;
  rdfs:label "human-oral" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from a person to examine their oral-associated microbiome." ;
  skos:altLabel "MIxS-human-oral" ;
  MIXS:use_cases "mouth swab sampling, dental microbiome samples, microbiome of oral swabs, nasal, mouth, throat, teeth, tongue microbiome studies" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000283 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000924 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000924 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016006 a owl:Class ;
  rdfs:label "human-skin" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from a person to examine their skin-associated microbiome." ;
  skos:altLabel "MIxS-human-skin" ;
  MIXS:use_cases "swab samples taken on a person’s skin surface." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000284 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000943 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000943 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000944 ;
    owl:allValuesFrom MIXS:DominantHandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000944 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016007 a owl:Class ;
  rdfs:label "human-vaginal" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from a person to examine their vaginal-associated microbiome." ;
  skos:altLabel "MIxS-human-vaginal" ;
  MIXS:use_cases "vaginal swabbing" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000965 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000965 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000285 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000285 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000966 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000966 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000967 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000967 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000286 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000286 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000968 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000968 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000969 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000969 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000287 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000287 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000288 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000289 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016015 a owl:Class ;
  rdfs:label "hydrocarbon resources-cores" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from environments pertaining to hydrocarbon resources, specifically core samples." ;
  skos:altLabel "MIxS-HCR (hydrocarbon resources-cores)" ;
  MIXS:use_cases "The microbial characterization of hydrocarbon occurrences, defined as the natural and artificial environmental features that are rich in hydrocarbons, from hydrocarbon rich formations, such as reservoir cores." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000988 ;
    owl:allValuesFrom MIXS:HcrEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000988 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000989 ;
    owl:allValuesFrom MIXS:HcProducedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000989 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000290 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000290 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000291 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000291 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000303 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000303 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000393 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000393 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000394 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000395 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000395 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000397 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000404 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000404 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000211 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000211 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000990 ;
    owl:allValuesFrom MIXS:LithologyEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000990 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000992 ;
    owl:allValuesFrom MIXS:DeposEnvEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000992 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000993 ;
    owl:allValuesFrom MIXS:GeolAgeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000993 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000405 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000405 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000406 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000406 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000407 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000407 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000408 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000408 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000994 ;
    owl:allValuesFrom MIXS:SrKerogTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000994 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000995 ;
    owl:allValuesFrom MIXS:SrLithologyEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000995 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000996 ;
    owl:allValuesFrom MIXS:SrDepEnvEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000996 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000997 ;
    owl:allValuesFrom MIXS:GeolAgeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000997 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000296 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000296 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000297 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000297 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000998 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000998 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000999 ;
    owl:allValuesFrom MIXS:SampSubtypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000999 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000409 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000409 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000413 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000413 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000410 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000410 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000099 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000099 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000298 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000419 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000419 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000102 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000102 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000139 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000139 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000105 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000105 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000106 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000106 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000117 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000117 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000150 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000438 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000438 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000152 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000152 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000153 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000153 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000154 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000154 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000155 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000155 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000156 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000156 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000157 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000157 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000120 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000120 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000126 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000126 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000127 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000127 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000131 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000131 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000133 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000133 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000134 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000134 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000135 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000135 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000300 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000300 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

MIXS:0016016 a owl:Class ;
  rdfs:label "hydrocarbon resources-fluids/swabs" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from environments pertaining to hydrocarbon resources, specifically run-off liquids samples and swabs." ;
  skos:altLabel "MIxS-HCR (hydrocarbon resources-fluids/swabs)" ;
  MIXS:use_cases "The microbial characterization of hydrocarbon occurrences,  defined as the natural and artificial environmental features that are rich in hydrocarbons, from hydrocarbon resource fluids." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000988 ;
    owl:allValuesFrom MIXS:HcrEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000988 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000989 ;
    owl:allValuesFrom MIXS:HcProducedEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000989 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000290 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000290 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000291 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000291 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000303 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000303 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000393 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000393 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000394 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000395 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000395 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000397 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000990 ;
    owl:allValuesFrom MIXS:LithologyEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000990 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000992 ;
    owl:allValuesFrom MIXS:DeposEnvEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000992 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000993 ;
    owl:allValuesFrom MIXS:GeolAgeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000993 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000406 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000406 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000407 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000407 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000408 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000408 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001008 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001008 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000452 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000452 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000453 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000453 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000454 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000454 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000455 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000455 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001010 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001010 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001011 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001011 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000456 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000456 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001012 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000457 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000457 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000136 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000136 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000296 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000296 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000297 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000297 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000998 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000998 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000999 ;
    owl:allValuesFrom MIXS:SampSubtypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000999 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001015 ;
    owl:allValuesFrom MIXS:SampCollectPointEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001015 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000463 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000463 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000410 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000410 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000099 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000099 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000298 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000419 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000419 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000102 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000102 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000139 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000139 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000105 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000105 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000106 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000106 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000117 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000117 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000150 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000438 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000438 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000152 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000152 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000153 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000153 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000154 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000154 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000155 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000155 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000156 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000156 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000157 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000157 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000120 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000120 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000126 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000126 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000127 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000127 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000131 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000131 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000133 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000133 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000134 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000134 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000135 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000135 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000300 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000300 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

MIXS:0016008 a owl:Class ;
  rdfs:label "microbial mat/biofilm" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from biofilm environments including microbial mats." ;
  skos:altLabel "MIxS-microbial mat/biofilm" ;
  MIXS:use_cases "samples from microbial mats at cold seeps" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000490 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000490 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000172 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000172 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000173 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000173 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000174 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000175 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000175 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000310 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000310 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000137 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000498 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000498 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000502 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000502 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000101 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000101 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000503 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000515 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000515 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000516 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000516 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000180 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000181 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000182 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000182 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000525 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000525 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

MIXS:0010003 a owl:Class ;
  rdfs:label "MIGS bacteria" ;
  rdfs:comment "Minimal Information about a Genome Sequence: cultured bacteria/archaea" ;
  skos:altLabel "migs_ba" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000034 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000034 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:allValuesFrom MIXS:BioticRelationshipEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000022 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000022 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000030 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:allValuesFrom MIXS:TaxIdentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:allValuesFrom MIXS:TrophicLevelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o2493 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o2493 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010003_0016018 a owl:Class ;
  rdfs:label "MigsBa combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010003 .

MIXS:0010003_0016000 a owl:Class ;
  rdfs:label "MigsBa combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010003 .

MIXS:0010003_0016001 a owl:Class ;
  rdfs:label "MigsBa combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010003 .

MIXS:0010003_0016019 a owl:Class ;
  rdfs:label "MigsBa combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010003 .

MIXS:0010003_0016020 a owl:Class ;
  rdfs:label "MigsBa combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010003 .

MIXS:0010003_0016021 a owl:Class ;
  rdfs:label "MigsBa combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010003 .

MIXS:0010003_0016022 a owl:Class ;
  rdfs:label "MigsBa combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010003 .

MIXS:0010003_0016002 a owl:Class ;
  rdfs:label "MigsBa combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010003 .

MIXS:0010003_0016003 a owl:Class ;
  rdfs:label "MigsBa combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010003 .

MIXS:0010003_0016004 a owl:Class ;
  rdfs:label "MigsBa combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010003 .

MIXS:0010003_0016005 a owl:Class ;
  rdfs:label "MigsBa combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010003 .

MIXS:0010003_0016006 a owl:Class ;
  rdfs:label "MigsBa combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010003 .

MIXS:0010003_0016007 a owl:Class ;
  rdfs:label "MigsBa combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010003 .

MIXS:0010003_0016015 a owl:Class ;
  rdfs:label "MigsBa combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010003 .

MIXS:0010003_0016016 a owl:Class ;
  rdfs:label "MigsBa combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010003 .

MIXS:0010003_0016008 a owl:Class ;
  rdfs:label "MigsBa combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010003 .

MIXS:0010003_0016009 a owl:Class ;
  rdfs:label "MigsBa combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010003 .

MIXS:0010003_0016010 a owl:Class ;
  rdfs:label "MigsBa combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010003 .

MIXS:0010003_0016011 a owl:Class ;
  rdfs:label "MigsBa combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010003 .

MIXS:0010003_0016012 a owl:Class ;
  rdfs:label "MigsBa combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010003 .

MIXS:0010003_0016023 a owl:Class ;
  rdfs:label "MigsBa combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010003 .

MIXS:0010003_0016013 a owl:Class ;
  rdfs:label "MigsBa combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010003 .

MIXS:0010003_0016014 a owl:Class ;
  rdfs:label "MigsBa combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MigsBa checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010003 .

MIXS:0010002 a owl:Class ;
  rdfs:label "MIGS eukaryote" ;
  rdfs:comment "Minimal Information about a Genome Sequence: eukaryote" ;
  skos:altLabel "migs_eu" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000021 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000021 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000033 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000033 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:allValuesFrom MIXS:BioticRelationshipEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000022 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000022 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000030 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:allValuesFrom MIXS:TaxIdentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:allValuesFrom MIXS:TrophicLevelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o2608 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o2608 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010002_0016018 a owl:Class ;
  rdfs:label "MigsEu combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010002 .

MIXS:0010002_0016000 a owl:Class ;
  rdfs:label "MigsEu combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010002 .

MIXS:0010002_0016001 a owl:Class ;
  rdfs:label "MigsEu combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010002 .

MIXS:0010002_0016019 a owl:Class ;
  rdfs:label "MigsEu combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010002 .

MIXS:0010002_0016020 a owl:Class ;
  rdfs:label "MigsEu combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010002 .

MIXS:0010002_0016021 a owl:Class ;
  rdfs:label "MigsEu combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010002 .

MIXS:0010002_0016022 a owl:Class ;
  rdfs:label "MigsEu combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010002 .

MIXS:0010002_0016002 a owl:Class ;
  rdfs:label "MigsEu combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010002 .

MIXS:0010002_0016003 a owl:Class ;
  rdfs:label "MigsEu combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010002 .

MIXS:0010002_0016004 a owl:Class ;
  rdfs:label "MigsEu combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010002 .

MIXS:0010002_0016005 a owl:Class ;
  rdfs:label "MigsEu combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010002 .

MIXS:0010002_0016006 a owl:Class ;
  rdfs:label "MigsEu combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010002 .

MIXS:0010002_0016007 a owl:Class ;
  rdfs:label "MigsEu combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010002 .

MIXS:0010002_0016015 a owl:Class ;
  rdfs:label "MigsEu combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010002 .

MIXS:0010002_0016016 a owl:Class ;
  rdfs:label "MigsEu combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010002 .

MIXS:0010002_0016008 a owl:Class ;
  rdfs:label "MigsEu combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010002 .

MIXS:0010002_0016009 a owl:Class ;
  rdfs:label "MigsEu combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010002 .

MIXS:0010002_0016010 a owl:Class ;
  rdfs:label "MigsEu combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010002 .

MIXS:0010002_0016011 a owl:Class ;
  rdfs:label "MigsEu combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010002 .

MIXS:0010002_0016012 a owl:Class ;
  rdfs:label "MigsEu combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010002 .

MIXS:0010002_0016023 a owl:Class ;
  rdfs:label "MigsEu combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010002 .

MIXS:0010002_0016013 a owl:Class ;
  rdfs:label "MigsEu combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010002 .

MIXS:0010002_0016014 a owl:Class ;
  rdfs:label "MigsEu combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MigsEu checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010002 .

MIXS:0010006 a owl:Class ;
  rdfs:label "MIGS org" ;
  rdfs:comment "Minimal Information about a Genome Sequence: organelle" ;
  skos:altLabel "migs_org" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:allValuesFrom MIXS:TaxIdentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o2706 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o2706 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010006_0016018 a owl:Class ;
  rdfs:label "MigsOrg combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010006 .

MIXS:0010006_0016000 a owl:Class ;
  rdfs:label "MigsOrg combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010006 .

MIXS:0010006_0016001 a owl:Class ;
  rdfs:label "MigsOrg combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010006 .

MIXS:0010006_0016019 a owl:Class ;
  rdfs:label "MigsOrg combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010006 .

MIXS:0010006_0016020 a owl:Class ;
  rdfs:label "MigsOrg combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010006 .

MIXS:0010006_0016021 a owl:Class ;
  rdfs:label "MigsOrg combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010006 .

MIXS:0010006_0016022 a owl:Class ;
  rdfs:label "MigsOrg combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010006 .

MIXS:0010006_0016002 a owl:Class ;
  rdfs:label "MigsOrg combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010006 .

MIXS:0010006_0016003 a owl:Class ;
  rdfs:label "MigsOrg combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010006 .

MIXS:0010006_0016004 a owl:Class ;
  rdfs:label "MigsOrg combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010006 .

MIXS:0010006_0016005 a owl:Class ;
  rdfs:label "MigsOrg combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010006 .

MIXS:0010006_0016006 a owl:Class ;
  rdfs:label "MigsOrg combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010006 .

MIXS:0010006_0016007 a owl:Class ;
  rdfs:label "MigsOrg combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010006 .

MIXS:0010006_0016015 a owl:Class ;
  rdfs:label "MigsOrg combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010006 .

MIXS:0010006_0016016 a owl:Class ;
  rdfs:label "MigsOrg combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010006 .

MIXS:0010006_0016008 a owl:Class ;
  rdfs:label "MigsOrg combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010006 .

MIXS:0010006_0016009 a owl:Class ;
  rdfs:label "MigsOrg combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010006 .

MIXS:0010006_0016010 a owl:Class ;
  rdfs:label "MigsOrg combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010006 .

MIXS:0010006_0016011 a owl:Class ;
  rdfs:label "MigsOrg combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010006 .

MIXS:0010006_0016012 a owl:Class ;
  rdfs:label "MigsOrg combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010006 .

MIXS:0010006_0016023 a owl:Class ;
  rdfs:label "MigsOrg combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010006 .

MIXS:0010006_0016013 a owl:Class ;
  rdfs:label "MigsOrg combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010006 .

MIXS:0010006_0016014 a owl:Class ;
  rdfs:label "MigsOrg combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MigsOrg checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010006 .

MIXS:0010004 a owl:Class ;
  rdfs:label "MIGS pl" ;
  rdfs:comment "Minimal Information about a Genome Sequence: plasmid" ;
  skos:altLabel "migs_pl" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000034 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000034 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000033 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000033 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000030 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:allValuesFrom MIXS:TaxIdentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o2809 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o2809 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010004_0016018 a owl:Class ;
  rdfs:label "MigsPl combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010004 .

MIXS:0010004_0016000 a owl:Class ;
  rdfs:label "MigsPl combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010004 .

MIXS:0010004_0016001 a owl:Class ;
  rdfs:label "MigsPl combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010004 .

MIXS:0010004_0016019 a owl:Class ;
  rdfs:label "MigsPl combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010004 .

MIXS:0010004_0016020 a owl:Class ;
  rdfs:label "MigsPl combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010004 .

MIXS:0010004_0016021 a owl:Class ;
  rdfs:label "MigsPl combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010004 .

MIXS:0010004_0016022 a owl:Class ;
  rdfs:label "MigsPl combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010004 .

MIXS:0010004_0016002 a owl:Class ;
  rdfs:label "MigsPl combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010004 .

MIXS:0010004_0016003 a owl:Class ;
  rdfs:label "MigsPl combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010004 .

MIXS:0010004_0016004 a owl:Class ;
  rdfs:label "MigsPl combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010004 .

MIXS:0010004_0016005 a owl:Class ;
  rdfs:label "MigsPl combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010004 .

MIXS:0010004_0016006 a owl:Class ;
  rdfs:label "MigsPl combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010004 .

MIXS:0010004_0016007 a owl:Class ;
  rdfs:label "MigsPl combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010004 .

MIXS:0010004_0016015 a owl:Class ;
  rdfs:label "MigsPl combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010004 .

MIXS:0010004_0016016 a owl:Class ;
  rdfs:label "MigsPl combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010004 .

MIXS:0010004_0016008 a owl:Class ;
  rdfs:label "MigsPl combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010004 .

MIXS:0010004_0016009 a owl:Class ;
  rdfs:label "MigsPl combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010004 .

MIXS:0010004_0016010 a owl:Class ;
  rdfs:label "MigsPl combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010004 .

MIXS:0010004_0016011 a owl:Class ;
  rdfs:label "MigsPl combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010004 .

MIXS:0010004_0016012 a owl:Class ;
  rdfs:label "MigsPl combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010004 .

MIXS:0010004_0016023 a owl:Class ;
  rdfs:label "MigsPl combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010004 .

MIXS:0010004_0016013 a owl:Class ;
  rdfs:label "MigsPl combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010004 .

MIXS:0010004_0016014 a owl:Class ;
  rdfs:label "MigsPl combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MigsPl checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010004 .

MIXS:0010005 a owl:Class ;
  rdfs:label "MIGS virus" ;
  rdfs:comment "Minimal Information about a Genome Sequence: virus" ;
  skos:altLabel "migs_vi" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000034 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000034 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000033 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000033 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:allValuesFrom MIXS:BioticRelationshipEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000022 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000022 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000030 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000036 ;
    owl:allValuesFrom MIXS:VirusEnrichApprEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000036 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:allValuesFrom MIXS:TaxIdentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o2922 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o2922 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010005_0016018 a owl:Class ;
  rdfs:label "MigsVi combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010005 .

MIXS:0010005_0016000 a owl:Class ;
  rdfs:label "MigsVi combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010005 .

MIXS:0010005_0016001 a owl:Class ;
  rdfs:label "MigsVi combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010005 .

MIXS:0010005_0016019 a owl:Class ;
  rdfs:label "MigsVi combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010005 .

MIXS:0010005_0016020 a owl:Class ;
  rdfs:label "MigsVi combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010005 .

MIXS:0010005_0016021 a owl:Class ;
  rdfs:label "MigsVi combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010005 .

MIXS:0010005_0016022 a owl:Class ;
  rdfs:label "MigsVi combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010005 .

MIXS:0010005_0016002 a owl:Class ;
  rdfs:label "MigsVi combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010005 .

MIXS:0010005_0016003 a owl:Class ;
  rdfs:label "MigsVi combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010005 .

MIXS:0010005_0016004 a owl:Class ;
  rdfs:label "MigsVi combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010005 .

MIXS:0010005_0016005 a owl:Class ;
  rdfs:label "MigsVi combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010005 .

MIXS:0010005_0016006 a owl:Class ;
  rdfs:label "MigsVi combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010005 .

MIXS:0010005_0016007 a owl:Class ;
  rdfs:label "MigsVi combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010005 .

MIXS:0010005_0016015 a owl:Class ;
  rdfs:label "MigsVi combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010005 .

MIXS:0010005_0016016 a owl:Class ;
  rdfs:label "MigsVi combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010005 .

MIXS:0010005_0016008 a owl:Class ;
  rdfs:label "MigsVi combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010005 .

MIXS:0010005_0016009 a owl:Class ;
  rdfs:label "MigsVi combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010005 .

MIXS:0010005_0016010 a owl:Class ;
  rdfs:label "MigsVi combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010005 .

MIXS:0010005_0016011 a owl:Class ;
  rdfs:label "MigsVi combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010005 .

MIXS:0010005_0016012 a owl:Class ;
  rdfs:label "MigsVi combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010005 .

MIXS:0010005_0016023 a owl:Class ;
  rdfs:label "MigsVi combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010005 .

MIXS:0010005_0016013 a owl:Class ;
  rdfs:label "MigsVi combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010005 .

MIXS:0010005_0016014 a owl:Class ;
  rdfs:label "MigsVi combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MigsVi checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010005 .

MIXS:0010011 a owl:Class ;
  rdfs:label "MIMAG" ;
  rdfs:comment "Minimum Information About a Metagenome-Assembled Genome" ;
  skos:altLabel "mimag" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000005 ;
    owl:allValuesFrom MIXS:ContamScreenInputEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000005 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000067 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000067 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000080 ;
    owl:allValuesFrom MIXS:MagCovSoftwareEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000080 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000077 ;
    owl:allValuesFrom MIXS:BinParamEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000077 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000078 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000078 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000079 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000079 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000074 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000074 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000068 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000068 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000073 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000073 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:allValuesFrom MIXS:TaxIdentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000072 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000072 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000066 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000066 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000065 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000065 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001354 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001354 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001355 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001355 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000071 ;
    owl:allValuesFrom MIXS:ComplApprEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000071 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3048 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o3048 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010011_0016018 a owl:Class ;
  rdfs:label "Mimag combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010011 .

MIXS:0010011_0016000 a owl:Class ;
  rdfs:label "Mimag combined with Air" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010011 .

MIXS:0010011_0016001 a owl:Class ;
  rdfs:label "Mimag combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010011 .

MIXS:0010011_0016019 a owl:Class ;
  rdfs:label "Mimag combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010011 .

MIXS:0010011_0016020 a owl:Class ;
  rdfs:label "Mimag combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010011 .

MIXS:0010011_0016021 a owl:Class ;
  rdfs:label "Mimag combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010011 .

MIXS:0010011_0016022 a owl:Class ;
  rdfs:label "Mimag combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010011 .

MIXS:0010011_0016002 a owl:Class ;
  rdfs:label "Mimag combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010011 .

MIXS:0010011_0016003 a owl:Class ;
  rdfs:label "Mimag combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010011 .

MIXS:0010011_0016004 a owl:Class ;
  rdfs:label "Mimag combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010011 .

MIXS:0010011_0016005 a owl:Class ;
  rdfs:label "Mimag combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010011 .

MIXS:0010011_0016006 a owl:Class ;
  rdfs:label "Mimag combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010011 .

MIXS:0010011_0016007 a owl:Class ;
  rdfs:label "Mimag combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010011 .

MIXS:0010011_0016015 a owl:Class ;
  rdfs:label "Mimag combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010011 .

MIXS:0010011_0016016 a owl:Class ;
  rdfs:label "Mimag combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010011 .

MIXS:0010011_0016008 a owl:Class ;
  rdfs:label "Mimag combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010011 .

MIXS:0010011_0016009 a owl:Class ;
  rdfs:label "Mimag combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010011 .

MIXS:0010011_0016010 a owl:Class ;
  rdfs:label "Mimag combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010011 .

MIXS:0010011_0016011 a owl:Class ;
  rdfs:label "Mimag combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010011 .

MIXS:0010011_0016012 a owl:Class ;
  rdfs:label "Mimag combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010011 .

MIXS:0010011_0016023 a owl:Class ;
  rdfs:label "Mimag combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010011 .

MIXS:0010011_0016013 a owl:Class ;
  rdfs:label "Mimag combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010011 .

MIXS:0010011_0016014 a owl:Class ;
  rdfs:label "Mimag combined with Water" ;
  rdfs:comment "MIxS Data that comply with the Mimag checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010011 .

MIXS:0010009 a owl:Class ;
  rdfs:label "MIMARKS specimen" ;
  rdfs:comment "Minimal Information about a Marker Sequence: specimen" ;
  skos:altLabel "mimarks_c" , "MIMARKS-SU" , "MIMARKS-specimen" ;
  skos:note "for marker gene sequences from cultured or voucher-identifiable specimens" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000046 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000046 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000045 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000045 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000049 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000049 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:allValuesFrom MIXS:BioticRelationshipEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000051 ;
    owl:allValuesFrom MIXS:SeqQualityCheckEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000051 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000052 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000052 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:allValuesFrom MIXS:TrophicLevelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3122 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000044 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000044 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o3122 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010009_0016018 a owl:Class ;
  rdfs:label "MimarksC combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010009 .

MIXS:0010009_0016000 a owl:Class ;
  rdfs:label "MimarksC combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010009 .

MIXS:0010009_0016001 a owl:Class ;
  rdfs:label "MimarksC combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010009 .

MIXS:0010009_0016019 a owl:Class ;
  rdfs:label "MimarksC combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010009 .

MIXS:0010009_0016020 a owl:Class ;
  rdfs:label "MimarksC combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010009 .

MIXS:0010009_0016021 a owl:Class ;
  rdfs:label "MimarksC combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010009 .

MIXS:0010009_0016022 a owl:Class ;
  rdfs:label "MimarksC combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010009 .

MIXS:0010009_0016002 a owl:Class ;
  rdfs:label "MimarksC combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010009 .

MIXS:0010009_0016003 a owl:Class ;
  rdfs:label "MimarksC combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010009 .

MIXS:0010009_0016004 a owl:Class ;
  rdfs:label "MimarksC combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010009 .

MIXS:0010009_0016005 a owl:Class ;
  rdfs:label "MimarksC combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010009 .

MIXS:0010009_0016006 a owl:Class ;
  rdfs:label "MimarksC combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010009 .

MIXS:0010009_0016007 a owl:Class ;
  rdfs:label "MimarksC combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010009 .

MIXS:0010009_0016015 a owl:Class ;
  rdfs:label "MimarksC combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010009 .

MIXS:0010009_0016016 a owl:Class ;
  rdfs:label "MimarksC combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010009 .

MIXS:0010009_0016008 a owl:Class ;
  rdfs:label "MimarksC combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010009 .

MIXS:0010009_0016009 a owl:Class ;
  rdfs:label "MimarksC combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010009 .

MIXS:0010015 a owl:Class ;
  rdfs:label "MIMARKS specimen-MISIP" ;
  rdfs:comment "Marker Sequence-specimen with SIP" ;
  skos:altLabel "misip" , "mimarks_c_misip" , "MIMARKS-SU-MISIP" , "MIMARKS-specimen-MISIP" ;
  skos:note "Any changes made to MIMARKS-specimen (MimarksC) should be reflected here. This checklist includes all MIMARKS-specimen terms and additional MISIP terms." ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000046 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000046 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000045 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000045 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000049 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000049 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000003 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000023 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:allValuesFrom MIXS:BioticRelationshipEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000051 ;
    owl:allValuesFrom MIXS:SeqQualityCheckEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000051 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000052 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000052 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:allValuesFrom MIXS:TrophicLevelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000032 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000020 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3198 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000044 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000044 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001338 ;
    owl:allValuesFrom MIXS:IsotopeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001338 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001339 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001339 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001340 ;
    owl:allValuesFrom MIXS:IsotopologLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001340 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001341 ;
    owl:allValuesFrom MIXS:IsotopologApproachEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001341 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001342 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001342 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001343 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001343 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001344 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001344 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001345 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001345 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001346 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001346 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001347 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001347 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001348 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001348 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001349 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:float ;
      owl:withRestrictions ( _:o3227 _:o3228 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001349 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001350 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001350 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001351 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001351 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001352 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001352 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001353 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001353 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

_:o3198 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o3227 xsd:minInclusive "0"^^xsd:float .

_:o3228 xsd:maxInclusive "1"^^xsd:float .

MIXS:0010015_0016018 a owl:Class ;
  rdfs:label "MimarksCMisip combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010015 .

MIXS:0010015_0016000 a owl:Class ;
  rdfs:label "MimarksCMisip combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010015 .

MIXS:0010015_0016001 a owl:Class ;
  rdfs:label "MimarksCMisip combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010015 .

MIXS:0010015_0016019 a owl:Class ;
  rdfs:label "MimarksCMisip combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010015 .

MIXS:0010015_0016020 a owl:Class ;
  rdfs:label "MimarksCMisip combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010015 .

MIXS:0010015_0016021 a owl:Class ;
  rdfs:label "MimarksCMisip combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010015 .

MIXS:0010015_0016022 a owl:Class ;
  rdfs:label "MimarksCMisip combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010015 .

MIXS:0010015_0016002 a owl:Class ;
  rdfs:label "MimarksCMisip combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010015 .

MIXS:0010015_0016003 a owl:Class ;
  rdfs:label "MimarksCMisip combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010015 .

MIXS:0010015_0016004 a owl:Class ;
  rdfs:label "MimarksCMisip combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010015 .

MIXS:0010015_0016005 a owl:Class ;
  rdfs:label "MimarksCMisip combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010015 .

MIXS:0010015_0016006 a owl:Class ;
  rdfs:label "MimarksCMisip combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010015 .

MIXS:0010015_0016007 a owl:Class ;
  rdfs:label "MimarksCMisip combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010015 .

MIXS:0010015_0016015 a owl:Class ;
  rdfs:label "MimarksCMisip combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010015 .

MIXS:0010015_0016016 a owl:Class ;
  rdfs:label "MimarksCMisip combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010015 .

MIXS:0010015_0016008 a owl:Class ;
  rdfs:label "MimarksCMisip combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010015 .

MIXS:0010015_0016009 a owl:Class ;
  rdfs:label "MimarksCMisip combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010015 .

MIXS:0010015_0016010 a owl:Class ;
  rdfs:label "MimarksCMisip combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010015 .

MIXS:0010015_0016011 a owl:Class ;
  rdfs:label "MimarksCMisip combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010015 .

MIXS:0010015_0016012 a owl:Class ;
  rdfs:label "MimarksCMisip combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010015 .

MIXS:0010015_0016023 a owl:Class ;
  rdfs:label "MimarksCMisip combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010015 .

MIXS:0010015_0016013 a owl:Class ;
  rdfs:label "MimarksCMisip combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010015 .

MIXS:0010015_0016014 a owl:Class ;
  rdfs:label "MimarksCMisip combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MimarksCMisip checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010015 .

MIXS:0010009_0016010 a owl:Class ;
  rdfs:label "MimarksC combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010009 .

MIXS:0010009_0016011 a owl:Class ;
  rdfs:label "MimarksC combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010009 .

MIXS:0010009_0016012 a owl:Class ;
  rdfs:label "MimarksC combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010009 .

MIXS:0010009_0016023 a owl:Class ;
  rdfs:label "MimarksC combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010009 .

MIXS:0010009_0016013 a owl:Class ;
  rdfs:label "MimarksC combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010009 .

MIXS:0010009_0016014 a owl:Class ;
  rdfs:label "MimarksC combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MimarksC checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010009 .

MIXS:0010008 a owl:Class ;
  rdfs:label "MIMARKS survey" ;
  rdfs:comment "Minimal Information about a Marker Sequence: survey" ;
  skos:altLabel "mimarks_s" , "MIMARKS-SP" , "MIMARKS-survey" ;
  skos:note "for marker gene sequences obtained directly from the environment" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000046 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000046 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000045 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000045 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000051 ;
    owl:allValuesFrom MIXS:SeqQualityCheckEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000051 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000052 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000052 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000049 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000049 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3317 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000044 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000044 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o3317 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010008_0016018 a owl:Class ;
  rdfs:label "MimarksS combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010008 .

MIXS:0010008_0016000 a owl:Class ;
  rdfs:label "MimarksS combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010008 .

MIXS:0010008_0016001 a owl:Class ;
  rdfs:label "MimarksS combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010008 .

MIXS:0010008_0016019 a owl:Class ;
  rdfs:label "MimarksS combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010008 .

MIXS:0010008_0016020 a owl:Class ;
  rdfs:label "MimarksS combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010008 .

MIXS:0010008_0016021 a owl:Class ;
  rdfs:label "MimarksS combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010008 .

MIXS:0010008_0016022 a owl:Class ;
  rdfs:label "MimarksS combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010008 .

MIXS:0010008_0016002 a owl:Class ;
  rdfs:label "MimarksS combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010008 .

MIXS:0010008_0016003 a owl:Class ;
  rdfs:label "MimarksS combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010008 .

MIXS:0010008_0016004 a owl:Class ;
  rdfs:label "MimarksS combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010008 .

MIXS:0010008_0016005 a owl:Class ;
  rdfs:label "MimarksS combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010008 .

MIXS:0010008_0016006 a owl:Class ;
  rdfs:label "MimarksS combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010008 .

MIXS:0010008_0016007 a owl:Class ;
  rdfs:label "MimarksS combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010008 .

MIXS:0010008_0016015 a owl:Class ;
  rdfs:label "MimarksS combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010008 .

MIXS:0010008_0016016 a owl:Class ;
  rdfs:label "MimarksS combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010008 .

MIXS:0010008_0016008 a owl:Class ;
  rdfs:label "MimarksS combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010008 .

MIXS:0010008_0016009 a owl:Class ;
  rdfs:label "MimarksS combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010008 .

MIXS:0010008_0016010 a owl:Class ;
  rdfs:label "MimarksS combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010008 .

MIXS:0010008_0016011 a owl:Class ;
  rdfs:label "MimarksS combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010008 .

MIXS:0010008_0016012 a owl:Class ;
  rdfs:label "MimarksS combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010008 .

MIXS:0010008_0016023 a owl:Class ;
  rdfs:label "MimarksS combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010008 .

MIXS:0010008_0016013 a owl:Class ;
  rdfs:label "MimarksS combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010008 .

MIXS:0010008_0016014 a owl:Class ;
  rdfs:label "MimarksS combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MimarksS checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010008 .

MIXS:0010007 a owl:Class ;
  rdfs:label "MIMS" ;
  rdfs:comment "Metagenome or Environmental" ;
  skos:altLabel "mims" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3409 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o3409 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010007_0016018 a owl:Class ;
  rdfs:label "Mims combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010007 .

MIXS:0010007_0016000 a owl:Class ;
  rdfs:label "Mims combined with Air" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010007 .

MIXS:0010007_0016001 a owl:Class ;
  rdfs:label "Mims combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010007 .

MIXS:0010007_0016019 a owl:Class ;
  rdfs:label "Mims combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010007 .

MIXS:0010007_0016020 a owl:Class ;
  rdfs:label "Mims combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010007 .

MIXS:0010007_0016021 a owl:Class ;
  rdfs:label "Mims combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010007 .

MIXS:0010007_0016022 a owl:Class ;
  rdfs:label "Mims combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010007 .

MIXS:0010007_0016002 a owl:Class ;
  rdfs:label "Mims combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010007 .

MIXS:0010007_0016002_0016024 a owl:Class ;
  rdfs:label "MimsHostAssociated combined with Ancient" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist, and HostAssociated and Ancient extensions." ;
  rdfs:subClassOf MIXS:0016024 , MIXS:0010007_0016002 , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3424 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3452 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000866 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000866 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000252 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000252 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000261 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000261 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000260 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000260 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000871 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000871 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000258 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000258 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000259 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000259 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000875 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000875 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000858 ;
    owl:allValuesFrom MIXS:BiolStatEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000858 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000249 ;
    owl:allValuesFrom MIXS:SampDisStageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000249 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3550 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000860 ;
    owl:allValuesFrom MIXS:SampCaptStatusEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000860 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3588 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3599 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3635 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o3424 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o3452 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o3550 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o3588 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o3599 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o3635 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0010007_0016003 a owl:Class ;
  rdfs:label "Mims combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010007 .

MIXS:0010007_0016003_0016024 a owl:Class ;
  rdfs:label "MimsHumanAssociated combined with Ancient" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist, and HumanAssociated and Ancient extensions." ;
  rdfs:subClassOf MIXS:0016024 , MIXS:0010007_0016003 , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3671 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3699 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000326 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000326 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000271 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000277 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000269 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000278 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000270 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000265 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000265 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000898 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000898 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000899 ;
    owl:allValuesFrom MIXS:UrineCollectMethEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000899 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000894 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000262 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000262 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000295 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000295 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000266 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000266 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000268 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000267 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000273 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000273 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000272 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000272 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000275 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000275 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000276 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000276 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3802 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3838 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3849 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3885 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o3671 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o3699 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o3802 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o3838 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o3849 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o3885 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0010007_0016004 a owl:Class ;
  rdfs:label "Mims combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010007 .

MIXS:0010007_0016004_0016024 a owl:Class ;
  rdfs:label "MimsHumanGut combined with Ancient" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist, and HumanGut and Ancient extensions." ;
  rdfs:subClassOf MIXS:0016024 , MIXS:0010007_0016004 , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3921 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o3949 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000905 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000282 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000280 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4025 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4061 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4072 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4108 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o3921 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o3949 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o4025 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4061 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4072 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4108 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0010007_0016005 a owl:Class ;
  rdfs:label "Mims combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010007 .

MIXS:0010007_0016005_0016024 a owl:Class ;
  rdfs:label "MimsHumanOral combined with Ancient" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist, and HumanOral and Ancient extensions." ;
  rdfs:subClassOf MIXS:0016024 , MIXS:0010007_0016005 , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4144 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4172 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000924 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000924 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000283 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4248 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4284 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4295 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4331 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o4144 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o4172 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o4248 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4284 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4295 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4331 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0010007_0016006 a owl:Class ;
  rdfs:label "Mims combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010007 .

MIXS:0010007_0016006_0016024 a owl:Class ;
  rdfs:label "MimsHumanSkin combined with Ancient" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist, and HumanSkin and Ancient extensions." ;
  rdfs:subClassOf MIXS:0016024 , MIXS:0010007_0016006 , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4367 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4395 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000895 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000811 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000944 ;
    owl:allValuesFrom MIXS:DominantHandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000944 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000274 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000869 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000870 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000896 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000284 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000943 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000943 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000897 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000884 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4473 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4509 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4520 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4556 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o4367 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o4395 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o4473 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4509 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4520 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4556 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0010007_0016007 a owl:Class ;
  rdfs:label "Mims combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010007 .

MIXS:0010007_0016015 a owl:Class ;
  rdfs:label "Mims combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010007 .

MIXS:0010007_0016016 a owl:Class ;
  rdfs:label "Mims combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010007 .

MIXS:0010007_0016008 a owl:Class ;
  rdfs:label "Mims combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010007 .

MIXS:0010007_0016009 a owl:Class ;
  rdfs:label "Mims combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010007 .

MIXS:0010014 a owl:Class ;
  rdfs:label "MIMS-MISIP" ;
  rdfs:comment "Metagenome or Environmental with SIP" ;
  skos:altLabel "misip" ;
  skos:note "Any changes made to MIMS should be reflected here, in MIMS-MISIP. This checklist includes all MIMS terms and additional MISIP terms." ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4667 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001338 ;
    owl:allValuesFrom MIXS:IsotopeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001338 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001339 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001339 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001340 ;
    owl:allValuesFrom MIXS:IsotopologLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001340 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001341 ;
    owl:allValuesFrom MIXS:IsotopologApproachEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001341 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001342 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001342 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001343 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001343 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001344 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001344 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001345 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001345 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001346 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001346 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001347 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001347 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001348 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001348 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001349 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:float ;
      owl:withRestrictions ( _:o4694 _:o4695 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001349 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001350 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001350 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001351 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001351 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001352 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001352 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001353 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001353 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

_:o4667 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o4694 xsd:minInclusive "0"^^xsd:float .

_:o4695 xsd:maxInclusive "1"^^xsd:float .

MIXS:0010014_0016018 a owl:Class ;
  rdfs:label "MimsMisip combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010014 .

MIXS:0010014_0016000 a owl:Class ;
  rdfs:label "MimsMisip combined with Air" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010014 .

MIXS:0010014_0016001 a owl:Class ;
  rdfs:label "MimsMisip combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010014 .

MIXS:0010014_0016019 a owl:Class ;
  rdfs:label "MimsMisip combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010014 .

MIXS:0010014_0016020 a owl:Class ;
  rdfs:label "MimsMisip combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010014 .

MIXS:0010014_0016021 a owl:Class ;
  rdfs:label "MimsMisip combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010014 .

MIXS:0010014_0016022 a owl:Class ;
  rdfs:label "MimsMisip combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010014 .

MIXS:0010014_0016002 a owl:Class ;
  rdfs:label "MimsMisip combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010014 .

MIXS:0010014_0016003 a owl:Class ;
  rdfs:label "MimsMisip combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010014 .

MIXS:0010014_0016004 a owl:Class ;
  rdfs:label "MimsMisip combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010014 .

MIXS:0010014_0016005 a owl:Class ;
  rdfs:label "MimsMisip combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010014 .

MIXS:0010014_0016006 a owl:Class ;
  rdfs:label "MimsMisip combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010014 .

MIXS:0010014_0016007 a owl:Class ;
  rdfs:label "MimsMisip combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010014 .

MIXS:0010014_0016015 a owl:Class ;
  rdfs:label "MimsMisip combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010014 .

MIXS:0010014_0016016 a owl:Class ;
  rdfs:label "MimsMisip combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010014 .

MIXS:0010014_0016008 a owl:Class ;
  rdfs:label "MimsMisip combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010014 .

MIXS:0010014_0016009 a owl:Class ;
  rdfs:label "MimsMisip combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010014 .

MIXS:0010014_0016010 a owl:Class ;
  rdfs:label "MimsMisip combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010014 .

MIXS:0010014_0016011 a owl:Class ;
  rdfs:label "MimsMisip combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010014 .

MIXS:0010014_0016012 a owl:Class ;
  rdfs:label "MimsMisip combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010014 .

MIXS:0010014_0016023 a owl:Class ;
  rdfs:label "MimsMisip combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010014 .

MIXS:0010014_0016013 a owl:Class ;
  rdfs:label "MimsMisip combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010014 .

MIXS:0010014_0016014 a owl:Class ;
  rdfs:label "MimsMisip combined with Water" ;
  rdfs:comment "MIxS Data that comply with the MimsMisip checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010014 .

MIXS:0010007_0016010 a owl:Class ;
  rdfs:label "Mims combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010007 .

MIXS:0010007_0016010_0016024 a owl:Class ;
  rdfs:label "MimsPlantAssociated combined with Ancient" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist, and PlantAssociated and Ancient extensions." ;
  rdfs:subClassOf MIXS:0016024 , MIXS:0010007_0016010 , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4717 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4745 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001059 ;
    owl:allValuesFrom MIXS:PlantSexEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000567 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000567 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000858 ;
    owl:allValuesFrom MIXS:BiolStatEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000858 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000249 ;
    owl:allValuesFrom MIXS:SampDisStageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000249 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4820 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000860 ;
    owl:allValuesFrom MIXS:SampCaptStatusEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000860 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000551 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000553 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000556 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000557 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000561 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000568 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000570 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000571 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000573 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001056 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000582 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000590 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000591 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000560 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000569 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000569 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000575 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000576 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001040 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000558 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001068 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000555 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001041 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000577 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000577 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000578 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000578 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000579 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000579 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001062 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000581 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000581 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000580 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000580 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001070 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000559 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001044 ;
    owl:allValuesFrom MIXS:GrowthHabitEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001044 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001052 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001060 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4912 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4923 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4959 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o4717 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o4745 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o4820 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4912 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4923 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o4959 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0010007_0016011 a owl:Class ;
  rdfs:label "Mims combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010007 .

MIXS:0010007_0016011_0016024 a owl:Class ;
  rdfs:label "MimsSediment combined with Ancient" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist, and Sediment and Ancient extensions." ;
  rdfs:subClassOf MIXS:0016024 , MIXS:0010007_0016011 , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o4995 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5023 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000750 ;
    owl:allValuesFrom MIXS:TidalStageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000750 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000634 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000634 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5066 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001078 ;
    owl:allValuesFrom MIXS:SedimentTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001078 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000206 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000211 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000211 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000498 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000498 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000502 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000502 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000182 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000182 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000525 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000525 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000515 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000515 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000310 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000310 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000101 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000101 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000490 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000490 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000503 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000181 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000175 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000175 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000516 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000516 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000180 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000173 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000173 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000172 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000172 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000137 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000174 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5200 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5211 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5247 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o4995 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o5023 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o5066 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o5200 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o5211 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o5247 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0010007_0016012 a owl:Class ;
  rdfs:label "Mims combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010007 .

MIXS:0010007_0016012_0016024 a owl:Class ;
  rdfs:label "MimsSoil combined with Ancient" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist, and Soil and Ancient extensions." ;
  rdfs:subClassOf MIXS:0016024 , MIXS:0010007_0016012 , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001356 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001357 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001358 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001359 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5283 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001360 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001361 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001363 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001362 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001082 ;
    owl:allValuesFrom MIXS:SoilHorizonEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001082 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000321 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001081 ;
    owl:allValuesFrom MIXS:TillageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001084 ;
    owl:allValuesFrom MIXS:ProfilePositionEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001084 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000647 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000647 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000646 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000646 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000330 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000330 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000331 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000331 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000329 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000329 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000328 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000328 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001083 ;
    owl:allValuesFrom MIXS:FaoClassEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001083 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001085 ;
    owl:allValuesFrom MIXS:DrainageClassEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001085 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000642 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000642 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000643 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000643 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000644 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000644 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000645 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000645 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000320 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000320 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001086 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001086 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000319 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000319 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001080 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001080 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000312 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000312 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000314 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000314 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000318 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000639 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000316 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000316 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000315 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000315 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5358 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001369 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001364 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001366 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001367 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001368 ;
    owl:allValuesFrom MIXS:BioCulturalLabelEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001375 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001376 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001377 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:allValuesFrom MIXS:ChronoAgeSysEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001378 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001379 ;
    owl:allValuesFrom MIXS:ChronoAgeProtocolEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001380 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:allValuesFrom MIXS:GeolEpochEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001374 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001373 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001372 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001371 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001381 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001370 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5396 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000332 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000332 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000334 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000334 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000335 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000335 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000336 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000336 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000323 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000323 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001106 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001106 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000337 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000337 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000338 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000338 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000652 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000343 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000343 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000607 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000607 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000324 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000324 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000650 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000650 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000339 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000339 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000340 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000340 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001382 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:allValuesFrom MIXS:SampCategoryEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001383 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001384 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5464 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001386 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001387 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5477 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001389 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:allValuesFrom MIXS:DamageTreatmentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001385 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:allValuesFrom MIXS:LibStrandEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001391 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001388 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:allValuesFrom MIXS:LibTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001392 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001390 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001396 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001397 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001395 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001394 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001393 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5513 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001398 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001399 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o5283 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

_:o5358 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

_:o5396 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o5464 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o5477 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

_:o5513 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0010007_0016023 a owl:Class ;
  rdfs:label "Mims combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010007 .

MIXS:0010007_0016013 a owl:Class ;
  rdfs:label "Mims combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010007 .

MIXS:0010007_0016014 a owl:Class ;
  rdfs:label "Mims combined with Water" ;
  rdfs:comment "MIxS Data that comply with the Mims checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010007 .

MIXS:0010010 a owl:Class ;
  rdfs:label "Minimum Information About a Single Amplified Genome" ;
  rdfs:comment "Minimum Information About a Single Amplified Genome" ;
  skos:altLabel "misag" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000005 ;
    owl:allValuesFrom MIXS:ContamScreenInputEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000005 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000067 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000067 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:allValuesFrom MIXS:RelToOxygenEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000015 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000006 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000006 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000074 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000074 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000068 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000068 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000054 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000054 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000073 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000073 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:allValuesFrom MIXS:TaxIdentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000072 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000072 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000066 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000066 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000065 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000065 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001354 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001354 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001355 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001355 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000075 ;
    owl:allValuesFrom MIXS:SortTechEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000075 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000055 ;
    owl:allValuesFrom MIXS:WgaAmpApprEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000055 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000071 ;
    owl:allValuesFrom MIXS:ComplApprEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000071 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000076 ;
    owl:allValuesFrom MIXS:ScLysisApproachEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000076 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5662 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o5662 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010010_0016018 a owl:Class ;
  rdfs:label "Misag combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010010 .

MIXS:0010010_0016000 a owl:Class ;
  rdfs:label "Misag combined with Air" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010010 .

MIXS:0010010_0016001 a owl:Class ;
  rdfs:label "Misag combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010010 .

MIXS:0010010_0016019 a owl:Class ;
  rdfs:label "Misag combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010010 .

MIXS:0010010_0016020 a owl:Class ;
  rdfs:label "Misag combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010010 .

MIXS:0010010_0016021 a owl:Class ;
  rdfs:label "Misag combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010010 .

MIXS:0010010_0016022 a owl:Class ;
  rdfs:label "Misag combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010010 .

MIXS:0010010_0016002 a owl:Class ;
  rdfs:label "Misag combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010010 .

MIXS:0010010_0016003 a owl:Class ;
  rdfs:label "Misag combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010010 .

MIXS:0010010_0016004 a owl:Class ;
  rdfs:label "Misag combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010010 .

MIXS:0010010_0016005 a owl:Class ;
  rdfs:label "Misag combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010010 .

MIXS:0010010_0016006 a owl:Class ;
  rdfs:label "Misag combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010010 .

MIXS:0010010_0016007 a owl:Class ;
  rdfs:label "Misag combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010010 .

MIXS:0010010_0016015 a owl:Class ;
  rdfs:label "Misag combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010010 .

MIXS:0010010_0016016 a owl:Class ;
  rdfs:label "Misag combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010010 .

MIXS:0010010_0016008 a owl:Class ;
  rdfs:label "Misag combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010010 .

MIXS:0010010_0016009 a owl:Class ;
  rdfs:label "Misag combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010010 .

MIXS:0010010_0016010 a owl:Class ;
  rdfs:label "Misag combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010010 .

MIXS:0010010_0016011 a owl:Class ;
  rdfs:label "Misag combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010010 .

MIXS:0010010_0016012 a owl:Class ;
  rdfs:label "Misag combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010010 .

MIXS:0010010_0016023 a owl:Class ;
  rdfs:label "Misag combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010010 .

MIXS:0010010_0016013 a owl:Class ;
  rdfs:label "Misag combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010010 .

MIXS:0010010_0016014 a owl:Class ;
  rdfs:label "Misag combined with Water" ;
  rdfs:comment "MIxS Data that comply with the Misag checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010010 .

MIXS:0016009 a owl:Class ;
  rdfs:label "miscellaneous natural or artificial environment" ;
  rdfs:comment "A collection of generic terms appropriate when collecting and sequencing samples obtained from environments, where there is no specific extension already available." ;
  skos:altLabel "MIxS-miscellaneous natural or artificial environment" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000174 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000181 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000203 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000203 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

MIXS:0010012 a owl:Class ;
  rdfs:label "Minimum Information About an Uncultivated Virus Genome" ;
  rdfs:comment "Minimum Information About an Uncultivated Virus Genome" ;
  skos:altLabel "miuvig" ;
  rdfs:subClassOf MIXS:Checklist , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000017 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000035 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000035 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000038 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000039 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000047 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000069 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000067 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000067 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000037 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000024 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000027 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000040 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000002 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:allValuesFrom xsd:integer
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000060 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:allValuesFrom MIXS:BioticRelationshipEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000028 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000068 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000068 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:allValuesFrom MIXS:LibLayoutEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:allValuesFrom MIXS:AssemblyQualEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000056 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000025 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000042 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000030 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:allValuesFrom MIXS:NegContTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000036 ;
    owl:allValuesFrom MIXS:VirusEnrichApprEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000036 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000048 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000058 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:allValuesFrom MIXS:TaxIdentEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000053 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000070 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000013 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000016 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001225 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000071 ;
    owl:allValuesFrom MIXS:ComplApprEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000071 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000029 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000014 ;
    owl:minCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001320 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000050 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000012 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000064 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000008 ;
    owl:allValuesFrom [
      a rdfs:Datatype ;
      owl:onDatatype xsd:string ;
      owl:withRestrictions ( _:o5862 )
    ]
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000075 ;
    owl:allValuesFrom MIXS:SortTechEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000075 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000076 ;
    owl:allValuesFrom MIXS:ScLysisApproachEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000076 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000054 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000054 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000055 ;
    owl:allValuesFrom MIXS:WgaAmpApprEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000055 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000006 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000006 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000077 ;
    owl:allValuesFrom MIXS:BinParamEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000077 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000078 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000078 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000079 ;
    owl:allValuesFrom xsd:boolean
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000079 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000080 ;
    owl:allValuesFrom MIXS:MagCovSoftwareEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000080 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000081 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000081 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000082 ;
    owl:allValuesFrom MIXS:ViralGenomeTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000082 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000083 ;
    owl:allValuesFrom MIXS:PredGenomeStrucEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000083 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000084 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000084 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000085 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000085 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000086 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000086 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000087 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000087 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000088 ;
    owl:allValuesFrom MIXS:HostPredApprEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000088 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000089 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000089 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000091 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000090 ;
    owl:allValuesFrom xsd:string
  ] .

_:o5862 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0010012_0016018 a owl:Class ;
  rdfs:label "Miuvig combined with Agriculture" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the Agriculture Extension" ;
  rdfs:subClassOf MIXS:0016018 , MIXS:0010012 .

MIXS:0010012_0016000 a owl:Class ;
  rdfs:label "Miuvig combined with Air" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the Air Extension" ;
  rdfs:subClassOf MIXS:0016000 , MIXS:0010012 .

MIXS:0010012_0016001 a owl:Class ;
  rdfs:label "Miuvig combined with BuiltEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the BuiltEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016001 , MIXS:0010012 .

MIXS:0010012_0016019 a owl:Class ;
  rdfs:label "Miuvig combined with FoodAnimalAndAnimalFeed" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the FoodAnimalAndAnimalFeed Extension" ;
  rdfs:subClassOf MIXS:0016019 , MIXS:0010012 .

MIXS:0010012_0016020 a owl:Class ;
  rdfs:label "Miuvig combined with FoodFarmEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the FoodFarmEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016020 , MIXS:0010012 .

MIXS:0010012_0016021 a owl:Class ;
  rdfs:label "Miuvig combined with FoodFoodProductionFacility" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the FoodFoodProductionFacility Extension" ;
  rdfs:subClassOf MIXS:0016021 , MIXS:0010012 .

MIXS:0010012_0016022 a owl:Class ;
  rdfs:label "Miuvig combined with FoodHumanFoods" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the FoodHumanFoods Extension" ;
  rdfs:subClassOf MIXS:0016022 , MIXS:0010012 .

MIXS:0010012_0016002 a owl:Class ;
  rdfs:label "Miuvig combined with HostAssociated" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the HostAssociated Extension" ;
  rdfs:subClassOf MIXS:0016002 , MIXS:0010012 .

MIXS:0010012_0016003 a owl:Class ;
  rdfs:label "Miuvig combined with HumanAssociated" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the HumanAssociated Extension" ;
  rdfs:subClassOf MIXS:0016003 , MIXS:0010012 .

MIXS:0010012_0016004 a owl:Class ;
  rdfs:label "Miuvig combined with HumanGut" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the HumanGut Extension" ;
  rdfs:subClassOf MIXS:0016004 , MIXS:0010012 .

MIXS:0010012_0016005 a owl:Class ;
  rdfs:label "Miuvig combined with HumanOral" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the HumanOral Extension" ;
  rdfs:subClassOf MIXS:0016005 , MIXS:0010012 .

MIXS:0010012_0016006 a owl:Class ;
  rdfs:label "Miuvig combined with HumanSkin" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the HumanSkin Extension" ;
  rdfs:subClassOf MIXS:0016006 , MIXS:0010012 .

MIXS:0010012_0016007 a owl:Class ;
  rdfs:label "Miuvig combined with HumanVaginal" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the HumanVaginal Extension" ;
  rdfs:subClassOf MIXS:0016007 , MIXS:0010012 .

MIXS:0010012_0016015 a owl:Class ;
  rdfs:label "Miuvig combined with HydrocarbonResourcesCores" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the HydrocarbonResourcesCores Extension" ;
  rdfs:subClassOf MIXS:0016015 , MIXS:0010012 .

MIXS:0010012_0016016 a owl:Class ;
  rdfs:label "Miuvig combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the HydrocarbonResourcesFluidsSwabs Extension" ;
  rdfs:subClassOf MIXS:0016016 , MIXS:0010012 .

MIXS:0010012_0016008 a owl:Class ;
  rdfs:label "Miuvig combined with MicrobialMatBiofilm" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the MicrobialMatBiofilm Extension" ;
  rdfs:subClassOf MIXS:0016008 , MIXS:0010012 .

MIXS:0010012_0016009 a owl:Class ;
  rdfs:label "Miuvig combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the MiscellaneousNaturalOrArtificialEnvironment Extension" ;
  rdfs:subClassOf MIXS:0016009 , MIXS:0010012 .

MIXS:0010012_0016010 a owl:Class ;
  rdfs:label "Miuvig combined with PlantAssociated" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the PlantAssociated Extension" ;
  rdfs:subClassOf MIXS:0016010 , MIXS:0010012 .

MIXS:0010012_0016011 a owl:Class ;
  rdfs:label "Miuvig combined with Sediment" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the Sediment Extension" ;
  rdfs:subClassOf MIXS:0016011 , MIXS:0010012 .

MIXS:0010012_0016012 a owl:Class ;
  rdfs:label "Miuvig combined with Soil" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the Soil Extension" ;
  rdfs:subClassOf MIXS:0016012 , MIXS:0010012 .

MIXS:0010012_0016023 a owl:Class ;
  rdfs:label "Miuvig combined with SymbiontAssociated" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the SymbiontAssociated Extension" ;
  rdfs:subClassOf MIXS:0016023 , MIXS:0010012 .

MIXS:0010012_0016013 a owl:Class ;
  rdfs:label "Miuvig combined with WastewaterSludge" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the WastewaterSludge Extension" ;
  rdfs:subClassOf MIXS:0016013 , MIXS:0010012 .

MIXS:0010012_0016014 a owl:Class ;
  rdfs:label "Miuvig combined with Water" ;
  rdfs:comment "MIxS Data that comply with the Miuvig checklist and the Water Extension" ;
  rdfs:subClassOf MIXS:0016014 , MIXS:0010012 .

MIXS:MixsCompliantData a owl:Class ;
  rdfs:label "MIxS compliant data" ;
  rdfs:comment "A collection of Data that comply with some combination of a MIxS checklist and environmental extension" ;
  rdfs:subClassOf [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_data ;
    owl:allValuesFrom MIXS:0010003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:agriculture_data ;
    owl:allValuesFrom MIXS:0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_agriculture_data ;
    owl:allValuesFrom MIXS:0010003_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:air_data ;
    owl:allValuesFrom MIXS:0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_air_data ;
    owl:allValuesFrom MIXS:0010003_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:built_environment_data ;
    owl:allValuesFrom MIXS:0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_built_environment_data ;
    owl:allValuesFrom MIXS:0010003_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010003_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:food_farm_environment_data ;
    owl:allValuesFrom MIXS:0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010003_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010003_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:food_human_foods_data ;
    owl:allValuesFrom MIXS:0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010003_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:host_associated_data ;
    owl:allValuesFrom MIXS:0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_host_associated_data ;
    owl:allValuesFrom MIXS:0010003_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:human_associated_data ;
    owl:allValuesFrom MIXS:0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_human_associated_data ;
    owl:allValuesFrom MIXS:0010003_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:human_gut_data ;
    owl:allValuesFrom MIXS:0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_human_gut_data ;
    owl:allValuesFrom MIXS:0010003_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:human_oral_data ;
    owl:allValuesFrom MIXS:0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_human_oral_data ;
    owl:allValuesFrom MIXS:0010003_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:human_skin_data ;
    owl:allValuesFrom MIXS:0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_human_skin_data ;
    owl:allValuesFrom MIXS:0010003_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:human_vaginal_data ;
    owl:allValuesFrom MIXS:0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010003_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010003_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010003_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010003_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010003_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:plant_associated_data ;
    owl:allValuesFrom MIXS:0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_plant_associated_data ;
    owl:allValuesFrom MIXS:0010003_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:sediment_data ;
    owl:allValuesFrom MIXS:0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_sediment_data ;
    owl:allValuesFrom MIXS:0010003_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:soil_data ;
    owl:allValuesFrom MIXS:0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_soil_data ;
    owl:allValuesFrom MIXS:0010003_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:symbiont_associated_data ;
    owl:allValuesFrom MIXS:0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010003_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010003_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:water_data ;
    owl:allValuesFrom MIXS:0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_ba_water_data ;
    owl:allValuesFrom MIXS:0010003_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_data ;
    owl:allValuesFrom MIXS:0010002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_agriculture_data ;
    owl:allValuesFrom MIXS:0010002_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_air_data ;
    owl:allValuesFrom MIXS:0010002_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_built_environment_data ;
    owl:allValuesFrom MIXS:0010002_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010002_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010002_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010002_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010002_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_host_associated_data ;
    owl:allValuesFrom MIXS:0010002_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_human_associated_data ;
    owl:allValuesFrom MIXS:0010002_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_human_gut_data ;
    owl:allValuesFrom MIXS:0010002_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_human_oral_data ;
    owl:allValuesFrom MIXS:0010002_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_human_skin_data ;
    owl:allValuesFrom MIXS:0010002_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010002_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010002_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010002_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010002_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010002_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_plant_associated_data ;
    owl:allValuesFrom MIXS:0010002_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_sediment_data ;
    owl:allValuesFrom MIXS:0010002_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_soil_data ;
    owl:allValuesFrom MIXS:0010002_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010002_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010002_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_eu_water_data ;
    owl:allValuesFrom MIXS:0010002_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_data ;
    owl:allValuesFrom MIXS:0010006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_agriculture_data ;
    owl:allValuesFrom MIXS:0010006_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_air_data ;
    owl:allValuesFrom MIXS:0010006_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_built_environment_data ;
    owl:allValuesFrom MIXS:0010006_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010006_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010006_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010006_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010006_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_host_associated_data ;
    owl:allValuesFrom MIXS:0010006_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_human_associated_data ;
    owl:allValuesFrom MIXS:0010006_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_human_gut_data ;
    owl:allValuesFrom MIXS:0010006_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_human_oral_data ;
    owl:allValuesFrom MIXS:0010006_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_human_skin_data ;
    owl:allValuesFrom MIXS:0010006_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010006_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010006_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010006_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010006_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010006_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_plant_associated_data ;
    owl:allValuesFrom MIXS:0010006_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_sediment_data ;
    owl:allValuesFrom MIXS:0010006_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_soil_data ;
    owl:allValuesFrom MIXS:0010006_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010006_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010006_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_org_water_data ;
    owl:allValuesFrom MIXS:0010006_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_data ;
    owl:allValuesFrom MIXS:0010004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_agriculture_data ;
    owl:allValuesFrom MIXS:0010004_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_air_data ;
    owl:allValuesFrom MIXS:0010004_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_built_environment_data ;
    owl:allValuesFrom MIXS:0010004_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010004_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010004_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010004_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010004_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_host_associated_data ;
    owl:allValuesFrom MIXS:0010004_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_human_associated_data ;
    owl:allValuesFrom MIXS:0010004_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_human_gut_data ;
    owl:allValuesFrom MIXS:0010004_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_human_oral_data ;
    owl:allValuesFrom MIXS:0010004_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_human_skin_data ;
    owl:allValuesFrom MIXS:0010004_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010004_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010004_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010004_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010004_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010004_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_plant_associated_data ;
    owl:allValuesFrom MIXS:0010004_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_sediment_data ;
    owl:allValuesFrom MIXS:0010004_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_soil_data ;
    owl:allValuesFrom MIXS:0010004_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010004_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010004_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_pl_water_data ;
    owl:allValuesFrom MIXS:0010004_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_data ;
    owl:allValuesFrom MIXS:0010005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_agriculture_data ;
    owl:allValuesFrom MIXS:0010005_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_air_data ;
    owl:allValuesFrom MIXS:0010005_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_built_environment_data ;
    owl:allValuesFrom MIXS:0010005_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010005_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010005_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010005_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010005_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_host_associated_data ;
    owl:allValuesFrom MIXS:0010005_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_human_associated_data ;
    owl:allValuesFrom MIXS:0010005_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_human_gut_data ;
    owl:allValuesFrom MIXS:0010005_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_human_oral_data ;
    owl:allValuesFrom MIXS:0010005_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_human_skin_data ;
    owl:allValuesFrom MIXS:0010005_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010005_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010005_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010005_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010005_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010005_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_plant_associated_data ;
    owl:allValuesFrom MIXS:0010005_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_sediment_data ;
    owl:allValuesFrom MIXS:0010005_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_soil_data ;
    owl:allValuesFrom MIXS:0010005_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010005_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010005_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:migs_vi_water_data ;
    owl:allValuesFrom MIXS:0010005_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_data ;
    owl:allValuesFrom MIXS:0010011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_agriculture_data ;
    owl:allValuesFrom MIXS:0010011_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_air_data ;
    owl:allValuesFrom MIXS:0010011_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_built_environment_data ;
    owl:allValuesFrom MIXS:0010011_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010011_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010011_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010011_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010011_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_host_associated_data ;
    owl:allValuesFrom MIXS:0010011_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_human_associated_data ;
    owl:allValuesFrom MIXS:0010011_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_human_gut_data ;
    owl:allValuesFrom MIXS:0010011_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_human_oral_data ;
    owl:allValuesFrom MIXS:0010011_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_human_skin_data ;
    owl:allValuesFrom MIXS:0010011_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010011_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010011_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010011_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010011_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010011_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_plant_associated_data ;
    owl:allValuesFrom MIXS:0010011_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_sediment_data ;
    owl:allValuesFrom MIXS:0010011_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_soil_data ;
    owl:allValuesFrom MIXS:0010011_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010011_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010011_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimag_water_data ;
    owl:allValuesFrom MIXS:0010011_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_data ;
    owl:allValuesFrom MIXS:0010009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_agriculture_data ;
    owl:allValuesFrom MIXS:0010009_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_air_data ;
    owl:allValuesFrom MIXS:0010009_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_built_environment_data ;
    owl:allValuesFrom MIXS:0010009_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010009_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010009_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010009_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010009_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_host_associated_data ;
    owl:allValuesFrom MIXS:0010009_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_human_associated_data ;
    owl:allValuesFrom MIXS:0010009_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_human_gut_data ;
    owl:allValuesFrom MIXS:0010009_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_human_oral_data ;
    owl:allValuesFrom MIXS:0010009_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_human_skin_data ;
    owl:allValuesFrom MIXS:0010009_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010009_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010009_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010009_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010009_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010009_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_plant_associated_data ;
    owl:allValuesFrom MIXS:0010009_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_sediment_data ;
    owl:allValuesFrom MIXS:0010009_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_soil_data ;
    owl:allValuesFrom MIXS:0010009_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010009_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010009_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_water_data ;
    owl:allValuesFrom MIXS:0010009_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_data ;
    owl:allValuesFrom MIXS:0010015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_agriculture_data ;
    owl:allValuesFrom MIXS:0010015_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_air_data ;
    owl:allValuesFrom MIXS:0010015_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_built_environment_data ;
    owl:allValuesFrom MIXS:0010015_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010015_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010015_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010015_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010015_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_host_associated_data ;
    owl:allValuesFrom MIXS:0010015_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_human_associated_data ;
    owl:allValuesFrom MIXS:0010015_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_human_gut_data ;
    owl:allValuesFrom MIXS:0010015_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_human_oral_data ;
    owl:allValuesFrom MIXS:0010015_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_human_skin_data ;
    owl:allValuesFrom MIXS:0010015_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010015_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010015_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010015_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010015_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010015_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_plant_associated_data ;
    owl:allValuesFrom MIXS:0010015_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_sediment_data ;
    owl:allValuesFrom MIXS:0010015_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_soil_data ;
    owl:allValuesFrom MIXS:0010015_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010015_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010015_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_c_misip_water_data ;
    owl:allValuesFrom MIXS:0010015_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_data ;
    owl:allValuesFrom MIXS:0010008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_agriculture_data ;
    owl:allValuesFrom MIXS:0010008_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_air_data ;
    owl:allValuesFrom MIXS:0010008_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_built_environment_data ;
    owl:allValuesFrom MIXS:0010008_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010008_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010008_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010008_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010008_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_host_associated_data ;
    owl:allValuesFrom MIXS:0010008_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_human_associated_data ;
    owl:allValuesFrom MIXS:0010008_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_human_gut_data ;
    owl:allValuesFrom MIXS:0010008_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_human_oral_data ;
    owl:allValuesFrom MIXS:0010008_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_human_skin_data ;
    owl:allValuesFrom MIXS:0010008_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010008_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010008_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010008_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010008_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010008_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_plant_associated_data ;
    owl:allValuesFrom MIXS:0010008_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_sediment_data ;
    owl:allValuesFrom MIXS:0010008_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_soil_data ;
    owl:allValuesFrom MIXS:0010008_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010008_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010008_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimarks_s_water_data ;
    owl:allValuesFrom MIXS:0010008_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_data ;
    owl:allValuesFrom MIXS:0010007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_agriculture_data ;
    owl:allValuesFrom MIXS:0010007_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_air_data ;
    owl:allValuesFrom MIXS:0010007_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_built_environment_data ;
    owl:allValuesFrom MIXS:0010007_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010007_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010007_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010007_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010007_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_host_associated_data ;
    owl:allValuesFrom MIXS:0010007_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_human_associated_data ;
    owl:allValuesFrom MIXS:0010007_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_human_gut_data ;
    owl:allValuesFrom MIXS:0010007_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_human_oral_data ;
    owl:allValuesFrom MIXS:0010007_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_human_skin_data ;
    owl:allValuesFrom MIXS:0010007_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010007_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010007_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010007_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010007_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010007_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_plant_associated_data ;
    owl:allValuesFrom MIXS:0010007_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_sediment_data ;
    owl:allValuesFrom MIXS:0010007_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_soil_data ;
    owl:allValuesFrom MIXS:0010007_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010007_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010007_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_water_data ;
    owl:allValuesFrom MIXS:0010007_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_data ;
    owl:allValuesFrom MIXS:0010014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_agriculture_data ;
    owl:allValuesFrom MIXS:0010014_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_air_data ;
    owl:allValuesFrom MIXS:0010014_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_built_environment_data ;
    owl:allValuesFrom MIXS:0010014_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010014_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010014_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimmisip_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010014_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010014_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_host_associated_data ;
    owl:allValuesFrom MIXS:0010014_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_human_associated_data ;
    owl:allValuesFrom MIXS:0010014_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_human_gut_data ;
    owl:allValuesFrom MIXS:0010014_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_human_oral_data ;
    owl:allValuesFrom MIXS:0010014_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_human_skin_data ;
    owl:allValuesFrom MIXS:0010014_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010014_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010014_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010014_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010014_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010014_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_plant_associated_data ;
    owl:allValuesFrom MIXS:0010014_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_sediment_data ;
    owl:allValuesFrom MIXS:0010014_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_soil_data ;
    owl:allValuesFrom MIXS:0010014_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010014_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010014_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mimsmisip_water_data ;
    owl:allValuesFrom MIXS:0010014_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_data ;
    owl:allValuesFrom MIXS:0010010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_agriculture_data ;
    owl:allValuesFrom MIXS:0010010_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_air_data ;
    owl:allValuesFrom MIXS:0010010_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_built_environment_data ;
    owl:allValuesFrom MIXS:0010010_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010010_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010010_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010010_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010010_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_host_associated_data ;
    owl:allValuesFrom MIXS:0010010_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_human_associated_data ;
    owl:allValuesFrom MIXS:0010010_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_human_gut_data ;
    owl:allValuesFrom MIXS:0010010_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_human_oral_data ;
    owl:allValuesFrom MIXS:0010010_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_human_skin_data ;
    owl:allValuesFrom MIXS:0010010_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010010_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010010_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010010_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010010_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010010_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_plant_associated_data ;
    owl:allValuesFrom MIXS:0010010_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_sediment_data ;
    owl:allValuesFrom MIXS:0010010_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_soil_data ;
    owl:allValuesFrom MIXS:0010010_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010010_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010010_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:misag_water_data ;
    owl:allValuesFrom MIXS:0010010_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_data ;
    owl:allValuesFrom MIXS:0010012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_agriculture_data ;
    owl:allValuesFrom MIXS:0010012_0016018
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_air_data ;
    owl:allValuesFrom MIXS:0010012_0016000
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_built_environment_data ;
    owl:allValuesFrom MIXS:0010012_0016001
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_food_animal_and_animal_feed_data ;
    owl:allValuesFrom MIXS:0010012_0016019
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_food_farm_environment_data ;
    owl:allValuesFrom MIXS:0010012_0016020
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_food_food_production_facility_data ;
    owl:allValuesFrom MIXS:0010012_0016021
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_food_human_foods_data ;
    owl:allValuesFrom MIXS:0010012_0016022
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_host_associated_data ;
    owl:allValuesFrom MIXS:0010012_0016002
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_human_associated_data ;
    owl:allValuesFrom MIXS:0010012_0016003
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_human_gut_data ;
    owl:allValuesFrom MIXS:0010012_0016004
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_human_oral_data ;
    owl:allValuesFrom MIXS:0010012_0016005
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_human_skin_data ;
    owl:allValuesFrom MIXS:0010012_0016006
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_human_vaginal_data ;
    owl:allValuesFrom MIXS:0010012_0016007
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_hydrocarbon_resources_cores_data ;
    owl:allValuesFrom MIXS:0010012_0016015
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_hydrocarbon_resources_fluids_swabs_data ;
    owl:allValuesFrom MIXS:0010012_0016016
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_microbial_mat_biofilm_data ;
    owl:allValuesFrom MIXS:0010012_0016008
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_miscellaneous_natural_or_artificial_environment_data ;
    owl:allValuesFrom MIXS:0010012_0016009
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_plant_associated_data ;
    owl:allValuesFrom MIXS:0010012_0016010
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_sediment_data ;
    owl:allValuesFrom MIXS:0010012_0016011
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_soil_data ;
    owl:allValuesFrom MIXS:0010012_0016012
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_symbiont_associated_data ;
    owl:allValuesFrom MIXS:0010012_0016023
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_wastewater_sludge_data ;
    owl:allValuesFrom MIXS:0010012_0016013
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:miuvig_water_data ;
    owl:allValuesFrom MIXS:0010012_0016014
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:ancient_data ;
    owl:allValuesFrom MIXS:0016024
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_hostassociated_ancient_data ;
    owl:allValuesFrom MIXS:0010007_0016002_0016024
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_humanassociated_ancient_data ;
    owl:allValuesFrom MIXS:0010007_0016003_0016024
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_humangut_ancient_data ;
    owl:allValuesFrom MIXS:0010007_0016004_0016024
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_humanoral_ancient_data ;
    owl:allValuesFrom MIXS:0010007_0016005_0016024
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_humanskin_ancient_data ;
    owl:allValuesFrom MIXS:0010007_0016006_0016024
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_plantassociated_ancient_data ;
    owl:allValuesFrom MIXS:0010007_0016010_0016024
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_sediment_ancient_data ;
    owl:allValuesFrom MIXS:0010007_0016011_0016024
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:mims_soil_ancient_data ;
    owl:allValuesFrom MIXS:0010007_0016012_0016024
  ] .

MIXS:0016010 a owl:Class ;
  rdfs:label "plant-associated" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from a plant to examine its plant-associated microbiome." ;
  skos:altLabel "MIxS-plant-associated" ;
  MIXS:use_cases "plant surface swabs, root soil or rhizosphere, cultivated plants, plant phenotyping" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000551 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000247 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000553 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000858 ;
    owl:allValuesFrom MIXS:BiolStatEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000858 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001038 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000555 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001040 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001041 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001041 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000556 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000557 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000558 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000859 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000559 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001043 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001043 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001044 ;
    owl:allValuesFrom MIXS:GrowthHabitEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001044 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000560 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000561 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000031 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000567 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000567 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000568 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000569 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000569 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001052 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000570 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000571 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001056 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000573 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001057 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001057 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001058 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001058 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001059 ;
    owl:allValuesFrom MIXS:PlantSexEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001059 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001060 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001060 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000575 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000576 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001061 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001061 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000577 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000577 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000578 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000578 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000579 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000579 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000580 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000580 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001062 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001062 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000581 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000581 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001063 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001063 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000582 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000860 ;
    owl:allValuesFrom MIXS:SampCaptStatusEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000860 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000249 ;
    owl:allValuesFrom MIXS:SampDisStageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000249 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001068 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001069 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001070 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001070 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000590 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000591 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016011 a owl:Class ;
  rdfs:label "sediment" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from the sedimentary area of aquatic environments." ;
  skos:altLabel "MIxS-sediment" ;
  skos:note "Sedimentary layers in terrestrial environments will probably be better served by the soil extension." ;
  MIXS:use_cases "river bed or sea floor." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000490 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000490 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000172 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000172 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000173 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000173 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000174 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000175 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000175 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000310 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000310 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000137 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000498 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000498 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000502 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000502 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000101 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000101 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000503 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000206 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000515 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000515 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000516 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000516 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000180 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000181 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000211 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000211 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000182 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000182 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001078 ;
    owl:allValuesFrom MIXS:SedimentTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001078 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000750 ;
    owl:allValuesFrom MIXS:TidalStageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000750 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000525 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000525 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000634 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000634 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

MIXS:0016012 a owl:Class ;
  rdfs:label "soil" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from the uppermost layer of Earth's crust, contributed by the Terragenome Consortium." ;
  skos:altLabel "MIxS-soil" ;
  rdfs:seeAlso <https://www.fao.org/agriculture/crops/thematic-sitemap/theme/spi/soil-biodiversity/research-into-soil-biodiversity/the-terragenome-project/en/> ;
  MIXS:use_cases "soil collection, island microbiome sampling, farm land or forest floor." ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001080 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001080 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000312 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000312 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000314 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000314 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000315 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000315 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000316 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000316 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000318 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000318 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000639 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001081 ;
    owl:allValuesFrom MIXS:TillageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001086 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001086 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000319 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000319 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000320 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000320 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001082 ;
    owl:allValuesFrom MIXS:SoilHorizonEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001082 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000321 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000321 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000322 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000322 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000185 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000323 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000323 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000325 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000328 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000328 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000642 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000642 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000643 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000643 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000644 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000644 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000645 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000645 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000329 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000329 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001083 ;
    owl:allValuesFrom MIXS:FaoClassEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001083 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000330 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000330 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000331 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000331 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000332 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000332 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000334 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000334 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000646 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000646 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000647 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000647 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001084 ;
    owl:allValuesFrom MIXS:ProfilePositionEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001084 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001085 ;
    owl:allValuesFrom MIXS:DrainageClassEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001085 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000335 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000335 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000336 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000336 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001106 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001106 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000533 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000337 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000337 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000530 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000338 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000338 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000650 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000650 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000339 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000339 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000340 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000340 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000652 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000343 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000343 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000607 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000607 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000324 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000324 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000829 ;
    owl:allValuesFrom MIXS:SeasonEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000829 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

MIXS:0016023 a owl:Class ;
  rdfs:label "symbiont-associated" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from an organism that lives in close association with any other organism(s)." ;
  skos:altLabel "MIxS-SA (symbiont-associated)" ;
  MIXS:use_cases "the microbiome sequence of a flea sampled from a farm animal" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000009 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000010 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:allValuesFrom xsd:dateTime
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000011 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000094 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000861 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000248 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000250 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000026 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001315 ;
    owl:allValuesFrom MIXS:HostDependenceEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001315 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001307 ;
    owl:allValuesFrom MIXS:TypeOfSymbiosisEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001307 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001300 ;
    owl:allValuesFrom MIXS:SymLifeCycleTypeEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001300 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000251 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000255 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000862 ;
    owl:allValuesFrom MIXS:UrobiomSexEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000862 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001312 ;
    owl:allValuesFrom MIXS:ModeTransmissionEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001312 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001316 ;
    owl:allValuesFrom MIXS:RouteTransmissionEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001316 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000866 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000866 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000867 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000888 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000263 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000264 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000256 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000871 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000871 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000252 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000252 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000872 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000253 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000253 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000254 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000254 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000365 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000874 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000257 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000260 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000260 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000261 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000261 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000875 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000875 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001305 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001305 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001308 ;
    owl:allValuesFrom MIXS:HostSpecificityEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001308 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001303 ;
    owl:allValuesFrom MIXS:SymbiontHostRoleEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001303 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001313 ;
    owl:allValuesFrom MIXS:HostCellularLocEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001313 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001299 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001299 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001310 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001310 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001324 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001324 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001325 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001326 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001326 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001306 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001306 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001327 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001327 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001319 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001328 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001329 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001329 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001330 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001330 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001331 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001331 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001332 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001332 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001333 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001333 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001334 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001334 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001317 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001317 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] .

MIXS:0016013 a owl:Class ;
  rdfs:label "wastewater/sludge" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing samples obtained from any solid, semisolid or liquid waste." ;
  skos:altLabel "MIxS-wastewater/sludge" ;
  MIXS:use_cases "sewerage or industrial wastewater" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000653 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000653 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000656 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000656 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000657 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000657 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000660 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000661 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000662 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000662 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000664 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000665 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000348 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000348 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000349 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000349 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000350 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000350 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000351 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000351 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000215 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000215 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000669 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000669 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000672 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000673 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000150 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000352 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000352 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000102 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000102 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000689 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000689 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000353 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000353 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

MIXS:0016014 a owl:Class ;
  rdfs:label "water" ;
  rdfs:comment "A collection of terms appropriate when collecting samples and sequencing water samples obtained from any aquatic environment." ;
  skos:altLabel "MIxS-water" ;
  rdfs:seeAlso <https://www.vliz.be/projects/assembleplus/research/ocean-sampling-day-2018.html> ;
  MIXS:use_cases "sea or river water, global ocean sampling day" ;
  rdfs:subClassOf MIXS:Extension , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001107 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000092 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000018 ;
    owl:cardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000093 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000421 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000298 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000298 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000490 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000490 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000172 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000172 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000427 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001097 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000173 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000173 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000683 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000683 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000684 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000684 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000174 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000175 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000175 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000176 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000432 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000310 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000310 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000751 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000429 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000177 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000692 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000692 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000435 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000178 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000436 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000179 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000434 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000698 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000698 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000106 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000106 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000433 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000162 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000119 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000703 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000703 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000704 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000704 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000137 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000137 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000706 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000706 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000431 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000498 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000498 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000502 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000502 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000752 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000503 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000425 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000426 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000504 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000508 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000204 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000205 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000103 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:allValuesFrom MIXS:OxyStatSampEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000753 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:allValuesFrom xsd:float
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0001001 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000515 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000515 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000719 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000719 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000754 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000516 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000516 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000180 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000505 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000181 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000725 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000725 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000430 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000412 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000728 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000728 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000182 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000182 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000183 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000116 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000755 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000110 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000111 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000184 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000735 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000735 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000736 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000736 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000428 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000738 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000738 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000423 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000424 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000741 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000741 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000113 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000750 ;
    owl:allValuesFrom MIXS:TidalStageEnum
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000750 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000634 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000634 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000744 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000744 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000745 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000745 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000102 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000102 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000747 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000747 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000117 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000117 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000191 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000203 ;
    owl:allValuesFrom xsd:string
  ] , [
    a owl:Restriction ;
    owl:onProperty MIXS:0000203 ;
    owl:maxCardinality "1"^^xsd:nonNegativeInteger
  ] .

MIXS:data_analysis a owl:DatatypeProperty ;
  rdfs:comment "Group of the slots that name 'Data analysis' in slot_group." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:environment a owl:DatatypeProperty ;
  rdfs:comment "Group of the slots that name 'Environment' in slot_group." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001215 a owl:DatatypeProperty ;
  rdfs:label "Hazard Analysis Critical Control Points (HACCP) guide food safety term" ;
  rdfs:comment "Hazard Analysis Critical Control Points (HACCP) food safety terms; This field accepts terms listed under HACCP guide food safety term (http://purl.obolibrary.org/obo/FOODON_03530221)" ;
  skos:example "tetrodotoxic poisoning [FOODON:03530249]" ;
  schema:keywords "food" , "term" ;
  rdfs:range xsd:string .

MIXS:0001179 a owl:DatatypeProperty ;
  rdfs:label "Interagency Food Safety Analytics Collaboration (IFSAC) category" ;
  rdfs:comment "The IFSAC food categorization scheme has five distinct levels to which foods can be assigned, depending upon the type of food. First, foods are assigned to one of four food groups (aquatic animals, land animals, plants, and other). Food groups include increasingly specific food categories; dairy, eggs, meat and poultry, and game are in the land animal food group, and the category meat and poultry is further subdivided into more specific categories of meat (beef, pork, other meat) and poultry (chicken, turkey, other poultry). Finally, foods are differentiated by differences in food processing (such as pasteurized fluid dairy products, unpasteurized fluid dairy products, pasteurized solid and semi-solid dairy products, and unpasteurized solid and semi-solid dairy products. An IFSAC food category chart is available from https://www.cdc.gov/foodsafety/ifsac/projects/food-categorization-scheme.html PMID: 28926300" ;
  skos:example "Plants:Produce:Vegetables:Herbs:Dried Herbs" ;
  schema:keywords "food" ;
  MIXS:Expected_value "IFSAC term" ;
  rdfs:range xsd:string .

MIXS:investigation a owl:DatatypeProperty ;
  rdfs:comment "Group of the slots that name 'Investigation' in slot_group." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:nucleic_acid_source a owl:DatatypeProperty ;
  rdfs:comment "Group of the slots that name 'Nucleic acid source' in slot_group." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:sequencing a owl:DatatypeProperty ;
  rdfs:comment "Group of the slots that name 'Sequencing' in slot_group." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000122 a owl:DatatypeProperty ;
  rdfs:label "absolute air humidity" ;
  rdfs:comment "Actual mass of water vapor present in the air water vapor mixture." ;
  skos:note "Can be calculated via mass of water vapor divided by the volume of the air and water vapor mixture." ;
  skos:example "7 gram per cubic meter" ;
  schema:keywords "absolute" , "air" , "humidity" ;
  MIXS:Preferred_unit "gram per gram, kilogram per kilogram, kilogram, pound, gram per cubic meter, kilogram per cubic meter, percent" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000048 a owl:DatatypeProperty ;
  rdfs:label "adapters" ;
  rdfs:comment "Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters" ;
  skos:example "AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001009 a owl:DatatypeProperty ;
  rdfs:label "secondary and tertiary recovery methods and start date" ;
  rdfs:comment "Additional (i.e. Secondary, tertiary, etc.) recovery methods deployed for increase of hydrocarbon recovery from resource and start date for each one of them. If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Polymer Addition;2018-06-21T14:30Z" ;
  schema:keywords "date" , "method" , "recover" , "secondary" , "start" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000300 a owl:DatatypeProperty ;
  rdfs:label "additional info" ;
  rdfs:comment "Information that doesn't fit anywhere else. Can also be used to propose new entries for fields with controlled vocabulary" ;
  schema:keywords "information" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000218 a owl:DatatypeProperty ;
  rdfs:label "address" ;
  rdfs:comment "The street name and building number where the sampling occurred" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000219 a owl:DatatypeProperty ;
  rdfs:label "adjacent rooms" ;
  rdfs:comment "List of rooms (room number, room name) immediately adjacent to the sampling room" ;
  schema:keywords "adjacent" , "room" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001121 a owl:DatatypeProperty ;
  rdfs:label "environment adjacent to site" ;
  rdfs:comment "Description of the environmental system or features that are adjacent to the sampling site. This field accepts terms under ecosystem (http://purl.obolibrary.org/obo/ENVO_01001110) and human construction (http://purl.obolibrary.org/obo/ENVO_00000070). Multiple terms can be separated by pipes" ;
  skos:example "estuarine biome [ENVO:01000020]" ;
  schema:keywords "adjacent" , "environment" , "site" ;
  MIXS:Expected_value "ENVO_01001110 or ENVO_00000070" ;
  rdfs:range xsd:string .

MIXS:0000773 a owl:ObjectProperty ;
  rdfs:label "aerospace structure" ;
  rdfs:comment "Aerospace structures typically consist of thin plates with stiffeners for the external surfaces, bulkheads and frames to support the shape and fasteners such as welds, rivets, screws and bolts to hold the components together" ;
  skos:example "plane" ;
  rdfs:range MIXS:AeroStrucEnum ;
  a owl:FunctionalProperty .

MIXS:agriculture_data a owl:ObjectProperty ;
  rdfs:label "Agriculture data" ;
  rdfs:comment "Data that comply with Extension Agriculture" ;
  rdfs:range MIXS:0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000639 a owl:DatatypeProperty ;
  rdfs:label "history/agrochemical additions" ;
  rdfs:comment "Addition of fertilizers, pesticides, etc. - amount and time of applications" ;
  skos:example "roundup;5 milligram per liter;2018-06-21" ;
  schema:keywords "history" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0000108 a owl:DatatypeProperty ;
  rdfs:label "air particulate matter concentration" ;
  rdfs:comment "Concentration of substances that remain suspended in the air, and comprise mixtures of organic and inorganic substances (PM10 and PM2.5); can report multiple PM's by entering numeric values preceded by name of PM" ;
  skos:example "PM2.5;10 microgram per cubic meter" ;
  schema:keywords "air" , "concentration" , "particle" , "particulate" ;
  rdfs:range xsd:string .

MIXS:air_data a owl:ObjectProperty ;
  rdfs:label "Air data" ;
  rdfs:comment "Data that comply with Extension Air" ;
  schema:keywords "air" ;
  rdfs:range MIXS:0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001146 a owl:DatatypeProperty ;
  rdfs:label "local air flow impediments" ;
  rdfs:comment "Presence of objects in the area that would influence or impede air flow through the air filter" ;
  skos:example "obstructed;hay bales; 2 m" ;
  schema:keywords "air" ;
  MIXS:Expected_value "enumeration;obstruction type; distance from sampling device" ;
  rdfs:range xsd:string .

MIXS:0000124 a owl:DatatypeProperty ;
  rdfs:label "air temperature" ;
  rdfs:comment "Temperature of the air at the time of sampling" ;
  skos:example "25 degree Celsius" ;
  schema:keywords "air" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000551 a owl:DatatypeProperty ;
  rdfs:label "air temperature regimen" ;
  rdfs:comment "Information about treatment involving an exposure to varying temperatures; should include the temperature, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include different temperature regimens" ;
  skos:example "25 degree Celsius;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "air" , "regimen" , "temperature" ;
  MIXS:Expected_value "temperature value;treatment interval and duration" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string .

MIXS:0000607 a owl:DatatypeProperty ;
  rdfs:label "extreme_unusual_properties/Al saturation" ;
  rdfs:comment "Aluminum saturation (esp. For tropical soils)" ;
  schema:keywords "extreme" , "properties" , "saturation" , "unusual" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000324 a owl:DatatypeProperty ;
  rdfs:label "extreme_unusual_properties/Al saturation method" ;
  rdfs:comment "Reference or method used in determining Al saturation" ;
  schema:keywords "extreme" , "method" , "properties" , "saturation" , "unusual" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000421 a owl:DatatypeProperty ;
  rdfs:label "alkalinity" ;
  rdfs:comment "Alkalinity, the ability of a solution to neutralize acids to the equivalence point of carbonate or bicarbonate" ;
  skos:example "50 milligram per liter" ;
  schema:keywords "alkalinity" ;
  MIXS:Preferred_unit "milliequivalent per liter, milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000298 a owl:DatatypeProperty ;
  rdfs:label "alkalinity method" ;
  rdfs:comment "Method used for alkalinity measurement" ;
  skos:example "titration" ;
  schema:keywords "alkalinity" , "method" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000490 a owl:DatatypeProperty ;
  rdfs:label "alkyl diethers" ;
  rdfs:comment "Concentration of alkyl diethers" ;
  skos:example "0.005 mole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000094 a owl:DatatypeProperty ;
  rdfs:label "altitude" ;
  rdfs:comment "Heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth's surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air" ;
  skos:example "100 meter" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000172 a owl:DatatypeProperty ;
  rdfs:label "aminopeptidase activity" ;
  rdfs:comment "Measurement of aminopeptidase activity" ;
  skos:example "0.269 mole per liter per hour" ;
  MIXS:Preferred_unit "mole per liter per hour" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000427 a owl:DatatypeProperty ;
  rdfs:label "ammonium" ;
  rdfs:comment "Concentration of ammonium in the sample" ;
  skos:example "1.5 milligram per liter" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000276 a owl:DatatypeProperty ;
  rdfs:label "amniotic fluid/color" ;
  rdfs:comment "Specification of the color of the amniotic fluid sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000140 a owl:DatatypeProperty ;
  rdfs:label "amount of light" ;
  rdfs:comment "The unit of illuminance and luminous emittance, measuring luminous flux per unit area" ;
  schema:keywords "light" ;
  MIXS:Preferred_unit "lux, lumens per square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000247 a owl:DatatypeProperty ;
  rdfs:label "ancestral data" ;
  rdfs:comment "Information about either pedigree or other ancestral information description (e.g. parental variety in case of mutant or selection), e.g. A/3*B (meaning [(A x B) x B] x B)" ;
  skos:example "A/3*B" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:ancient_data a owl:ObjectProperty ;
  rdfs:label "ancient data" ;
  rdfs:comment "Data that comply with Extension Ancient" ;
  rdfs:range MIXS:0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001115 a owl:DatatypeProperty ;
  rdfs:label "animal water delivery method" ;
  rdfs:comment "Description of the equipment or method used to distribute water to livestock. This field accepts termed listed under water delivery equipment (http://opendata.inra.fr/EOL/EOL_0001653). Multiple terms can be separated by pipes" ;
  skos:example "water trough [EOL:0001618]" ;
  schema:keywords "animal" , "delivery" , "method" , "water" ;
  rdfs:range xsd:string .

MIXS:0001243 a owl:DatatypeProperty ;
  rdfs:label "food animal antimicrobial" ;
  rdfs:comment "The name(s) (generic or brand) of the antimicrobial(s) given to the food animal within the last 30 days" ;
  skos:example "tetracycline" ;
  schema:keywords "animal" , "antimicrobial" , "food" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001244 a owl:DatatypeProperty ;
  rdfs:label "food animal antimicrobial duration" ;
  rdfs:comment "The duration of time (days) that the antimicrobial was administered to the food animal" ;
  skos:example "3 days" ;
  schema:keywords "animal" , "antimicrobial" , "duration" , "food" , "period" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001245 a owl:DatatypeProperty ;
  rdfs:label "food animal antimicrobial frequency" ;
  rdfs:comment "The frequency per day that the antimicrobial was administered to the food animal" ;
  skos:example "1.5" ;
  schema:keywords "animal" , "antimicrobial" , "food" , "frequency" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0001246 a owl:DatatypeProperty ;
  rdfs:label "food animal antimicrobial route of administration" ;
  rdfs:comment "The route by which the antimicrobial is administered into the body of the food animal" ;
  skos:example "oral-feed" ;
  schema:keywords "administration" , "animal" , "antimicrobial" , "food" , "route" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001247 a owl:DatatypeProperty ;
  rdfs:label "food animal antimicrobial intended use" ;
  rdfs:comment "The prescribed intended use of or the condition treated by the antimicrobial given to the food animal by any route of administration" ;
  skos:example "shipping fever" ;
  schema:keywords "animal" , "antimicrobial" , "food" , "use" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001248 a owl:ObjectProperty ;
  rdfs:label "food animal body condition" ;
  rdfs:comment "Body condition scoring is a production management tool used to evaluate overall health and nutritional needs of a food animal. Because there are different scoring systems, this field is restricted to three categories" ;
  skos:example "under conditioned" ;
  schema:keywords "animal" , "body" , "condition" , "food" ;
  rdfs:range MIXS:AnimalBodyCondEnum ;
  a owl:FunctionalProperty .

MIXS:0001130 a owl:DatatypeProperty ;
  rdfs:label "food animal source diet" ;
  rdfs:comment "If the isolate is from a food animal, the type of diet eaten by the food animal.  Please list the main food staple and the setting, if appropriate.  For a list of acceptable animal feed terms or categories, please see http://www.feedipedia.org.  Multiple terms may apply and can be separated by pipes |Food product for animal covers foods intended for consumption by domesticated animals. Consult http://purl.obolibrary.org/obo/FOODON_03309997. If the proper descriptor is not listed please use text to describe the food type. Multiple terms can be separated by one or more pipes. If the proper descriptor is not listed please use text to describe the food product type" ;
  skos:example "Hay [FOODON:03301763]" ;
  schema:keywords "animal" , "diet" , "food" , "source" ;
  MIXS:Expected_value "text or FOODON_03309997" ;
  rdfs:range xsd:string .

MIXS:0001113 a owl:DatatypeProperty ;
  rdfs:label "animal feeding equipment" ;
  rdfs:comment "Description of the feeding equipment used for livestock. This field accepts terms listed under feed delivery (http://opendata.inra.fr/EOL/EOL_0001757). Multiple terms can be separated by pipes" ;
  skos:example "self feeding [EOL:0001645]| straight feed trough [EOL:0001661]" ;
  schema:keywords "animal" , "equipment" ;
  MIXS:Expected_value "EOL:0001757" ;
  rdfs:range xsd:string .

MIXS:0001129 a owl:DatatypeProperty ;
  rdfs:label "food animal group size" ;
  rdfs:comment "The number of food animals of the same species that are maintained together as a unit, i.e. a herd or flock" ;
  skos:example "80" ;
  schema:keywords "animal" , "food" , "size" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0001180 a owl:DatatypeProperty ;
  rdfs:label "animal housing system" ;
  rdfs:comment "Description of the housing system of the livestock. This field accepts terms listed under terrestrial management housing system (http://opendata.inra.fr/EOL/EOL_0001605)" ;
  skos:example "pen rearing system [EOL:0001636]" ;
  schema:keywords "animal" ;
  rdfs:range xsd:string .

MIXS:0001114 a owl:DatatypeProperty ;
  rdfs:label "animal intrusion near sample source" ;
  rdfs:comment "Identification of animals intruding on the sample or sample site including invertebrates (such as pests or pollinators) and vertebrates (such as wildlife or domesticated animals). This field accepts terms under organism (http://purl.obolibrary.org/obo/NCIT_C14250). This field also accepts identification numbers from NCBI under https://www.ncbi.nlm.nih.gov/taxonomy. Multiple terms can be separated by pipes" ;
  skos:example "Thripidae [NCBITaxon:45053]" ;
  schema:keywords "animal" , "sample" , "source" ;
  rdfs:range xsd:string .

MIXS:0001249 a owl:ObjectProperty ;
  rdfs:label "food animal source sex category" ;
  rdfs:comment "The sex and reproductive status of the food animal" ;
  skos:example "castrated male" ;
  schema:keywords "animal" , "food" , "source" ;
  rdfs:range MIXS:AnimalSexEnum ;
  a owl:FunctionalProperty .

MIXS:0000059 a owl:DatatypeProperty ;
  rdfs:label "annotation" ;
  rdfs:comment "Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter" ;
  skos:example "prokka" ;
  MIXS:Expected_value "name of tool or pipeline used, or annotation source description" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000644 a owl:DatatypeProperty ;
  rdfs:label "mean annual precipitation" ;
  rdfs:comment "The average of all annual precipitation values known, or an estimated equivalent value derived by such methods as regional indexes or Isohyetal maps" ;
  schema:keywords "mean" ;
  MIXS:Preferred_unit "millimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000642 a owl:DatatypeProperty ;
  rdfs:label "mean annual temperature" ;
  rdfs:comment "Mean annual temperature" ;
  skos:example "12.5 degree Celsius" ;
  schema:keywords "mean" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000553 a owl:DatatypeProperty ;
  rdfs:label "antibiotic regimen" ;
  rdfs:comment "Information about treatment involving antibiotic administration; should include the name of antibiotic, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple antibiotic regimens" ;
  skos:example "penicillin;5 milligram;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" ;
  MIXS:Expected_value "antibiotic name;antibiotic amount;treatment interval and duration" ;
  MIXS:Preferred_unit "milligram" ;
  rdfs:range xsd:string .

MIXS:0000157 a owl:DatatypeProperty ;
  rdfs:label "API gravity" ;
  rdfs:comment "API gravity is a measure of how heavy or light a petroleum liquid is compared to water (source: https://en.wikipedia.org/wiki/API_gravity) (e.g. 31.1   API)" ;
  skos:example "31.1 API" ;
  MIXS:Preferred_unit "degrees API" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000774 a owl:ObjectProperty ;
  rdfs:label "architectural structure" ;
  rdfs:comment "An architectural structure is a human-made, free-standing, immobile outdoor construction" ;
  skos:example "shed" ;
  rdfs:range MIXS:ArchStrucEnum ;
  a owl:FunctionalProperty .

MIXS:0001255 a owl:DatatypeProperty ;
  rdfs:label "area sampled size" ;
  rdfs:comment "The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected" ;
  skos:example "12 centimeter x 12 centimeter" ;
  schema:keywords "area" , "sample" , "size" ;
  MIXS:Expected_value "measurement value" ;
  MIXS:Preferred_unit "centimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000133 a owl:DatatypeProperty ;
  rdfs:label "aromatics wt%" ;
  rdfs:comment "Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that divides crude oil components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)" ;
  MIXS:Preferred_unit "percent" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000135 a owl:DatatypeProperty ;
  rdfs:label "asphaltenes wt%" ;
  rdfs:comment "Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that divides crude oil components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)" ;
  MIXS:Preferred_unit "percent" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000057 a owl:DatatypeProperty ;
  rdfs:label "assembly name" ;
  rdfs:comment "Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community" ;
  skos:example "HuRef, JCVI_ISG_i3_1.0" ;
  MIXS:Expected_value "name and version of assembly" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000056 a owl:ObjectProperty ;
  rdfs:label "assembly quality" ;
  rdfs:comment "The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the large subunit (LSU) RNA, small subunit (SSU) and the presence of 5.8S rRNA or 5S rRNA depending on whether it is a eukaryotic or prokaryotic genome, respectively. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling   90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated" ;
  skos:example "High-quality draft genome" ;
  schema:keywords "quality" ;
  rdfs:range MIXS:AssemblyQualEnum ;
  a owl:FunctionalProperty .

MIXS:0000058 a owl:DatatypeProperty ;
  rdfs:label "assembly software" ;
  rdfs:comment "Tool(s) used for assembly, including version number and parameters" ;
  skos:example "metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise" ;
  schema:keywords "software" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000091 a owl:DatatypeProperty ;
  rdfs:label "relevant electronic resources" ;
  rdfs:comment "A related resource that is referenced, cited, or otherwise associated to the sequence" ;
  skos:example "http://www.earthmicrobiome.org/" ;
  schema:keywords "resource" ;
  MIXS:Expected_value "reference to resource" ;
  rdfs:range xsd:string .

MIXS:0001299 a owl:DatatypeProperty ;
  rdfs:label "duration of association with the host" ;
  rdfs:comment "Time spent in host of the symbiotic organism at the time of sampling; relevant scale depends on symbiotic organism and study" ;
  schema:keywords "duration" , "host" , "host." , "period" ;
  MIXS:Preferred_unit "year, day, hour" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001097 a owl:DatatypeProperty ;
  rdfs:label "atmospheric data" ;
  rdfs:comment "Measurement of atmospheric data; can include multiple data" ;
  skos:example "wind speed;9 knots" ;
  MIXS:Expected_value "atmospheric data name;measurement value" ;
  rdfs:range xsd:string .

MIXS:0000141 a owl:DatatypeProperty ;
  rdfs:label "average dew point" ;
  rdfs:comment "The average of dew point measures taken at the beginning of every hour over a 24 hour period on the sampling day" ;
  skos:example "25.5 degree Celsius" ;
  schema:keywords "average" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000775 a owl:DatatypeProperty ;
  rdfs:label "average daily occupancy" ;
  rdfs:comment "Daily average occupancy of room. Indicate the number of person(s) daily occupying the sampling room" ;
  schema:keywords "average" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000142 a owl:DatatypeProperty ;
  rdfs:label "average temperature" ;
  rdfs:comment "The average of temperatures taken at the beginning of every hour over a 24 hour period on the sampling day" ;
  skos:example "12.5 degree Celsius" ;
  schema:keywords "average" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000683 a owl:DatatypeProperty ;
  rdfs:label "bacterial production" ;
  rdfs:comment "Bacterial production in the water column measured by isotope uptake" ;
  skos:example "5 milligram per cubic meter per day" ;
  schema:keywords "production" ;
  MIXS:Preferred_unit "milligram per cubic meter per day" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000684 a owl:DatatypeProperty ;
  rdfs:label "bacterial respiration" ;
  rdfs:comment "Measurement of bacterial respiration in the water column" ;
  skos:example "300 micromole oxygen per liter per hour" ;
  MIXS:Preferred_unit "milligram per cubic meter per day, micromole oxygen per liter per hour" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000173 a owl:DatatypeProperty ;
  rdfs:label "bacterial carbon production" ;
  rdfs:comment "Measurement of bacterial carbon production" ;
  skos:example "2.53 microgram per liter per hour" ;
  schema:keywords "carbon" , "production" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001194 a owl:DatatypeProperty ;
  rdfs:label "bacteria density" ;
  rdfs:comment "Number of bacteria in sample, as defined by bacteria density (http://purl.obolibrary.org/obo/GENEPIO_0000043)" ;
  skos:example "10 colony forming units per gram dry weight" ;
  schema:keywords "density" ;
  MIXS:Preferred_unit "colony forming units per milliliter; colony forming units per gram of dry weight" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000096 a owl:DatatypeProperty ;
  rdfs:label "barometric pressure" ;
  rdfs:comment "Force per unit area exerted against a surface by the weight of air above that surface" ;
  skos:example "5 millibar" ;
  schema:keywords "pressure" ;
  MIXS:Preferred_unit "millibar" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000290 a owl:DatatypeProperty ;
  rdfs:label "basin name" ;
  rdfs:comment "Name of the basin (e.g. Campos)" ;
  skos:example "Campos" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001382 a owl:DatatypeProperty ;
  rdfs:label "batch identifiers" ;
  rdfs:comment "Identifiers for any form of batch or 'group' that the samples is associated with, examples including: individual/skeleton ID, sediment core IDs, extract batch, library batch, sequencing run etc..  These IDs should always act as 'umbrella' IDs that allow association with entries processed together, to allow for downstream analyses of batch effects. Ideally, the information should indicate or specify what type of batch the ID is describing." ;
  skos:example "EXTB1;LIBB2;SeqRun1" , "Extraction batch: 1" , "20260501-A2 (extraction);20202607-B2 (library)" , "ExtrMG;LibMG;SeqMG" ;
  schema:keywords "identifiers" ;
  MIXS:Expected_value "list any batch_ids the sample, nucleic acids, or library was associated with during processing and sequencing" ;
  rdfs:range xsd:string .

MIXS:0000776 a owl:DatatypeProperty ;
  rdfs:label "bathroom count" ;
  rdfs:comment "The number of bathrooms in the building" ;
  skos:example "1" ;
  schema:keywords "count" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000777 a owl:DatatypeProperty ;
  rdfs:label "bedroom count" ;
  rdfs:comment "The number of bedrooms in the building" ;
  skos:example "2" ;
  schema:keywords "count" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000153 a owl:DatatypeProperty ;
  rdfs:label "benzene" ;
  rdfs:comment "Concentration of benzene in the sample" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000077 a owl:ObjectProperty ;
  rdfs:label "binning parameters" ;
  rdfs:comment "The parameters that have been applied during the extraction of genomes from metagenomic datasets" ;
  skos:example "coverage" , "kmer" ;
  schema:keywords "parameter" ;
  rdfs:range MIXS:BinParamEnum ;
  a owl:FunctionalProperty .

MIXS:0000078 a owl:DatatypeProperty ;
  rdfs:label "binning software" ;
  rdfs:comment "Tool(s) used for the extraction of genomes from metagenomic datasets, where possible include a product ID (PID) of the tool(s) used" ;
  skos:example "MetaCluster-TA (RRID:SCR_004599), MaxBin (biotools:maxbin)" ;
  schema:keywords "software" ;
  MIXS:Expected_value "names and versions of software(s) used" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000653 a owl:DatatypeProperty ;
  rdfs:label "biochemical oxygen demand" ;
  rdfs:comment "Amount of dissolved oxygen needed by aerobic biological organisms in a body of water to break down organic material present in a given water sample at certain temperature over a specific time period" ;
  schema:keywords "oxygen" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001011 a owl:DatatypeProperty ;
  rdfs:label "biocide administration" ;
  rdfs:comment "List of biocides (commercial name of product and supplier) and date of administration" ;
  skos:example "ALPHA 1427;Baker Hughes;2008-01-23" ;
  schema:keywords "administration" ;
  MIXS:Expected_value "name;name;timestamp" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000456 a owl:DatatypeProperty ;
  rdfs:label "biocide administration method" ;
  rdfs:comment "Method of biocide administration (dose, frequency, duration, time elapsed between last biociding and sampling) (e.g. 150 mg/l; weekly; 4 hr; 3 days)" ;
  schema:keywords "administration" , "method" ;
  MIXS:Expected_value "measurement value;frequency;duration;duration" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001258 a owl:DatatypeProperty ;
  rdfs:label "biocide" ;
  rdfs:comment "Substance intended for preventing, neutralizing, destroying, repelling, or mitigating the effects of any pest or microorganism; that inhibits the growth, reproduction, and activity of organisms, including fungal cells; decreases the number of fungi or pests present; deters microbial growth and degradation of other ingredients in the formulation. Indicate the biocide used on the location where the sample was taken. Multiple terms can be separated by pipes" ;
  skos:example "Quaternary ammonium compound|SterBac" ;
  MIXS:Expected_value "commercial name of biocide, active ingredient in biocide or class of biocide" ;
  rdfs:range xsd:string .

MIXS:0001368 a owl:ObjectProperty ;
  rdfs:label "biocultural label" ;
  rdfs:comment "Relevant biocultural labels defined by the local contexts project (https://localcontexts.org/label/bc-provenance/) that describe in what ways this data can be reused, as permitted by any associated native or indigenous peoples or communities." ;
  skos:example "BC R" , "BC MC" , "BC MC;BC CV" ;
  schema:keywords "ethics" ;
  MIXS:Expected_value "Relevant biocultural label from https://localcontexts.org/labels/biocultural-labels/" ;
  rdfs:range MIXS:BioCulturalLabelEnum .

MIXS:0000858 a owl:ObjectProperty ;
  rdfs:label "biological status" ;
  rdfs:comment "The level of genome modification" ;
  skos:example "natural" ;
  schema:keywords "status" ;
  rdfs:range MIXS:BiolStatEnum ;
  a owl:FunctionalProperty .

MIXS:0000174 a owl:DatatypeProperty ;
  rdfs:label "biomass" ;
  rdfs:comment "Amount of biomass; should include the name for the part of biomass measured, e.g. Microbial, total. Can include multiple measurements" ;
  skos:example "total;20 gram" ;
  schema:keywords "biomass" ;
  MIXS:Expected_value "biomass type;measurement value" ;
  MIXS:Preferred_unit "ton, kilogram, gram" ;
  rdfs:range xsd:string .

MIXS:0001038 a owl:DatatypeProperty ;
  rdfs:label "biotic regimen" ;
  rdfs:comment "Information about treatment(s) involving use of biotic factors, such as bacteria, viruses or fungi" ;
  skos:example "sample inoculated with Rhizobium spp. Culture" ;
  schema:keywords "regimen" ;
  rdfs:range xsd:string .

MIXS:0000028 a owl:ObjectProperty ;
  rdfs:label "observed biotic relationship" ;
  rdfs:comment "Description of relationship(s) between the subject organism and other organism(s) it is associated with. E.g., parasite on species X; mutualist with species Y. The target organism is the subject of the relationship, and the other organism(s) is the object" ;
  skos:example "free living" ;
  schema:keywords "observed" , "relationship" ;
  rdfs:range MIXS:BioticRelationshipEnum ;
  a owl:FunctionalProperty .

MIXS:0000286 a owl:DatatypeProperty ;
  rdfs:label "birth control" ;
  rdfs:comment "Specification of birth control medication used" ;
  MIXS:Expected_value "medication name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000175 a owl:DatatypeProperty ;
  rdfs:label "bishomohopanol" ;
  rdfs:comment "Concentration of bishomohopanol" ;
  skos:example "14 microgram per liter" ;
  MIXS:Preferred_unit "microgram per liter, microgram per gram" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000271 a owl:DatatypeProperty ;
  rdfs:label "blood/blood disorder" ;
  rdfs:comment "History of blood disorders; can include multiple disorders.  The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, hematopoietic system disease (https://disease-ontology.org/?id=DOID:74)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000258 a owl:DatatypeProperty ;
  rdfs:label "host blood pressure diastolic" ;
  rdfs:comment "Resting diastolic blood pressure, measured as mm mercury" ;
  schema:keywords "host" , "host." , "pressure" ;
  MIXS:Preferred_unit "millimeter mercury" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000259 a owl:DatatypeProperty ;
  rdfs:label "host blood pressure systolic" ;
  rdfs:comment "Resting systolic blood pressure, measured as mm mercury" ;
  schema:keywords "host" , "host." , "pressure" ;
  MIXS:Preferred_unit "millimeter mercury" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000176 a owl:DatatypeProperty ;
  rdfs:label "bromide" ;
  rdfs:comment "Concentration of bromide" ;
  skos:example "0.05 parts per million" ;
  MIXS:Preferred_unit "parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000787 a owl:ObjectProperty ;
  rdfs:label "design, construction, and operation documents" ;
  rdfs:comment "The building design, construction and operation documents" ;
  skos:example "maintenance plans" ;
  schema:keywords "documents" ;
  rdfs:range MIXS:BuildDocsEnum ;
  a owl:FunctionalProperty .

MIXS:0000761 a owl:ObjectProperty ;
  rdfs:label "building occupancy type" ;
  rdfs:comment "The primary function for which a building or discrete part of a building is intended to be used" ;
  skos:example "market" ;
  schema:keywords "type" ;
  rdfs:range MIXS:BuildOccupTypeEnum .

MIXS:0000768 a owl:ObjectProperty ;
  rdfs:label "building setting" ;
  rdfs:comment "A location (geography) where a building is set" ;
  skos:example "rural" ;
  rdfs:range MIXS:BuildingSettingEnum ;
  a owl:FunctionalProperty .

MIXS:built_environment_data a owl:ObjectProperty ;
  rdfs:label "BuiltEnvironment data" ;
  rdfs:comment "Data that comply with Extension BuiltEnvironment" ;
  rdfs:range MIXS:0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000145 a owl:DatatypeProperty ;
  rdfs:label "built structure age" ;
  rdfs:comment "The age of the built structure since construction" ;
  skos:example "15 years" ;
  schema:keywords "age" ;
  MIXS:Preferred_unit "year" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000778 a owl:ObjectProperty ;
  rdfs:label "built structure setting" ;
  rdfs:comment "The characterization of the location of the built structure as high or low human density" ;
  skos:example "rural" ;
  rdfs:range MIXS:BuiltStrucSetEnum ;
  a owl:FunctionalProperty .

MIXS:0000721 a owl:DatatypeProperty ;
  rdfs:label "built structure type" ;
  rdfs:comment "A physical structure that is a body or assemblage of bodies in space to form a system capable of supporting loads" ;
  schema:keywords "type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000432 a owl:DatatypeProperty ;
  rdfs:label "calcium" ;
  rdfs:comment "Concentration of calcium in the sample" ;
  skos:example "0.2 micromole per liter" ;
  MIXS:Preferred_unit "milligram per liter, micromole per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001395 a owl:DatatypeProperty ;
  rdfs:label "post capture PCR reamplication cycles total" ;
  rdfs:comment "Amplification cycles after capture enrichment total. Provide additional information about PCR conditions in pcr_cond" ;
  skos:example "12" ;
  rdfs:range xsd:integer .

MIXS:0001397 a owl:DatatypeProperty ;
  rdfs:label "capture probe design description" ;
  rdfs:comment "Description of target enrichment probe designs used (e.g., species included, sequences, type, company). This can include custom kits (please provide a general description and DOI if available) or commercially available kit (provide ID and company)." ;
  skos:example "Custom probe design (70 bp biotinylated RNA probes) covering 500 full E. Coli genomes; company TE-Science" , "Commercial RNA baits kit ABC001-EC from company TE-Science, purchased 2020" ;
  schema:keywords "library" , "enrichment" ;
  MIXS:Expected_value "Description of probe set used for target enrichment/library selection (a.k.a. capture)" ;
  rdfs:range xsd:string .

MIXS:0001396 a owl:DatatypeProperty ;
  rdfs:label "Genomic capture probe source taxonomy IDs" ;
  rdfs:comment "NCBI taxon ID(s) of all organisms included in the baits of a whole organelle or whole genome-level capture panel. There should be an (ideally) species level taxonomic ID entry for each organism that had sequences included in the design. If whole genera were targeted, you can instead use a single genus level taxonomic ID or that of any relevant higher taxonomic unit." ;
  skos:example "9606" , "632" , "9789" ;
  schema:keywords "sequencing" , "library" , "enrichment" , "capture" ;
  MIXS:Expected_value "Taxonomic IDs corresponding to organism(s) included in target enrichment (a.k.a. capture) probe design" ;
  rdfs:range xsd:integer .

MIXS:0000097 a owl:DatatypeProperty ;
  rdfs:label "carbon dioxide" ;
  rdfs:comment "Carbon dioxide (gas) amount or concentration at the time of sampling" ;
  skos:example "410 parts per million" ;
  schema:keywords "carbon" ;
  MIXS:Preferred_unit "micromole per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000098 a owl:DatatypeProperty ;
  rdfs:label "carbon monoxide" ;
  rdfs:comment "Carbon monoxide (gas) amount or concentration at the time of sampling" ;
  skos:example "0.1 parts per million" ;
  schema:keywords "carbon" ;
  MIXS:Preferred_unit "micromole per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000310 a owl:DatatypeProperty ;
  rdfs:label "carbon/nitrogen ratio" ;
  rdfs:comment "Ratio of amount or concentrations of carbon to nitrogen" ;
  skos:example "0.417361111" ;
  schema:keywords "carbon" , "nitrogen" , "ratio" ;
  MIXS:Expected_value "measurement value" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000148 a owl:DatatypeProperty ;
  rdfs:label "ceiling area" ;
  rdfs:comment "The area of the ceiling space within the room" ;
  skos:example "25 square meter" ;
  schema:keywords "area" , "ceiling" ;
  MIXS:Preferred_unit "square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000779 a owl:ObjectProperty ;
  rdfs:label "ceiling condition" ;
  rdfs:comment "The physical condition of the ceiling at the time of sampling; photos or video preferred; use drawings to indicate location of damaged areas" ;
  skos:example "damaged" ;
  schema:keywords "ceiling" , "condition" ;
  rdfs:range MIXS:DamagedEnum ;
  a owl:FunctionalProperty .

MIXS:0000780 a owl:ObjectProperty ;
  rdfs:label "ceiling finish material" ;
  rdfs:comment "The type of material used to finish a ceiling" ;
  skos:example "stucco" ;
  schema:keywords "ceiling" , "material" ;
  rdfs:range MIXS:CeilFinishMatEnum ;
  a owl:FunctionalProperty .

MIXS:0000782 a owl:ObjectProperty ;
  rdfs:label "ceiling structure" ;
  rdfs:comment "The construction format of the ceiling" ;
  skos:example "concrete" ;
  schema:keywords "ceiling" ;
  rdfs:range MIXS:CeilStrucEnum ;
  a owl:FunctionalProperty .

MIXS:0000783 a owl:ObjectProperty ;
  rdfs:label "ceiling texture" ;
  rdfs:comment "The feel, appearance, or consistency of a ceiling surface" ;
  skos:example "popcorn" ;
  schema:keywords "ceiling" , "texture" ;
  rdfs:range MIXS:CeilingWallTextureEnum ;
  a owl:FunctionalProperty .

MIXS:0000143 a owl:DatatypeProperty ;
  rdfs:label "ceiling thermal mass" ;
  rdfs:comment "The ability of the ceiling to provide inertia against temperature fluctuations. Generally this means concrete that is exposed. A metal deck that supports a concrete slab will act thermally as long as it is exposed to room air flow" ;
  schema:keywords "ceiling" , "mass" ;
  MIXS:Preferred_unit "joule per degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000784 a owl:ObjectProperty ;
  rdfs:label "ceiling type" ;
  rdfs:comment "The type of ceiling according to the ceiling's appearance or construction" ;
  skos:example "coffered" ;
  schema:keywords "ceiling" , "type" ;
  rdfs:range MIXS:CeilTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000781 a owl:ObjectProperty ;
  rdfs:label "ceiling signs of water/mold" ;
  rdfs:comment "Signs of the presence of mold or mildew on the ceiling" ;
  skos:example "presence of mold visible" ;
  schema:keywords "ceiling" ;
  rdfs:range MIXS:MoldVisibilityEnum ;
  a owl:FunctionalProperty .

MIXS:0000751 a owl:DatatypeProperty ;
  rdfs:label "chemical administration" ;
  rdfs:comment "List of chemical compounds administered to the host or site where sampling occurred, and when (e.g. Antibiotics, n fertilizer, air filter); can include multiple compounds. For chemical entities of biological interest ontology (chebi) (v 163), http://purl.bioontology.org/ontology/chebi" ;
  skos:example "agar [CHEBI:2509];2018-05-11T20:00Z" ;
  schema:keywords "administration" ;
  MIXS:Expected_value "CHEBI;timestamp" ;
  rdfs:range xsd:string .

MIXS:0000555 a owl:DatatypeProperty ;
  rdfs:label "chemical mutagen" ;
  rdfs:comment "Treatment involving use of mutagens; should include the name of mutagen, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple mutagen regimens" ;
  skos:example "nitrous acid;0.5 milligram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  MIXS:Expected_value "mutagen name;mutagen amount;treatment interval and duration" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0000656 a owl:DatatypeProperty ;
  rdfs:label "chemical oxygen demand" ;
  rdfs:comment "A measure of the capacity of water to consume oxygen during the decomposition of organic matter and the oxidation of inorganic chemicals such as ammonia and nitrite" ;
  schema:keywords "oxygen" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000457 a owl:DatatypeProperty ;
  rdfs:label "chemical treatment method" ;
  rdfs:comment "Method of chemical administration(dose, frequency, duration, time elapsed between administration and sampling) (e.g. 50 mg/l; twice a week; 1 hr; 0 days)" ;
  schema:keywords "method" , "treatment" ;
  MIXS:Expected_value "measurement value;frequency;duration;duration" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001012 a owl:DatatypeProperty ;
  rdfs:label "chemical treatment" ;
  rdfs:comment "List of chemical compounds administered upstream the sampling location where sampling occurred (e.g. Glycols, H2S scavenger, corrosion and scale inhibitors, demulsifiers, and other production chemicals etc.). The commercial name of the product and name of the supplier should be provided. The date of administration should also be included" ;
  skos:example "ACCENT 1125;DOW;2010-11-17" ;
  schema:keywords "treatment" ;
  MIXS:Expected_value "name;name;timestamp" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000052 a owl:DatatypeProperty ;
  rdfs:label "chimera check software" ;
  rdfs:comment "Tool(s) used for chimera checking, including version number and parameters, to discover and remove chimeric sequences. A chimeric sequence is comprised of two or more phylogenetically distinct parent sequences" ;
  skos:example "uchime;v4.1;default parameters" ;
  schema:keywords "software" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000429 a owl:DatatypeProperty ;
  rdfs:label "chloride" ;
  rdfs:comment "Concentration of chloride in the sample" ;
  skos:example "5000 milligram per liter" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000177 a owl:DatatypeProperty ;
  rdfs:label "chlorophyll" ;
  rdfs:comment "Concentration of chlorophyll" ;
  skos:example "5 milligram per cubic meter" ;
  MIXS:Preferred_unit "milligram per cubic meter, microgram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001379 a owl:ObjectProperty ;
  rdfs:label "chronometric age protocol" ;
  rdfs:comment "A description of or reference to the methods used to determine the earliest_chrono_age and latest_chrono_age." ;
  skos:example "radiocarbon dating" , "optically stimulated infrared luminescence" , "contextual dating" , "historical records" ;
  skos:broadMatch chrono:chronometricAgeProtocol ;
  rdfs:range MIXS:ChronoAgeProtocolEnum .

MIXS:0001380 a owl:DatatypeProperty ;
  rdfs:label "chronometric age remarks" ;
  rdfs:comment "Notes or comments about the  earliest_chrono_age and latest_chrono_age. For more detail use Chronometric Age Protocol to point to original publication describing method. Useful to specify confidence and/or accuracy of reported date." ;
  skos:example "radiocarbon dating, calibrated with OxCal v4.3 with 95% confidence interval" , "based on proxy dating from other bone samples of stratigraphic layer" , "a coin found in the burial was from the 3rd century was found in the mouth of the skeleton" , "age taken from previous publication Doe et al. 2019" , "radiocarbon age ID: OxA-12345" ;
  skos:closeMatch chrono:chronometricAgeRemarks ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001040 a owl:DatatypeProperty ;
  rdfs:label "climate environment" ;
  rdfs:comment "Treatment involving an exposure to a particular climate; treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple climates" ;
  skos:example "tropical climate;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "environment" ;
  owl:deprecated "true, slot is inconsistently used and provides redundant information to other slots, https://github.com/GenomicsStandardsConsortium/mixs/issues/591 and https://github.com/microbiomedata/nmdc-schema/issues/586" ;
  rdfs:range xsd:string .

MIXS:0001183 a owl:DatatypeProperty ;
  rdfs:label "collection site geographic feature" ;
  rdfs:comment "Text or terms that describe the geographic feature where the food sample was obtained by the researcher. This field accepts selected terms listed under the following ontologies: anthropogenic geographic feature (http://purl.obolibrary.org/obo/ENVO_00000002), for example agricultural fairground [ENVO:01000986]; garden [ENVO:00000011} or any of its subclasses; market [ENVO:01000987]; water well [ENVO:01000002]; or human construction (http://purl.obolibrary.org/obo/ENVO_00000070)" ;
  skos:example "farm [ENVO:00000078]" ;
  schema:keywords "feature" , "geographic" , "site" ;
  MIXS:Expected_value "ENVO:00000002 or ENVO:00000070" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000011 a owl:DatatypeProperty ;
  rdfs:label "collection date" ;
  rdfs:comment "The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  schema:keywords "date" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000071 a owl:ObjectProperty ;
  rdfs:label "completeness approach" ;
  rdfs:comment "The approach used to determine the completeness of a given genomic assembly, which would typically make use of a set of conserved marker genes or a closely related reference genome. For UViG completeness, include reference genome or group used, and contig feature suggesting a complete genome" ;
  skos:example "other" ;
  MIXS:Expected_value "text" ;
  rdfs:range MIXS:ComplApprEnum ;
  a owl:FunctionalProperty .

MIXS:0000069 a owl:DatatypeProperty ;
  rdfs:label "completeness score" ;
  rdfs:comment "Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores" ;
  skos:example "med;60%" ;
  schema:keywords "score" ;
  MIXS:Expected_value "quality;percent completeness" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000070 a owl:DatatypeProperty ;
  rdfs:label "completeness software" ;
  rdfs:comment "Tools used for completion estimate, i.e. checkm, anvi'o, busco" ;
  skos:example "checkm" ;
  schema:keywords "software" ;
  MIXS:Expected_value "names and versions of software(s) used" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000692 a owl:DatatypeProperty ;
  rdfs:label "conductivity" ;
  rdfs:comment "Electrical conductivity of water" ;
  skos:example "10 milliSiemens per centimeter" ;
  MIXS:Preferred_unit "milliSiemens per centimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001195 a owl:DatatypeProperty ;
  rdfs:label "food stored by consumer (storage duration)" ;
  rdfs:comment "The storage duration of the food commodity by the consumer, prior to onset of illness or sample collection.  Indicate the timepoint written in ISO 8601 format" ;
  skos:example "P5D" ;
  schema:keywords "consumer" , "duration)" , "food" , "storage" ;
  MIXS:Preferred_unit "hours or days" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001196 a owl:DatatypeProperty ;
  rdfs:label "food stored by consumer (storage temperature)" ;
  rdfs:comment "Temperature at which food commodity was stored by the consumer, prior to onset of illness or sample collection" ;
  skos:example "4 degree Celsius" ;
  schema:keywords "consumer" , "food" , "storage" , "temperature" ;
  MIXS:Expected_value "text or measurement value" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001197 a owl:DatatypeProperty ;
  rdfs:label "purchase date" ;
  rdfs:comment "The date a food product was purchased by consumer" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  schema:keywords "date" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0001198 a owl:DatatypeProperty ;
  rdfs:label "quantity purchased" ;
  rdfs:comment "The quantity of food purchased by consumer" ;
  skos:example "5 cans" ;
  schema:keywords "quantity" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000072 a owl:DatatypeProperty ;
  rdfs:label "contamination score" ;
  rdfs:comment "The contamination score is based on the fraction of single-copy genes that are observed more than once in a query genome. The following scores are acceptable for; High Quality Draft: < 5%, Medium Quality Draft: < 10%, Low Quality Draft: < 10%. Contamination must be below 5% for a SAG or MAG to be deposited into any of the public databases" ;
  skos:example "0.01" ;
  schema:keywords "score" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000005 a owl:ObjectProperty ;
  rdfs:label "contamination screening input" ;
  rdfs:comment "The type of sequence data used as input" ;
  skos:example "contigs" ;
  rdfs:range MIXS:ContamScreenInputEnum ;
  a owl:FunctionalProperty .

MIXS:0000073 a owl:DatatypeProperty ;
  rdfs:label "contamination screening parameters" ;
  rdfs:comment "Specific parameters used in the decontamination sofware, such as reference database, coverage, and kmers. Combinations of these parameters may also be used, i.e. kmer and coverage, or reference database and kmer" ;
  skos:example "kmer" ;
  schema:keywords "parameter" ;
  MIXS:Expected_value "enumeration;value or name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001363 a owl:DatatypeProperty ;
  rdfs:label "date of retrieval from depositional context" ;
  rdfs:comment "Date of excavation or retrieval from burial or depositional context, if known. If excavations were done during a  longer period, report its midpoint at a month or year level. In case no exact time is available, the date can be  right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23;  2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant." ;
  skos:example "2023" , "1972-11" , "2001-09-25" ;
  MIXS:Preferred_unit "year" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000785 a owl:DatatypeProperty ;
  rdfs:label "cooling system identifier" ;
  rdfs:comment "The cooling system identifier" ;
  skos:example "12345" ;
  schema:keywords "identifier" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000318 a owl:DatatypeProperty ;
  rdfs:label "history/crop rotation" ;
  rdfs:comment "Whether or not crop is rotated, and if yes, rotation schedule" ;
  skos:example "yes;R2/2017-01-01/2018-12-31/P6M" ;
  schema:keywords "history" ;
  MIXS:Expected_value "crop rotation status;schedule" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001116 a owl:DatatypeProperty ;
  rdfs:label "crop yield" ;
  rdfs:comment "Amount of crop produced per unit or area of land" ;
  skos:example "570 kilogram per metre square" ;
  schema:keywords "crop" ;
  MIXS:Preferred_unit "kilogram per metre square" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001181 a owl:DatatypeProperty ;
  rdfs:label "culture isolation date" ;
  rdfs:comment "The datetime marking the end of a process in which a sample yields a positive result for the target microbial analyte(s) in the form of an isolated colony or colonies" ;
  skos:example "2018-05-11T10:00:00+01:00" ;
  schema:keywords "culture" , "date" , "isolation" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0001117 a owl:ObjectProperty ;
  rdfs:label "culture result" ;
  rdfs:comment "Any result of a bacterial culture experiment reported as a binary assessment such as positive/negative, active/inactive" ;
  skos:example "positive" ;
  schema:keywords "culture" ;
  rdfs:range MIXS:CultResultEnum ;
  a owl:FunctionalProperty .

MIXS:0001118 a owl:DatatypeProperty ;
  rdfs:label "culture result organism" ;
  rdfs:comment "Taxonomic information about the cultured organism(s)" ;
  skos:example "Listeria monocytogenes [NCIT:C86502]" ;
  schema:keywords "culture" , "organism" ;
  rdfs:range xsd:string .

MIXS:0001041 a owl:DatatypeProperty ;
  rdfs:label "culture rooting medium" ;
  rdfs:comment "Name or reference for the hydroponic or in vitro culture rooting medium; can be the name of a commonly used medium or reference to a specific medium, e.g. Murashige and Skoog medium. If the medium has not been formally published, use the rooting medium descriptors" ;
  skos:example "http://himedialabs.com/TD/PT158.pdf" ;
  schema:keywords "culture" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001119 a owl:DatatypeProperty ;
  rdfs:label "culture target microbial analyte" ;
  rdfs:comment "The target microbial analyte in terms of investigation scope. This field accepts terms under organism (http://purl.obolibrary.org/obo/NCIT_C14250). This field also accepts identification numbers from NCBI under https://www.ncbi.nlm.nih.gov/taxonomy" ;
  skos:example "Listeria monocytogenes [NCIT:C86502]" ;
  schema:keywords "culture" , "microbial" , "target" ;
  MIXS:Expected_value "NCIT:C14250 or NCBI taxid or culture independent" ;
  rdfs:range xsd:string .

MIXS:0001373 a owl:DatatypeProperty ;
  rdfs:label "cultural era or period" ;
  rdfs:comment "The cultural era approximating to the period in which the archaeological remains existed in. Where possible use terms from ontologies such as Chronontology (https://chronontology.dainst.org/) or PeriodO (https://perio.do/en/)." ;
  skos:example "Copper Age [Chronotology: NW6hofAScJSE]" , "Upper Middle Palaeolthic" , "Not collected" ;
  schema:keywords "ancient" , "age" ;
  MIXS:Expected_value "chronotology or PeriodO term; text" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001080 a owl:DatatypeProperty ;
  rdfs:label "current land use" ;
  rdfs:comment "Present state of sample site" ;
  skos:example "conifers" ;
  schema:keywords "land" , "use" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000312 a owl:DatatypeProperty ;
  rdfs:label "current vegetation" ;
  rdfs:comment "Vegetation classification from one or more standard classification systems, or agricultural crop" ;
  schema:keywords "vegetation" ;
  MIXS:Expected_value "current vegetation type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000314 a owl:DatatypeProperty ;
  rdfs:label "current vegetation method" ;
  rdfs:comment "Reference or method used in vegetation classification" ;
  schema:keywords "method" , "vegetation" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001385 a owl:ObjectProperty ;
  rdfs:label "damage treatment type" ;
  rdfs:comment "Indication of whether characteristic ancient DNA damage has been altered or removed from a DNA extract in a laboratory. If damage has been removed, but whether it was fully or partially removed is unknown (e.g. with UDG treatment) - specify 'other', and describe known information in `sop_experimental` and related free text descriptive terms." ;
  skos:example "none" , "partial-removal" ;
  schema:keywords "ancient" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range MIXS:DamageTreatmentEnum ;
  a owl:FunctionalProperty .

MIXS:0001398 a owl:DatatypeProperty ;
  rdfs:label "description of sequencing reads preprocessing" ;
  rdfs:comment "Description of preprocessing performed on the reads in the sequencing data file. Describe any in silico processing or modification of the sequencing reads away from the original state as received from the sequencer. This should include details such as adapter-, barcode-, and/or quality- trimming, or any filtering such as for read length or of off-target reads." ;
  skos:example "Adapter trimmed, quality filtered, and host reads removed through mapping for ethical reasons." , "Adapters removed by Trimmomatic (v0.39), and off-target reads removed after mapping to the HG19 Human reference with bwa aln (v0.7.19)." , "Demultiplexed with bcl2fastq, inline barcodes removed, and reads quality filtered with fastp (v1.0.0)." ;
  schema:keywords "data analysis" , "data" ;
  MIXS:Expected_value "description of any modifications to data away from original raw files" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001142 a owl:DatatypeProperty ;
  rdfs:label "extreme weather date" ;
  rdfs:comment "Date of unusual weather events that may have affected microbial populations. Multiple terms can be separated by pipes, listed in reverse chronological order" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  schema:keywords "date" , "extreme" , "weather" ;
  rdfs:range xsd:dateTime .

MIXS:0000786 a owl:DatatypeProperty ;
  rdfs:label "date last rain" ;
  rdfs:comment "The date of the last time it rained" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  schema:keywords "date" , "rain" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000074 a owl:DatatypeProperty ;
  rdfs:label "decontamination software" ;
  rdfs:comment "Tool(s) used in contamination screening" ;
  skos:example "anvi'o" ;
  schema:keywords "software" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000435 a owl:DatatypeProperty ;
  rdfs:label "density" ;
  rdfs:comment "Density of the sample, which is its mass per unit volume (aka volumetric mass density)" ;
  skos:example "1000 kilogram per cubic meter" ;
  schema:keywords "density" ;
  MIXS:Preferred_unit "gram per cubic meter, gram per cubic centimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000992 a owl:ObjectProperty ;
  rdfs:label "depositional environment" ;
  rdfs:comment "Main depositional environment (https://en.wikipedia.org/wiki/Depositional_environment). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  schema:keywords "environment" ;
  rdfs:range MIXS:DeposEnvEnum ;
  a owl:FunctionalProperty .

MIXS:0000018 a owl:DatatypeProperty ;
  rdfs:label "depth" ;
  rdfs:comment "The vertical distance below local surface. For sediment or soil samples depth is measured from sediment or soil surface, respectively. Depth can be reported as an interval for subsurface samples" ;
  schema:keywords "depth" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000284 a owl:DatatypeProperty ;
  rdfs:label "dermatology disorder" ;
  rdfs:comment "History of dermatology disorders; can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, skin disease (https://disease-ontology.org/?id=DOID:37)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000084 a owl:DatatypeProperty ;
  rdfs:label "detection type" ;
  rdfs:comment "Type of UViG detection" ;
  skos:example "independent sequence (UViG)" ;
  schema:keywords "type" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000129 a owl:DatatypeProperty ;
  rdfs:label "dew point" ;
  rdfs:comment "The temperature to which a given parcel of humid air must be cooled, at constant barometric pressure, for water vapor to condense into water" ;
  skos:example "22 degree Celsius" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000266 a owl:DatatypeProperty ;
  rdfs:label "major diet change in last six months" ;
  rdfs:comment "Specification of major diet changes in the last six months, if yes the change should be specified" ;
  skos:example "yes;vegetarian diet" ;
  schema:keywords "diet" , "months" ;
  MIXS:Expected_value "diet change;current diet" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001199 a owl:DatatypeProperty ;
  rdfs:label "dietary claim or use" ;
  rdfs:comment "These descriptors are used either for foods intended for special dietary use as defined in 21 CFR 105 or for foods that have special characteristics indicated in the name or labeling. This field accepts terms listed under dietary claim or use (http://purl.obolibrary.org/obo/FOODON_03510023). Multiple terms can be separated by one or more pipes, but please consider limiting this list to the most prominent dietary claim or use" ;
  skos:example "No preservatives [FOODON:03510113]" ;
  schema:keywords "diet" , "use" ;
  MIXS:Expected_value "FOODON:03510023" ;
  rdfs:range xsd:string .

MIXS:0000178 a owl:DatatypeProperty ;
  rdfs:label "diether lipids" ;
  rdfs:comment "Concentration of diether lipids; can include multiple types of diether lipids" ;
  skos:example "0.2 nanogram per liter" ;
  MIXS:Expected_value "diether lipid name;measurement value" ;
  MIXS:Preferred_unit "nanogram per liter" ;
  rdfs:range xsd:string .

MIXS:0000436 a owl:DatatypeProperty ;
  rdfs:label "dissolved carbon dioxide" ;
  rdfs:comment "Concentration of dissolved carbon dioxide in the sample or liquid portion of the sample" ;
  skos:example "5 milligram per liter" ;
  schema:keywords "carbon" , "dissolved" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000179 a owl:DatatypeProperty ;
  rdfs:label "dissolved hydrogen" ;
  rdfs:comment "Concentration of dissolved hydrogen" ;
  skos:example "0.3 micromole per liter" ;
  schema:keywords "dissolved" ;
  MIXS:Preferred_unit "micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000434 a owl:DatatypeProperty ;
  rdfs:label "dissolved inorganic carbon" ;
  rdfs:comment "Dissolved inorganic carbon concentration in the sample, typically measured after filtering the sample using a 0.45 micrometer filter" ;
  skos:example "2059 micromole per kilogram" ;
  schema:keywords "carbon" , "dissolved" , "inorganic" ;
  MIXS:Preferred_unit "microgram per liter, milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000698 a owl:DatatypeProperty ;
  rdfs:label "dissolved inorganic nitrogen" ;
  rdfs:comment "Concentration of dissolved inorganic nitrogen" ;
  skos:example "761 micromole per liter" ;
  schema:keywords "dissolved" , "inorganic" , "nitrogen" ;
  MIXS:Preferred_unit "microgram per liter, micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000106 a owl:DatatypeProperty ;
  rdfs:label "dissolved inorganic phosphorus" ;
  rdfs:comment "Concentration of dissolved inorganic phosphorus in the sample" ;
  skos:example "56.5 micromole per liter" ;
  schema:keywords "dissolved" , "inorganic" , "phosphorus" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000139 a owl:DatatypeProperty ;
  rdfs:label "dissolved iron" ;
  rdfs:comment "Concentration of dissolved iron in the sample" ;
  schema:keywords "dissolved" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000433 a owl:DatatypeProperty ;
  rdfs:label "dissolved organic carbon" ;
  rdfs:comment "Concentration of dissolved organic carbon in the sample, liquid portion of the sample, or aqueous phase of the fluid" ;
  skos:example "197 micromole per liter" ;
  schema:keywords "carbon" , "dissolved" , "organic" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000162 a owl:DatatypeProperty ;
  rdfs:label "dissolved organic nitrogen" ;
  rdfs:comment "Dissolved organic nitrogen concentration measured as; total dissolved nitrogen - NH4 - NO3 - NO2" ;
  skos:example "0.05 micromole per liter" ;
  schema:keywords "dissolved" , "nitrogen" , "organic" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000119 a owl:DatatypeProperty ;
  rdfs:label "dissolved oxygen" ;
  rdfs:comment "Concentration of dissolved oxygen" ;
  skos:example "175 micromole per kilogram" ;
  schema:keywords "dissolved" , "oxygen" ;
  MIXS:Preferred_unit "micromole per kilogram, milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000438 a owl:DatatypeProperty ;
  rdfs:label "dissolved oxygen in fluids" ;
  rdfs:comment "Concentration of dissolved oxygen in the oil field produced fluids as it contributes to oxygen-corrosion and microbial activity (e.g. Mic)" ;
  schema:keywords "dissolved" , "oxygen" ;
  MIXS:Preferred_unit "micromole per kilogram, milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000944 a owl:ObjectProperty ;
  rdfs:label "dominant hand" ;
  rdfs:comment "Dominant hand of the subject" ;
  skos:example "right" ;
  rdfs:range MIXS:DominantHandEnum ;
  a owl:FunctionalProperty .

MIXS:0000795 a owl:ObjectProperty ;
  rdfs:label "door type, composite" ;
  rdfs:comment "The composite type of the door" ;
  skos:example "revolving" ;
  schema:keywords "door" , "type" ;
  rdfs:range MIXS:DoorCompTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000788 a owl:ObjectProperty ;
  rdfs:label "door condition" ;
  rdfs:comment "The physical condition of the door" ;
  skos:example "new" ;
  schema:keywords "condition" , "door" ;
  rdfs:range MIXS:DamagedRupturedEnum ;
  a owl:FunctionalProperty .

MIXS:0000789 a owl:ObjectProperty ;
  rdfs:label "door direction of opening" ;
  rdfs:comment "The direction the door opens" ;
  skos:example "inward" ;
  schema:keywords "direction" , "door" ;
  rdfs:range MIXS:DoorDirectEnum ;
  a owl:FunctionalProperty .

MIXS:0000790 a owl:ObjectProperty ;
  rdfs:label "door location" ;
  rdfs:comment "The relative location of the door in the room" ;
  skos:example "north" ;
  schema:keywords "door" , "location" ;
  rdfs:range MIXS:CompassDirections8Enum ;
  a owl:FunctionalProperty .

MIXS:0000791 a owl:ObjectProperty ;
  rdfs:label "door material" ;
  rdfs:comment "The material the door is composed of" ;
  skos:example "wood" ;
  schema:keywords "door" , "material" ;
  rdfs:range MIXS:DoorMatEnum ;
  a owl:FunctionalProperty .

MIXS:0000792 a owl:ObjectProperty ;
  rdfs:label "door movement" ;
  rdfs:comment "The type of movement of the door" ;
  skos:example "swinging" ;
  schema:keywords "door" ;
  rdfs:range MIXS:DoorMoveEnum ;
  a owl:FunctionalProperty .

MIXS:0000158 a owl:DatatypeProperty ;
  rdfs:label "door area or size" ;
  rdfs:comment "The size of the door" ;
  skos:example "2.5 square meter" ;
  schema:keywords "area" , "door" , "size" ;
  MIXS:Preferred_unit "square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000794 a owl:ObjectProperty ;
  rdfs:label "door type" ;
  rdfs:comment "The type of door material" ;
  skos:example "wooden" ;
  schema:keywords "door" , "type" ;
  rdfs:range MIXS:DoorTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000796 a owl:ObjectProperty ;
  rdfs:label "door type, metal" ;
  rdfs:comment "The type of metal door" ;
  skos:example "hollow" ;
  schema:keywords "door" , "type" ;
  rdfs:range MIXS:DoorTypeMetalEnum ;
  a owl:FunctionalProperty .

MIXS:0000797 a owl:DatatypeProperty ;
  rdfs:label "door type, wood" ;
  rdfs:comment "The type of wood door" ;
  skos:example "battened" ;
  schema:keywords "door" , "type" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000793 a owl:ObjectProperty ;
  rdfs:label "door signs of water/mold" ;
  rdfs:comment "Signs of the presence of mold or mildew on a door" ;
  skos:example "presence of mold visible" ;
  schema:keywords "door" ;
  rdfs:range MIXS:MoldVisibilityEnum ;
  a owl:FunctionalProperty .

MIXS:0000967 a owl:DatatypeProperty ;
  rdfs:label "douche" ;
  rdfs:comment "Date of most recent douche" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000703 a owl:DatatypeProperty ;
  rdfs:label "downward PAR" ;
  rdfs:comment "Visible waveband radiance and irradiance measurements in the water column" ;
  skos:example "28.71 microEinstein per square meter per second" ;
  MIXS:Preferred_unit "microEinstein per square meter per second, microEinstein per square centimeter per second" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001085 a owl:ObjectProperty ;
  rdfs:label "drainage classification" ;
  rdfs:comment "Drainage classification from a standard system such as the USDA system" ;
  skos:example "well" ;
  schema:keywords "classification" ;
  rdfs:range MIXS:DrainageClassEnum ;
  a owl:FunctionalProperty .

MIXS:0000798 a owl:ObjectProperty ;
  rdfs:label "drawings" ;
  rdfs:comment "The buildings architectural drawings; if design is chosen, indicate phase-conceptual, schematic, design development, and construction documents" ;
  skos:example "sketch" ;
  schema:keywords "drawings" ;
  rdfs:range MIXS:DrawingsEnum ;
  a owl:FunctionalProperty .

MIXS:0000894 a owl:DatatypeProperty ;
  rdfs:label "drug usage" ;
  rdfs:comment "Any drug used by subject and the frequency of usage; can include multiple drugs used" ;
  skos:example "Lipitor;2/day" ;
  schema:keywords "drug" , "use" ;
  MIXS:Expected_value "drug name;frequency" ;
  rdfs:range xsd:string .

MIXS:0001375 a owl:DatatypeProperty ;
  rdfs:label "earliest chronometric age" ;
  rdfs:comment "The maximum/earliest/oldest possible age of a specimen as determined by a dating method. If multiple dating measurements available, use the most earliest/oldest date to provide widest range of age possibilities. The specific age unit should be specified by the term earliest_chrono_sys. More information on specific dates (e.g. radiocarbon lab codes) can be specified in the term chrono_age_remarks." ;
  skos:example "120000" , "1900" ;
  skos:broadMatch chrono:earliestChronometricAge ;
  MIXS:Expected_value "age value corresponding to unit" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0001376 a owl:ObjectProperty ;
  rdfs:label "earliest chronometric age reference system" ;
  rdfs:comment "The reference system associated with the earliest_chrono_age." ;
  skos:example "cal BP" , "CE" , "Ma" , "ka" ;
  skos:broadMatch chrono:earliestChronometricAgeReferenceSystem ;
  rdfs:range MIXS:ChronoAgeSysEnum ;
  a owl:FunctionalProperty .

MIXS:0000657 a owl:DatatypeProperty ;
  rdfs:label "efficiency percent" ;
  rdfs:comment "Percentage of volatile solids removed from the anaerobic digestor" ;
  schema:keywords "percent" ;
  MIXS:Preferred_unit "micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000093 a owl:DatatypeProperty ;
  rdfs:label "elevation" ;
  rdfs:comment "Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit" ;
  skos:example "100 meter" ;
  schema:keywords "elevation" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000799 a owl:DatatypeProperty ;
  rdfs:label "elevator count" ;
  rdfs:comment "The number of elevators within the built structure" ;
  skos:example "2" ;
  schema:keywords "count" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000660 a owl:DatatypeProperty ;
  rdfs:label "emulsions" ;
  rdfs:comment "Amount or concentration of substances such as paints, adhesives, mayonnaise, hair colorants, emulsified oils, etc.; can include multiple emulsion types" ;
  MIXS:Expected_value "emulsion name;measurement value" ;
  MIXS:Preferred_unit "gram per liter" ;
  rdfs:range xsd:string .

MIXS:0000034 a owl:DatatypeProperty ;
  rdfs:label "encoded traits" ;
  rdfs:comment "Should include key traits like antibiotic resistance or xenobiotic degradation phenotypes for plasmids, converting genes for phage" ;
  skos:example "beta-lactamase class A" ;
  MIXS:Expected_value "for plasmid: antibiotic resistance; for phage: converting genes" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001177 a owl:DatatypeProperty ;
  rdfs:label "enrichment protocol" ;
  rdfs:comment "The microbiological workflow or protocol followed to test for the presence or enumeration of the target microbial analyte(s). Please provide a PubMed or DOI reference for published protocols" ;
  skos:example "BAM Chapter 4: Enumeration of Escherichia coli and the Coliform Bacteria" ;
  schema:keywords "enrichment" , "protocol" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000012 a owl:DatatypeProperty ;
  rdfs:label "broad-scale environmental context" ;
  rdfs:comment "Report the major environmental system the sample or specimen came from. The system(s) identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. in the desert or a rainforest). We recommend using subclasses of EnvO s biome class:  http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS" ;
  skos:example "rangeland biome [ENVO:01000247]" ;
  schema:keywords "context" , "environmental" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000013 a owl:DatatypeProperty ;
  rdfs:label "local environmental context" ;
  rdfs:comment "Report the entity or entities which are in the sample or specimen s local vicinity and which you believe have significant causal influences on your sample or specimen. We recommend using EnvO terms which are of smaller spatial grain than your entry for env_broad_scale. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS" ;
  skos:example "hillside [ENVO:01000333]" ;
  schema:keywords "context" , "environmental" ;
  MIXS:Expected_value "Environmental entities having causal influences upon the entity at time of sampling" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000014 a owl:DatatypeProperty ;
  rdfs:label "environmental medium" ;
  rdfs:comment "Report the environmental material(s) immediately surrounding the sample or specimen at the time of sampling. We recommend using subclasses of 'environmental material' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. a tree, a leaf, a table top)" ;
  skos:example "bluegrass field soil [ENVO:00005789]" ;
  schema:keywords "environmental" ;
  rdfs:range xsd:string .

MIXS:0001254 a owl:DatatypeProperty ;
  rdfs:label "food production environmental monitoring zone" ;
  rdfs:comment "An environmental monitoring zone is a formal designation as part of an environmental monitoring program, in which areas of a food production facility are categorized, commonly as zones 1-4, based on likelihood or risk of foodborne pathogen contamination. This field accepts terms listed under food production environmental monitoring zone (http://purl.obolibrary.org/obo/ENVO). Please add a term to indicate the environmental monitoring zone the sample was taken from" ;
  skos:example "Zone 1" ;
  schema:keywords "environmental" , "food" , "production" ;
  MIXS:Expected_value "ENVO" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000800 a owl:DatatypeProperty ;
  rdfs:label "escalator count" ;
  rdfs:comment "The number of escalators within the built structure" ;
  skos:example "4" ;
  schema:keywords "count" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000024 a owl:DatatypeProperty ;
  rdfs:label "estimated genome size" ;
  rdfs:comment "The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period" ;
  skos:note "Slot updated 2026-02-10 `estimated_size` and title 'estimated size'" ;
  skos:example "300000 bp" ;
  schema:keywords "size" ;
  MIXS:Expected_value "number of base pairs" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000895 a owl:DatatypeProperty ;
  rdfs:label "ethnicity" ;
  rdfs:comment "A category of people who identify with each other, usually on the basis of presumed similarities such as a common language, ancestry, history, society, culture, nation or social treatment within their residing area. https://en.wikipedia.org/wiki/List_of_contemporary_ethnic_groups" ;
  skos:example "native american" ;
  MIXS:Expected_value "text recommend from Wikipedia list" ;
  rdfs:range xsd:string .

MIXS:0000155 a owl:DatatypeProperty ;
  rdfs:label "ethylbenzene" ;
  rdfs:comment "Concentration of ethylbenzene in the sample" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000144 a owl:DatatypeProperty ;
  rdfs:label "exposed ductwork" ;
  rdfs:comment "The amount of exposed ductwork in the room" ;
  MIXS:Preferred_unit "square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000220 a owl:DatatypeProperty ;
  rdfs:label "exposed pipes" ;
  rdfs:comment "The number of exposed pipes in the room" ;
  schema:keywords "pipes" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000008 a owl:DatatypeProperty ;
  rdfs:label "experimental factor" ;
  rdfs:comment "Variable aspects of an experiment design that can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI)" ;
  skos:example "time series design [EFO:0001779]" ;
  schema:keywords "experimental" , "factor" ;
  MIXS:Expected_value "text or EFO and/or OBI" ;
  rdfs:range [
    a rdfs:Datatype ;
    owl:onDatatype xsd:string ;
    owl:withRestrictions ( _:o6965 )
  ] .

_:o6965 xsd:pattern "\\S+.*\\S+ \\[[a-zA-Z]{2,}:\\d+\\]" .

MIXS:0000170 a owl:DatatypeProperty ;
  rdfs:label "exterior door count" ;
  rdfs:comment "The number of exterior doors in the built structure" ;
  schema:keywords "count" , "door" , "exterior" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000817 a owl:ObjectProperty ;
  rdfs:label "orientations of exterior wall" ;
  rdfs:comment "The orientation of the exterior wall" ;
  skos:example "northwest" ;
  schema:keywords "exterior" , "wall" ;
  rdfs:range MIXS:CompassDirections8Enum ;
  a owl:FunctionalProperty .

MIXS:0000818 a owl:ObjectProperty ;
  rdfs:label "orientations of exterior window" ;
  rdfs:comment "The compass direction the exterior window of the room is facing" ;
  skos:example "southwest" ;
  schema:keywords "exterior" , "window" ;
  rdfs:range MIXS:CompassDirections8Enum ;
  a owl:FunctionalProperty .

MIXS:0001141 a owl:ObjectProperty ;
  rdfs:label "extreme weather event" ;
  rdfs:comment "Unusual weather events that may have affected microbial populations. Multiple terms can be separated by pipes, listed in reverse chronological order" ;
  skos:example "hail" ;
  schema:keywords "event" , "extreme" , "weather" ;
  rdfs:range MIXS:ExtrWeatherEventEnum .

MIXS:0000023 a owl:DatatypeProperty ;
  rdfs:label "extrachromosomal elements" ;
  rdfs:comment "Do plasmids exist of significant phenotypic consequence (e.g. ones that determine virulence or antibiotic resistance). Megaplasmids? Other plasmids (borrelia has 15+ plasmids)" ;
  skos:example "5" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000320 a owl:DatatypeProperty ;
  rdfs:label "history/extreme events" ;
  rdfs:comment "Unusual physical events that may have affected microbial populations" ;
  schema:keywords "event" , "history" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0001252 a owl:ObjectProperty ;
  rdfs:label "facility type" ;
  rdfs:comment "Establishment details about the type of facility where the sample was taken. This is independent of the specific product(s) within the facility" ;
  skos:example "manufacturing-processing" ;
  schema:keywords "facility" , "type" ;
  rdfs:range MIXS:FacilityTypeEnum .

MIXS:0001083 a owl:ObjectProperty ;
  rdfs:label "soil_taxonomic/FAO classification" ;
  rdfs:comment "Soil classification from the FAO World soil distribution from International Soil Reference and Information Centre (ISRIC). The list of available soil classifications can be found at https://www.isric.org/explore/world-soil-distribution" ;
  skos:example "Luvisols" ;
  schema:keywords "classification" ;
  rdfs:range MIXS:FaoClassEnum ;
  a owl:FunctionalProperty .

MIXS:0001126 a owl:DatatypeProperty ;
  rdfs:label "farm equipment used" ;
  rdfs:comment "List of equipment used for planting, fertilization, harvesting, irrigation, land levelling, residue management, weeding or transplanting during the growing season.  This field accepts terms listed under agricultural implement (http://purl.obolibrary.org/obo/AGRO_00000416). Multiple terms can be separated by pipes" ;
  skos:example "combine harvester [AGRO:00000473]" ;
  schema:keywords "equipment" , "farm" , "use" ;
  rdfs:range xsd:string .

MIXS:0001124 a owl:DatatypeProperty ;
  rdfs:label "farm equipment sanitization" ;
  rdfs:comment "Method used to sanitize growing and harvesting equipment. This can including type and concentration of sanitizing solution.  Multiple terms can be separated by one or more pipes" ;
  skos:example "hot water pressure wash, hypochlorite solution, 50 parts per million" ;
  schema:keywords "equipment" , "farm" ;
  MIXS:Expected_value "text or commercial name of sanitizer or class of sanitizer or active ingredient in sanitizer" ;
  MIXS:Preferred_unit "parts per million" ;
  rdfs:range xsd:string .

MIXS:0001125 a owl:DatatypeProperty ;
  rdfs:label "farm equipment sanitization frequency" ;
  rdfs:comment "The number of times farm equipment is cleaned. Frequency of cleaning might be on a Daily basis, Weekly, Monthly, Quarterly or Annually" ;
  skos:example "Biweekly" ;
  schema:keywords "equipment" , "farm" , "frequency" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001123 a owl:DatatypeProperty ;
  rdfs:label "equipment shared with other farms" ;
  rdfs:comment "List of planting, growing or harvesting equipment shared with other farms. This field accepts terms listed under agricultural implement (http://purl.obolibrary.org/obo/AGRO_00000416). Multiple terms can be separated by pipes" ;
  skos:example "combine harvester [AGRO:00000473]" ;
  schema:keywords "equipment" , "farm" ;
  rdfs:range xsd:string .

MIXS:0001110 a owl:ObjectProperty ;
  rdfs:label "farm watering water source" ;
  rdfs:comment "Source of water used on the farm for irrigation of crops or watering of livestock" ;
  skos:example "well" ;
  schema:keywords "farm" , "source" , "water" ;
  rdfs:range MIXS:FarmWaterSourceEnum ;
  a owl:FunctionalProperty .

MIXS:0000061 a owl:DatatypeProperty ;
  rdfs:label "feature prediction" ;
  rdfs:comment "Method used to predict UViGs features such as ORFs, integration site, etc" ;
  skos:example "Prodigal;2.6.3;default parameters" ;
  schema:keywords "feature" , "predict" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001185 a owl:DatatypeProperty ;
  rdfs:label "fermentation chemical additives" ;
  rdfs:comment "Any chemicals that are added to the fermentation process to achieve the desired final product" ;
  skos:example "salt" ;
  schema:keywords "fermentation" ;
  MIXS:Expected_value "chemical ingredient" ;
  rdfs:range xsd:string .

MIXS:0001186 a owl:DatatypeProperty ;
  rdfs:label "fermentation chemical additives percentage" ;
  rdfs:comment "The amount of chemical added to the fermentation process" ;
  skos:example "0.01" ;
  schema:keywords "fermentation" , "percent" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:float .

MIXS:0001187 a owl:DatatypeProperty ;
  rdfs:label "fermentation headspace oxygen" ;
  rdfs:comment "The amount of headspace oxygen in a fermentation vessel" ;
  skos:example "0.05" ;
  schema:keywords "fermentation" , "oxygen" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0001188 a owl:DatatypeProperty ;
  rdfs:label "fermentation medium" ;
  rdfs:comment "The growth medium used for the fermented food fermentation process, which supplies the required nutrients.  Usually this includes a carbon and nitrogen source, water, micronutrients and chemical additives" ;
  skos:example "molasses" ;
  schema:keywords "fermentation" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001189 a owl:DatatypeProperty ;
  rdfs:label "fermentation pH" ;
  rdfs:comment "The pH of the fermented food fermentation process" ;
  skos:example "4.5" ;
  schema:keywords "fermentation" , "ph" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0001190 a owl:DatatypeProperty ;
  rdfs:label "fermentation relative humidity" ;
  rdfs:comment "The relative humidity of the fermented food fermentation process" ;
  skos:note "percent or float?" ;
  skos:example "95%" ;
  schema:keywords "fermentation" , "humidity" , "relative" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001191 a owl:DatatypeProperty ;
  rdfs:label "fermentation temperature" ;
  rdfs:comment "The temperature of the fermented food fermentation process" ;
  skos:example "22 degrees Celsius" ;
  schema:keywords "fermentation" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001192 a owl:DatatypeProperty ;
  rdfs:label "fermentation time" ;
  rdfs:comment "The time duration of the fermented food fermentation process" ;
  skos:example "P10D" ;
  schema:keywords "fermentation" , "time" ;
  MIXS:Preferred_unit "days" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001193 a owl:DatatypeProperty ;
  rdfs:label "fermentation vessel" ;
  rdfs:comment "The type of vessel used for containment of the fermentation" ;
  skos:example "steel drum" ;
  schema:keywords "fermentation" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001127 a owl:DatatypeProperty ;
  rdfs:label "fertilizer administration" ;
  rdfs:comment "Type of fertilizer or amendment added to the soil or water for the purpose of improving substrate health and quality for plant growth. This field accepts terms listed under agronomic fertilizer (http://purl.obolibrary.org/obo/AGRO_00002062). Multiple terms may apply and can be separated by pipes, listing in reverse chronological order" ;
  skos:example "fish emulsion [AGRO:00000082]" ;
  schema:keywords "administration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001128 a owl:DatatypeProperty ;
  rdfs:label "fertilizer administration date" ;
  rdfs:comment "Date of administration of soil amendment or fertilizer. Multiple terms may apply and can be separated by pipes, listing in reverse chronological order" ;
  skos:example "2018-05-11T10:00:00+01:00" ;
  schema:keywords "administration" , "date" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000556 a owl:DatatypeProperty ;
  rdfs:label "fertilizer regimen" ;
  rdfs:comment "Information about treatment involving the use of fertilizers; should include the name of fertilizer, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple fertilizer regimens" ;
  skos:example "urea;0.6 milligram per liter;R2/2018-05-11:T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" ;
  MIXS:Expected_value "fertilizer name;fertilizer amount;treatment interval and duration" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0000291 a owl:DatatypeProperty ;
  rdfs:label "field name" ;
  rdfs:comment "Name of the hydrocarbon field (e.g. Albacora)" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000765 a owl:ObjectProperty ;
  rdfs:label "filter type" ;
  rdfs:comment "A device which removes solid particulates or airborne molecular contaminants" ;
  skos:example "HEPA" ;
  schema:keywords "filter" , "type" ;
  rdfs:range MIXS:FilterTypeEnum .

MIXS:0001086 a owl:DatatypeProperty ;
  rdfs:label "history/fire" ;
  rdfs:comment "Historical and/or physical evidence of fire" ;
  schema:keywords "history" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000802 a owl:ObjectProperty ;
  rdfs:label "fireplace type" ;
  rdfs:comment "A firebox with chimney" ;
  skos:example "wood burning" ;
  schema:keywords "type" ;
  rdfs:range MIXS:FireplaceTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000319 a owl:DatatypeProperty ;
  rdfs:label "history/flooding" ;
  rdfs:comment "Historical and/or physical evidence of flooding" ;
  schema:keywords "history" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000164 a owl:DatatypeProperty ;
  rdfs:label "floor age" ;
  rdfs:comment "The time period since installment of the carpet or flooring" ;
  schema:keywords "age" , "floor" ;
  MIXS:Preferred_unit "years, weeks, days" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000165 a owl:DatatypeProperty ;
  rdfs:label "floor area" ;
  rdfs:comment "The area of the floor space within the room" ;
  schema:keywords "area" , "floor" ;
  MIXS:Preferred_unit "square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000803 a owl:ObjectProperty ;
  rdfs:label "floor condition" ;
  rdfs:comment "The physical condition of the floor at the time of sampling; photos or video preferred; use drawings to indicate location of damaged areas" ;
  skos:example "new" ;
  schema:keywords "condition" , "floor" ;
  rdfs:range MIXS:DamagedEnum ;
  a owl:FunctionalProperty .

MIXS:0000225 a owl:DatatypeProperty ;
  rdfs:label "floor count" ;
  rdfs:comment "The number of floors in the building, including basements and mechanical penthouse" ;
  schema:keywords "count" , "floor" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000804 a owl:DatatypeProperty ;
  rdfs:label "floor finish material" ;
  rdfs:comment "The floor covering type; the finished surface that is walked on" ;
  skos:example "carpet" ;
  schema:keywords "floor" , "material" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000806 a owl:ObjectProperty ;
  rdfs:label "floor structure" ;
  rdfs:comment "Refers to the structural elements and subfloor upon which the finish flooring is installed" ;
  skos:example "concrete" ;
  schema:keywords "floor" ;
  rdfs:range MIXS:FloorStrucEnum ;
  a owl:FunctionalProperty .

MIXS:0000166 a owl:DatatypeProperty ;
  rdfs:label "floor thermal mass" ;
  rdfs:comment "The ability of the floor to provide inertia against temperature fluctuations" ;
  schema:keywords "floor" , "mass" ;
  MIXS:Preferred_unit "joule per degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000805 a owl:ObjectProperty ;
  rdfs:label "floor signs of water/mold" ;
  rdfs:comment "Signs of the presence of mold or mildew in a room" ;
  skos:example "ceiling discoloration" ;
  schema:keywords "floor" ;
  rdfs:range MIXS:FloorWaterMoldEnum ;
  a owl:FunctionalProperty .

MIXS:0000704 a owl:DatatypeProperty ;
  rdfs:label "fluorescence" ;
  rdfs:comment "Raw or converted fluorescence of water" ;
  skos:example "2.5 volts" ;
  MIXS:Preferred_unit "milligram chlorophyll a per cubic meter, volts" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000275 a owl:DatatypeProperty ;
  rdfs:label "amniotic fluid/foetal health status" ;
  rdfs:comment "Specification of foetal health status, should also include abortion" ;
  schema:keywords "status" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001200 a owl:DatatypeProperty ;
  rdfs:label "food additive" ;
  rdfs:comment "A substance or substances added to food to maintain or improve safety and freshness, to improve or maintain nutritional value, or improve taste, texture and appearance.  This field accepts terms listed under food additive (http://purl.obolibrary.org/obo/FOODON_03412972). Multiple terms can be separated by one or more pipes, but please consider limiting this list to the top 5 ingredients listed in order as on the food label.  See also, https://www.fda.gov/food/food-ingredients-packaging/overview-food-ingredients-additives-colors" ;
  skos:example "xanthan gum [FOODON:03413321]" ;
  schema:keywords "food" ;
  MIXS:Expected_value "FOODON:03412972" ;
  rdfs:range xsd:string .

MIXS:0001201 a owl:DatatypeProperty ;
  rdfs:label "food allergen labeling" ;
  rdfs:comment "A label indication that the product contains a recognized allergen. This field accepts terms listed under dietary claim or use (http://purl.obolibrary.org/obo/FOODON_03510213)" ;
  skos:example "food allergen labelling about crustaceans and products thereof [FOODON:03510215]" ;
  schema:keywords "food" ;
  MIXS:Expected_value "FOODON:03510213" ;
  rdfs:range xsd:string .

MIXS:food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "FoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with Extension FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001182 a owl:ObjectProperty ;
  rdfs:label "food cleaning process" ;
  rdfs:comment "The process of cleaning food to separate other environmental materials from the food source. Multiple terms can be separated by pipes" ;
  skos:example "rinsed with water" , "scrubbed with brush" ;
  schema:keywords "food" , "process" ;
  rdfs:range MIXS:FoodCleanProcEnum ;
  a owl:FunctionalProperty .

MIXS:0001131 a owl:DatatypeProperty ;
  rdfs:label "food contact surface" ;
  rdfs:comment "The specific container or coating materials in direct contact with the food. Multiple values can be assigned.  This field accepts terms listed under food contact surface (http://purl.obolibrary.org/obo/FOODON_03500010)" ;
  skos:example "cellulose acetate [FOODON:03500034]" ;
  schema:keywords "food" , "surface" ;
  MIXS:Expected_value "FOODON:03500010" ;
  rdfs:range xsd:string .

MIXS:0001132 a owl:DatatypeProperty ;
  rdfs:label "food container or wrapping" ;
  rdfs:comment "Type of container or wrapping defined by the main container material, the container form, and the material of the liner lids or ends. Also type of container or wrapping by form; prefer description by material first, then by form. This field accepts terms listed under food container or wrapping (http://purl.obolibrary.org/obo/FOODON_03490100)" ;
  skos:example "Plastic shrink-pack [FOODON:03490137]" ;
  schema:keywords "food" ;
  MIXS:Expected_value "FOODON:03490100" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001202 a owl:DatatypeProperty ;
  rdfs:label "food cooking process" ;
  rdfs:comment "The transformation of raw food by the application of heat. This field accepts terms listed under food cooking (http://purl.obolibrary.org/obo/FOODON_03450002)" ;
  skos:example "food blanching [FOODON:03470175]" ;
  schema:keywords "food" , "process" ;
  MIXS:Expected_value "FOODON:03450002" ;
  rdfs:range xsd:string .

MIXS:0001203 a owl:DatatypeProperty ;
  rdfs:label "food distribution point geographic location" ;
  rdfs:comment "A reference to a place on the Earth, by its name or by its geographical location that refers to a distribution point along the food chain. This field accepts terms listed under geographic location (http://purl.obolibrary.org/obo/GAZ_00000448). Reference: Adam Diamond, James Barham. Moving Food Along the Value Chain: Innovations in Regional Food Distribution. U.S. Dept. of Agriculture, Agricultural Marketing Service. Washington, DC. March 2012. http://dx.doi.org/10.9752/MS045.03-2012" ;
  skos:example "USA: Delmarva, Peninsula" ;
  schema:keywords "food" , "geographic" , "location" ;
  rdfs:range xsd:string .

MIXS:0001204 a owl:DatatypeProperty ;
  rdfs:label "food distribution point geographic location (city)" ;
  rdfs:comment "A reference to a place on the Earth, by its name or by its geographical location that refers to a distribution point along the food chain. This field accepts terms listed under geographic location (http://purl.obolibrary.org/obo/GAZ_00000448). Reference: Adam Diamond, James Barham. Moving Food Along the Value Chain: Innovations in Regional Food Distribution. U.S. Dept. of Agriculture, Agricultural Marketing Service. Washington, DC. March 2012. http://dx.doi.org/10.9752/MS045.03-2012" ;
  skos:example "Atlanta[GAZ:00004445]" ;
  schema:keywords "food" , "geographic" , "location" ;
  MIXS:Expected_value "GAZ:00000448" ;
  rdfs:range xsd:string .

MIXS:food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "FoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with Extension FoodFarmEnvironment" ;
  rdfs:range MIXS:0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "FoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with Extension FoodFoodProductionFacility" ;
  rdfs:range MIXS:0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001133 a owl:DatatypeProperty ;
  rdfs:label "Food harvesting process" ;
  rdfs:comment "A harvesting process is a process which takes in some food material from an individual or community of plant or animal organisms in a given context and time, and outputs a precursor or consumable food product. This may include a part of an organism or the whole, and may involve killing the organism" ;
  skos:example "hand-picked" ;
  schema:keywords "food" , "process" ;
  rdfs:range xsd:string .

MIXS:food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "FoodHumanFoods data" ;
  rdfs:comment "Data that comply with Extension FoodHumanFoods" ;
  rdfs:range MIXS:0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001205 a owl:DatatypeProperty ;
  rdfs:label "food ingredient" ;
  rdfs:comment "In this field, please list individual ingredients for multi-component food [FOODON:00002501] and simple foods that is not captured in food_type.  Please use terms that are present in FoodOn.  Multiple terms can be separated by one or more pipes |, but please consider limiting this list to the top 5 ingredients listed in order as on the food label.  See also, https://www.fda.gov/food/food-ingredients-packaging/overview-food-ingredients-additives-colors" ;
  skos:example "bean (whole) [FOODON:00002753]" ;
  schema:keywords "food" , "ingredient" ;
  MIXS:Expected_value "FOODON" ;
  rdfs:range xsd:string .

MIXS:0001206 a owl:DatatypeProperty ;
  rdfs:label "food product name legal status" ;
  rdfs:comment "A datum indicating that use of a food product name is regulated in some legal jurisdiction. This field accepts terms listed under food product name legal status (http://purl.obolibrary.org/obo/FOODON_03530087)" ;
  skos:example "protected geographic indication [FOODON:03530256]" ;
  schema:keywords "food" , "product" , "status" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001207 a owl:DatatypeProperty ;
  rdfs:label "food product origin geographic location" ;
  rdfs:comment "A reference to a place on the Earth, by its name or by its geographical location that describes the origin of the food commodity, either in terms of its cultivation or production. This field accepts terms listed under geographic location (http://purl.obolibrary.org/obo/GAZ_00000448)" ;
  skos:example "USA: Delmarva, Peninsula" ;
  schema:keywords "food" , "geographic" , "location" , "product" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001208 a owl:DatatypeProperty ;
  rdfs:label "food package capacity" ;
  rdfs:comment "The maximum number of product units within a package" ;
  skos:example "454 grams" ;
  schema:keywords "food" , "package" ;
  MIXS:Preferred_unit "grams" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001209 a owl:DatatypeProperty ;
  rdfs:label "food packing medium integrity" ;
  rdfs:comment "A term label and term id to describe the state of the packing material and text to explain the exact condition.  This field accepts terms listed under food packing medium integrity (http://purl.obolibrary.org/obo/FOODON_03530218)" ;
  skos:example "food packing medium compromised [FOODON:00002517]" ;
  schema:keywords "food" ;
  MIXS:Expected_value "FOODON:03530218" ;
  rdfs:range xsd:string .

MIXS:0001134 a owl:DatatypeProperty ;
  rdfs:label "food packing medium" ;
  rdfs:comment "The medium in which the food is packed for preservation and handling or the medium surrounding homemade foods, e.g., peaches cooked in sugar syrup. The packing medium may provide a controlled environment for the food. It may also serve to improve palatability and consumer appeal.  This includes edible packing media (e.g. fruit juice), gas other than air (e.g. carbon dioxide), vacuum packed, or packed with aerosol propellant. This field accepts terms under food packing medium (http://purl.obolibrary.org/obo/FOODON_03480020). Multiple terms may apply and can be separated by pipes" ;
  schema:keywords "food" ;
  MIXS:Expected_value "FOODON:03480020" ;
  rdfs:range xsd:string .

MIXS:0001135 a owl:DatatypeProperty ;
  rdfs:label "food preservation process" ;
  rdfs:comment "The methods contributing to the prevention or retardation of microbial, enzymatic or oxidative spoilage and thus to the extension of shelf life. This field accepts terms listed under food preservation process (http://purl.obolibrary.org/obo/FOODON_03470107)" ;
  skos:example "food slow freezing [FOODON:03470128]" ;
  schema:keywords "food" , "process" ;
  MIXS:Expected_value "FOODON:03470107" ;
  rdfs:range xsd:string .

MIXS:0001210 a owl:DatatypeProperty ;
  rdfs:label "material of contact prior to food packaging" ;
  rdfs:comment "The material the food contacted (e.g., was processed in) prior to packaging. This field accepts terms listed under material of contact prior to food packaging (http://purl.obolibrary.org/obo/FOODON_03530077). If the proper descriptor is not listed please use text to describe the material of contact prior to food packaging" ;
  skos:example "processed in stainless steel container [FOODON:03530081]" ;
  schema:keywords "food" , "material" , "prior" ;
  MIXS:Expected_value "FOODON:03530077" ;
  rdfs:range xsd:string .

MIXS:0001211 a owl:DatatypeProperty ;
  rdfs:label "food production system characteristics" ;
  rdfs:comment "Descriptors of the food production system or of the agricultural environment and growing conditions related to the farm production system, such as wild caught, organic, free-range, industrial, dairy, beef,  domestic or cultivated food production. This field accepts terms listed under food production (http://purl.obolibrary.org/obo/FOODON_03530206). Multiple terms may apply and can be separated by pipes" ;
  skos:example "organic plant cultivation [FOODON:03530253]" ;
  schema:keywords "food" , "production" ;
  rdfs:range xsd:string .

MIXS:0001136 a owl:DatatypeProperty ;
  rdfs:label "food production characteristics" ;
  rdfs:comment "Descriptors of the food production system such as wild caught, free-range, organic, free-range, industrial, dairy, beef" ;
  skos:example "wild caught" ;
  schema:keywords "food" , "production" ;
  rdfs:range xsd:string .

MIXS:0001212 a owl:DatatypeProperty ;
  rdfs:label "food product synonym" ;
  rdfs:comment "Other names by which the food product is known by (e.g., regional or non-English names)" ;
  skos:example "pinot gris" ;
  schema:keywords "food" , "product" ;
  rdfs:range xsd:string .

MIXS:0001213 a owl:DatatypeProperty ;
  rdfs:label "food product by quality" ;
  rdfs:comment "Descriptors for describing food visually or via other senses, which is useful for tasks like food inspection where little prior knowledge of how the food came to be is available. Some terms like \"food (frozen)\" are both a quality descriptor and the output of a process. This field accepts terms listed under food product by quality (http://purl.obolibrary.org/obo/FOODON_00002454)" ;
  skos:example "raw [FOODON:03311126]" ;
  schema:keywords "food" , "product" , "quality" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001184 a owl:DatatypeProperty ;
  rdfs:label "food product type" ;
  rdfs:comment "A food product type is a class of food products that is differentiated by its food composition (e.g., single- or multi-ingredient), processing and/or consumption characteristics. This does not include brand name products but it may include generic food dish categories. This field accepts terms under food product type (http://purl.obolibrary.org/obo/FOODON:03400361). For terms related to food product for an animal, consult food product for animal (http://purl.obolibrary.org/obo/FOODON_03309997). If the proper descriptor is not listed please use text to describe the food type. Multiple terms can be separated by one or more pipes" ;
  schema:keywords "food" , "product" , "type" ;
  MIXS:Expected_value "FOODON:00001002 or FOODON:03309997" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001178 a owl:DatatypeProperty ;
  rdfs:label "food quality date" ;
  rdfs:comment "The date recommended for the use of the product while at peak quality, this date is not a reflection of safety unless used on infant formula this date is not a reflection of safety and is typically labeled on a food product as \"best if used by,\" best by,\" \"use by,\" or \"freeze by.\"" ;
  skos:example "best by 2020-05-24" ;
  schema:keywords "date" , "food" , "quality" ;
  MIXS:Expected_value "enumeration, date" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001139 a owl:DatatypeProperty ;
  rdfs:label "food source" ;
  rdfs:comment "Type of plant or animal from which the food product or its major ingredient is derived or a chemical food source [FDA CFSAN 1995]" ;
  schema:keywords "food" , "source" ;
  MIXS:Expected_value "FOODON term" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001251 a owl:DatatypeProperty ;
  rdfs:label "food source age" ;
  rdfs:comment "The age of the food source host organism. Depending on the type of host organism, age may be more appropriate to report in days, weeks, or years" ;
  skos:note "ISO 8601 period or measurement value?" ;
  skos:example "6 months" ;
  schema:keywords "age" , "food" , "source" ;
  MIXS:Preferred_unit "days" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001214 a owl:ObjectProperty ;
  rdfs:label "food traceability list category" ;
  rdfs:comment "The FDA is proposing to establish additional traceability recordkeeping requirements (beyond what is already required in existing regulations) for persons who manufacture, process, pack, or hold foods the Agency has designated for inclusion on the Food Traceability List. The Food Traceability List (FTL) identifies the foods for which the additional traceability records described in the proposed rule would be required. The term  Food Traceability List  (FTL) refers not only to the foods specifically listed (https://www.fda.gov/media/142303/download), but also to any foods that contain listed foods as ingredients" ;
  skos:example "tropical tree fruits" ;
  schema:keywords "food" ;
  rdfs:range MIXS:FoodTraceListEnum ;
  a owl:FunctionalProperty .

MIXS:0001137 a owl:DatatypeProperty ;
  rdfs:label "food shipping transportation method" ;
  rdfs:comment "A descriptor for the method of movement of food commodity along the food distribution system.  This field accepts terms listed under travel mode (http://purl.obolibrary.org/obo/GENEPIO_0001064). If the proper descrptor is not listed please use text to describe the mode of travel. Multiple terms can be separated by one or more pipes" ;
  skos:example "train travel [GENEPIO:0001060]" ;
  schema:keywords "food" , "method" , "transport" ;
  rdfs:range xsd:string .

MIXS:0001138 a owl:DatatypeProperty ;
  rdfs:label "food shipping transportation vehicle" ;
  rdfs:comment "A descriptor for the mobile machine which is used to transport food commodities along the food distribution system.  This field accepts terms listed under vehicle (http://purl.obolibrary.org/obo/ENVO_01000604). If the proper descrptor is not listed please use text to describe the mode of travel. Multiple terms can be separated by one or more pipes" ;
  skos:example "aircraft [ENVO:01001488]|car [ENVO:01000605]" ;
  schema:keywords "food" , "transport" ;
  MIXS:Expected_value "ENVO:01000604" ;
  rdfs:range xsd:string .

MIXS:0001140 a owl:DatatypeProperty ;
  rdfs:label "food treatment process" ;
  rdfs:comment "Used to specifically characterize a food product based on the treatment or processes applied to the product or any indexed ingredient. The processes include adding, substituting or removing components or modifying the food or component, e.g., through fermentation. Multiple values can be assigned. This fields accepts terms listed under food treatment process (http://purl.obolibrary.org/obo/FOODON_03460111)" ;
  skos:example "gluten removal process [FOODON:03460750]" ;
  schema:keywords "food" , "process" , "treatment" ;
  MIXS:Expected_value "FOODON:03460111" ;
  rdfs:range xsd:string .

MIXS:0000226 a owl:ObjectProperty ;
  rdfs:label "frequency of cleaning" ;
  rdfs:comment "The number of times the sample location is cleaned. Frequency of cleaning might be on a Daily basis, Weekly, Monthly, Quarterly or Annually" ;
  skos:example "Daily" ;
  schema:keywords "frequency" ;
  rdfs:range MIXS:FreqCleanEnum ;
  a owl:FunctionalProperty .

MIXS:0000227 a owl:DatatypeProperty ;
  rdfs:label "frequency of cooking" ;
  rdfs:comment "The number of times a meal is cooked per week" ;
  schema:keywords "frequency" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000557 a owl:DatatypeProperty ;
  rdfs:label "fungicide regimen" ;
  rdfs:comment "Information about treatment involving use of fungicides; should include the name of fungicide, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple fungicide regimens" ;
  skos:example "bifonazole;1 mole per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0000807 a owl:ObjectProperty ;
  rdfs:label "furniture" ;
  rdfs:comment "The types of furniture present in the sampled room" ;
  skos:example "chair" ;
  rdfs:range MIXS:FurnitureEnum ;
  a owl:FunctionalProperty .

MIXS:0000558 a owl:DatatypeProperty ;
  rdfs:label "gaseous environment" ;
  rdfs:comment "Use of conditions with differing gaseous environments; should include the name of gaseous compound, amount administered, treatment duration, interval and total experimental duration; can include multiple gaseous environment regimens" ;
  skos:example "nitric oxide;0.5 micromole per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "environment" ;
  MIXS:Preferred_unit "micromole per liter" ;
  rdfs:range xsd:string .

MIXS:0000661 a owl:DatatypeProperty ;
  rdfs:label "gaseous substances" ;
  rdfs:comment "Amount or concentration of substances such as hydrogen sulfide, carbon dioxide, methane, etc.; can include multiple substances" ;
  MIXS:Expected_value "gaseous substance name;measurement value" ;
  MIXS:Preferred_unit "micromole per liter" ;
  rdfs:range xsd:string .

MIXS:0000280 a owl:DatatypeProperty ;
  rdfs:label "gastrointestinal tract disorder" ;
  rdfs:comment "History of gastrointestinal tract disorders; can include multiple disorders. History of blood disorders; can include multiple disorders.  The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, gastrointestinal system disease (https://disease-ontology.org/?id=DOID:77)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000808 a owl:ObjectProperty ;
  rdfs:label "gender of restroom" ;
  rdfs:comment "The gender type of the restroom" ;
  skos:example "male" ;
  rdfs:range MIXS:GenderRestroomEnum ;
  a owl:FunctionalProperty .

MIXS:0000859 a owl:DatatypeProperty ;
  rdfs:label "genetic modification" ;
  rdfs:comment "Genetic modifications of the genome of an organism, which may occur naturally by spontaneous mutation, or be introduced by some experimental means, e.g. specification of a transgene or the gene knocked-out or details of transient transfection" ;
  skos:example "PMID:19497774" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000010 a owl:DatatypeProperty ;
  rdfs:label "geographic location (country and/or sea,region)" ;
  rdfs:comment "The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ)" ;
  skos:example "USA: Maryland, Bethesda" ;
  schema:keywords "geographic" , "location" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001374 a owl:ObjectProperty ;
  rdfs:label "geological epoch" ;
  rdfs:comment "The geological epoch approximating to the period within which the specimen or sample existed. Where possible use terms from ontologies. NOTE: This term is for geological timescales. For more precise or anthropogenic defined periods, use `Cultural Era`." ;
  skos:example "Pleistocene" , "Upper Cretaceous" , "Pliocene" ;
  schema:keywords "ancient" , "age" ;
  MIXS:Expected_value "ontology term; text" ;
  rdfs:range MIXS:GeolEpochEnum ;
  a owl:FunctionalProperty .

MIXS:0000272 a owl:DatatypeProperty ;
  rdfs:label "amniotic fluid/gestation state" ;
  rdfs:comment "Specification of the gestation state" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000137 a owl:DatatypeProperty ;
  rdfs:label "glucosidase activity" ;
  rdfs:comment "Measurement of glucosidase activity" ;
  skos:example "5 mol per liter per hour" ;
  MIXS:Preferred_unit "mol per liter per hour" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001343 a owl:DatatypeProperty ;
  rdfs:label "density of gradient position" ;
  rdfs:comment "Buoyant density of this fraction" ;
  skos:example "1.725 g/mL" , "1.725-1.735 g/mL" ;
  MIXS:Preferred_unit "g/mL" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001344 a owl:DatatypeProperty ;
  rdfs:label "relative amount of nucleic acids in the gradient position" ;
  rdfs:comment "The total nucleic acids loaded onto the column in this fraction as a decimal. If uploading 16S rRNA gene (or other amplicon) sequencing data, this value should be calculated from qPCR data. If uploading untargetted sequencing data, this value should be calculated from total DNA concentration." ;
  skos:example "0.10" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0001342 a owl:DatatypeProperty ;
  rdfs:label "gradient position" ;
  rdfs:comment "A number designating the gradient position from heaviest (=1) to lightest. Unfractionated samples, from which fractionated samples were derived, should be denoted with –1." ;
  skos:example "1" , "-1" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000875 a owl:DatatypeProperty ;
  rdfs:label "gravidity" ;
  rdfs:comment "Whether or not subject is gravid, and if yes date due or date post-conception, specifying which is used" ;
  skos:example "yes;due date:2018-05-11" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000559 a owl:DatatypeProperty ;
  rdfs:label "gravity" ;
  rdfs:comment "Information about treatment involving use of gravity factor to study various types of responses in presence, absence or modified levels of gravity; treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple treatments" ;
  skos:example "12 g;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  MIXS:Expected_value "gravity factor value;treatment interval and duration" ;
  MIXS:Preferred_unit "meter per square second, g" ;
  rdfs:range xsd:string .

MIXS:0001043 a owl:DatatypeProperty ;
  rdfs:label "growth facility" ;
  rdfs:comment "Type of facility where the sampled plant was grown; controlled vocabulary: growth chamber, open top chamber, glasshouse, experimental garden, field. Alternatively use Crop Ontology (CO) terms, see http://www.cropontology.org/ontology/CO_715/Crop%20Research" ;
  skos:example "Growth chamber [CO_715:0000189]" ;
  schema:keywords "facility" , "growth" ;
  MIXS:Expected_value "free text or CO" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001044 a owl:ObjectProperty ;
  rdfs:label "growth habit" ;
  rdfs:comment "Characteristic shape, appearance or growth form of a plant species" ;
  skos:example "spreading" ;
  schema:keywords "growth" ;
  rdfs:range MIXS:GrowthHabitEnum ;
  a owl:FunctionalProperty .

MIXS:0000560 a owl:DatatypeProperty ;
  rdfs:label "growth hormone regimen" ;
  rdfs:comment "Information about treatment involving use of growth hormones; should include the name of growth hormone, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple growth hormone regimens" ;
  skos:example "abscisic acid;0.5 milligram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "growth" , "regimen" ;
  MIXS:Expected_value "growth hormone name;growth hormone amount;treatment interval and duration" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0001108 a owl:DatatypeProperty ;
  rdfs:label "growth medium" ;
  rdfs:comment "A liquid or gel containing nutrients, salts, and other factors formulated to support the growth of microorganisms, cells, or plants (National Cancer Institute Thesaurus).  The name of the medium used to grow the microorganism" ;
  skos:example "LB broth" ;
  schema:keywords "growth" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000288 a owl:DatatypeProperty ;
  rdfs:label "gynecological disorder" ;
  rdfs:comment "History of gynecological disorders; can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, female reproductive system disease (https://disease-ontology.org/?id=DOID:229)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000228 a owl:DatatypeProperty ;
  rdfs:label "hallway/corridor count" ;
  rdfs:comment "The total count of hallways and corridors in the built structure" ;
  schema:keywords "corridor" , "count" , "hallway" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000809 a owl:ObjectProperty ;
  rdfs:label "handidness" ;
  rdfs:comment "The handidness of the individual sampled" ;
  skos:example "right handedness" ;
  rdfs:range MIXS:HandidnessEnum ;
  a owl:FunctionalProperty .

MIXS:0000989 a owl:ObjectProperty ;
  rdfs:label "hydrocarbon type produced" ;
  rdfs:comment "Main hydrocarbon type produced from resource (i.e. Oil, gas, condensate, etc). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Gas" ;
  schema:keywords "hydrocarbon" , "type" ;
  rdfs:range MIXS:HcProducedEnum ;
  a owl:FunctionalProperty .

MIXS:0000988 a owl:ObjectProperty ;
  rdfs:label "hydrocarbon resource type" ;
  rdfs:comment "Main Hydrocarbon Resource type. The term \"Hydrocarbon Resource\" HCR defined as a natural environmental feature containing large amounts of hydrocarbons at high concentrations potentially suitable for commercial exploitation. This term should not be confused with the Hydrocarbon Occurrence term which also includes hydrocarbon-rich environments with currently limited commercial interest such as seeps, outcrops, gas hydrates etc. If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Oil Sand" ;
  schema:keywords "hydrocarbon" , "resource" , "type" ;
  rdfs:range MIXS:HcrEnum ;
  a owl:FunctionalProperty .

MIXS:0000406 a owl:DatatypeProperty ;
  rdfs:label "formation water salinity" ;
  rdfs:comment "Original formation water salinity (prior to secondary recovery e.g. Waterflooding) expressed as TDS" ;
  schema:keywords "salinity" , "water" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000993 a owl:ObjectProperty ;
  rdfs:label "hydrocarbon resource geological age" ;
  rdfs:comment "Geological age of hydrocarbon resource (Additional info: https://en.wikipedia.org/wiki/Period_(geology)). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Silurian" ;
  schema:keywords "age" , "hydrocarbon" , "resource" ;
  rdfs:range MIXS:GeolAgeEnum ;
  a owl:FunctionalProperty .

MIXS:0000395 a owl:DatatypeProperty ;
  rdfs:label "hydrocarbon resource original pressure" ;
  rdfs:comment "Original pressure of the hydrocarbon resource" ;
  schema:keywords "hydrocarbon" , "pressure" , "resource" ;
  MIXS:Preferred_unit "atmosphere, kilopascal" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000393 a owl:DatatypeProperty ;
  rdfs:label "hydrocarbon resource original temperature" ;
  rdfs:comment "Original temperature of the hydrocarbon resource" ;
  skos:example "150-295 degree Celsius" ;
  schema:keywords "hydrocarbon" , "resource" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000766 a owl:ObjectProperty ;
  rdfs:label "heating and cooling system type" ;
  rdfs:comment "Methods of conditioning or heating a room or building" ;
  skos:example "heat pump" ;
  schema:keywords "type" ;
  rdfs:range MIXS:HeatCoolTypeEnum .

MIXS:0000810 a owl:ObjectProperty ;
  rdfs:label "heating delivery locations" ;
  rdfs:comment "The location of heat delivery within the room" ;
  skos:example "north" ;
  schema:keywords "delivery" , "location" , "locations" ;
  rdfs:range MIXS:CompassDirections8Enum ;
  a owl:FunctionalProperty .

MIXS:0000812 a owl:ObjectProperty ;
  rdfs:label "heating system delivery method" ;
  rdfs:comment "The method by which the heat is delivered through the system" ;
  skos:example "radiant" ;
  schema:keywords "delivery" , "method" ;
  rdfs:range MIXS:HeatSysDelivMethEnum ;
  a owl:FunctionalProperty .

MIXS:0000833 a owl:DatatypeProperty ;
  rdfs:label "heating system identifier" ;
  rdfs:comment "The heating system identifier" ;
  schema:keywords "identifier" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000652 a owl:DatatypeProperty ;
  rdfs:label "extreme_unusual_properties/heavy metals" ;
  rdfs:comment "Heavy metals present in the sequenced sample and their concentrations. For multiple heavy metals and concentrations, add multiple copies of this field" ;
  skos:example "mercury;0.09 micrograms per gram" ;
  schema:keywords "extreme" , "properties" , "unusual" ;
  MIXS:Expected_value "heavy metal name;measurement value unit" ;
  MIXS:Preferred_unit "microgram per gram" ;
  rdfs:range xsd:string .

MIXS:0000343 a owl:DatatypeProperty ;
  rdfs:label "extreme_unusual_properties/heavy metals method" ;
  rdfs:comment "Reference or method used in determining heavy metals" ;
  schema:keywords "extreme" , "method" , "properties" , "unusual" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000167 a owl:DatatypeProperty ;
  rdfs:label "height carpet fiber mat" ;
  rdfs:comment "The average carpet fiber height in the indoor environment" ;
  schema:keywords "height" ;
  MIXS:Preferred_unit "centimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000561 a owl:DatatypeProperty ;
  rdfs:label "herbicide regimen" ;
  rdfs:comment "Information about treatment involving use of herbicides; information about treatment involving use of growth hormones; should include the name of herbicide, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens" ;
  skos:example "atrazine;10 milligram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0000321 a owl:DatatypeProperty ;
  rdfs:label "horizon method" ;
  rdfs:comment "Reference or method used in determining the horizon" ;
  schema:keywords "horizon" , "method" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000255 a owl:DatatypeProperty ;
  rdfs:label "host age" ;
  rdfs:comment "Age of host at the time of sampling; relevant scale depends on species and study, e.g. Could be seconds for amoebae or centuries for trees" ;
  schema:keywords "age" , "host" , "host." ;
  MIXS:Preferred_unit "year, day, hour" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:host_associated_data a owl:ObjectProperty ;
  rdfs:label "HostAssociated data" ;
  rdfs:comment "Data that comply with Extension HostAssociated" ;
  rdfs:range MIXS:0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000866 a owl:DatatypeProperty ;
  rdfs:label "host body habitat" ;
  rdfs:comment "Original body habitat where the sample was obtained from" ;
  schema:keywords "body" , "habitat" , "host" , "host." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000317 a owl:DatatypeProperty ;
  rdfs:label "host body-mass index" ;
  rdfs:comment "Body mass index, calculated as weight/(height)squared" ;
  skos:example "22 kilogram per square meter" ;
  schema:keywords "host" , "host." ;
  MIXS:Preferred_unit "kilogram per square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000888 a owl:DatatypeProperty ;
  rdfs:label "host body product" ;
  rdfs:comment "Substance produced by the body, e.g. Stool, mucus, where the sample was obtained from. Use terms from the foundational model of anatomy ontology (fma) or Uber-anatomy ontology (UBERON)" ;
  skos:example "mucus [FMA:66938]" ;
  schema:keywords "body" , "host" , "host." , "product" ;
  MIXS:Expected_value "FMA or UBERON" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000867 a owl:DatatypeProperty ;
  rdfs:label "host body site" ;
  rdfs:comment "Name of body site where the sample was obtained from, such as a specific organ or tissue (tongue, lung etc...). Use terms from the foundational model of anatomy ontology (fma) or the Uber-anatomy ontology (UBERON)" ;
  schema:keywords "body" , "host" , "site" ;
  MIXS:Expected_value "FMA or UBERON" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000274 a owl:DatatypeProperty ;
  rdfs:label "host body temperature" ;
  rdfs:comment "Core body temperature of the host when sample was collected" ;
  schema:keywords "body" , "host" , "host." , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001313 a owl:ObjectProperty ;
  rdfs:label "host cellular location" ;
  rdfs:comment "The localization of the symbiotic host organism within the host from which it was sampled: e.g. intracellular if the symbiotic host organism is localized within the cells or extracellular if the symbiotic host organism is localized outside of cells" ;
  skos:example "extracellular" ;
  schema:keywords "host" , "host." , "location" ;
  rdfs:range MIXS:HostCellularLocEnum ;
  a owl:FunctionalProperty .

MIXS:0000260 a owl:DatatypeProperty ;
  rdfs:label "host color" ;
  rdfs:comment "The color of host" ;
  schema:keywords "host" , "host." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000248 a owl:DatatypeProperty ;
  rdfs:label "host common name" ;
  rdfs:comment "Common name of the host" ;
  schema:keywords "host" , "host." ;
  MIXS:Preferred_unit "" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001315 a owl:ObjectProperty ;
  rdfs:label "host dependence" ;
  rdfs:comment "Type of host dependence for the symbiotic host organism to its host" ;
  skos:example "obligate" ;
  schema:keywords "host" , "host." ;
  rdfs:range MIXS:HostDependenceEnum ;
  a owl:FunctionalProperty .

MIXS:0000869 a owl:DatatypeProperty ;
  rdfs:label "host diet" ;
  rdfs:comment "Type of diet depending on the host, for animals omnivore, herbivore etc., for humans high-fat, meditteranean etc.; can include multiple diet types" ;
  schema:keywords "diet" , "host" , "host." ;
  rdfs:range xsd:string .

MIXS:0000031 a owl:DatatypeProperty ;
  rdfs:label "host disease status" ;
  rdfs:comment "List of diseases with which the host has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text" ;
  schema:keywords "disease" , "host" , "host." , "status" ;
  MIXS:Expected_value "disease name or Disease Ontology term" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000257 a owl:DatatypeProperty ;
  rdfs:label "host dry mass" ;
  rdfs:comment "Measurement of dry mass" ;
  skos:example "500 gram" ;
  schema:keywords "dry" , "host" , "host." , "mass" ;
  MIXS:Preferred_unit "kilogram, gram" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000872 a owl:DatatypeProperty ;
  rdfs:label "host family relationship" ;
  rdfs:comment "Relationships to other hosts in the same study; can include multiple relationships" ;
  schema:keywords "family" , "host" , "host." , "relationship" ;
  MIXS:Expected_value "relationship type;arbitrary identifier" ;
  rdfs:range xsd:string .

MIXS:0000365 a owl:DatatypeProperty ;
  rdfs:label "host genotype" ;
  rdfs:comment "Observed genotype" ;
  schema:keywords "host" , "host." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000871 a owl:DatatypeProperty ;
  rdfs:label "host growth conditions" ;
  rdfs:comment "Literature reference giving growth conditions of the host" ;
  skos:example "https://academic.oup.com/icesjms/article/68/2/349/617247" ;
  schema:keywords "condition" , "growth" , "host" , "host." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000264 a owl:DatatypeProperty ;
  rdfs:label "host height" ;
  rdfs:comment "The height of subject" ;
  schema:keywords "height" , "host" , "host." ;
  MIXS:Preferred_unit "centimeter, millimeter, meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000265 a owl:DatatypeProperty ;
  rdfs:label "host HIV status" ;
  rdfs:comment "HIV status of subject, if yes HAART initiation status should also be indicated as [YES or NO]" ;
  skos:example "yes;yes" ;
  schema:keywords "host" , "host." , "status" ;
  MIXS:Expected_value "HIV status;HAART initiation status" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000253 a owl:DatatypeProperty ;
  rdfs:label "host infra-specific name" ;
  rdfs:comment "Taxonomic information about the host below subspecies level" ;
  schema:keywords "host" , "host." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000254 a owl:DatatypeProperty ;
  rdfs:label "host infra-specific rank" ;
  rdfs:comment "Taxonomic rank information about the host below subspecies level, such as variety, form, rank etc" ;
  schema:keywords "host" , "host." , "rank" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000870 a owl:DatatypeProperty ;
  rdfs:label "host last meal" ;
  rdfs:comment "Content of last meal and time since feeding; can include multiple values" ;
  schema:keywords "host" , "host." ;
  MIXS:Expected_value "content;duration" ;
  rdfs:range xsd:string .

MIXS:0000256 a owl:DatatypeProperty ;
  rdfs:label "host length" ;
  rdfs:comment "The length of subject" ;
  skos:example "1 meter" ;
  schema:keywords "host" , "host." , "length" ;
  MIXS:Preferred_unit "centimeter, millimeter, meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000251 a owl:DatatypeProperty ;
  rdfs:label "host life stage" ;
  rdfs:comment "Description of life stage of host" ;
  schema:keywords "host" , "host." , "life" ;
  MIXS:Expected_value "stage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001305 a owl:DatatypeProperty ;
  rdfs:label "host number individual" ;
  rdfs:comment "Number of symbiotic host individuals pooled at the time of collection" ;
  skos:example "3" ;
  schema:keywords "host" , "host." , "number" ;
  MIXS:Expected_value "count" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000896 a owl:DatatypeProperty ;
  rdfs:label "host occupation" ;
  rdfs:comment "Most frequent job performed by subject" ;
  skos:note "Couldn't convert host_occupation with value veterinary to integer" , "almost all host_occupation values in the NCBI biosample_set are strings, not integers" ;
  skos:example "veterinary" ;
  schema:keywords "host" , "host." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001310 a owl:DatatypeProperty ;
  rdfs:label "observed coinfecting organisms in host of host" ;
  rdfs:comment "The taxonomic name of any coinfecting organism observed in a symbiotic relationship with the host of the sampled host organism. e.g. where a sample collected from a host trematode species (A) which was collected from a host_of_host fish (B) that was also infected with a nematode (C), the value here would be (C) the nematode {species name} or {common name}. Multiple co-infecting species may be added in a comma-separated list. For listing symbiotic organisms associated with the host (A) use the term Observed host symbiont" ;
  skos:example "Maritrema novaezealandense" ;
  schema:keywords "host" , "host." , "observed" , "organism" ;
  MIXS:Expected_value "species name of coinfecting organism(s)" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001319 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host disease status" ;
  rdfs:comment "List of diseases with which the host of the symbiotic host organism has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text" ;
  skos:example "rabies [DOID:11260]" ;
  schema:keywords "disease" , "host" , "host." , "status" , "symbiosis" ;
  MIXS:Expected_value "disease name or Disease Ontology term" ;
  rdfs:range xsd:string .

MIXS:0001325 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host local environmental context" ;
  rdfs:comment "For a symbiotic host organism the local anatomical environment within its host may have causal influences. Report the anatomical entity(s) which are in the direct environment of the symbiotic host organism being sampled and which you believe have significant causal influences on your sample or specimen. For example, if the symbiotic host organism being sampled is an intestinal worm, its local environmental context will be the term for intestine from UBERON (http://uberon.github.io/)" ;
  skos:example "small intestine[uberon:0002108]" ;
  schema:keywords "context" , "environmental" , "host" , "host." , "symbiosis" ;
  MIXS:Expected_value "UBERON term(s), multiple values can be separated by pipes" ;
  rdfs:range xsd:string .

MIXS:0001326 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host environmental medium" ;
  rdfs:comment "Report the environmental material(s) immediately surrounding the symbiotic host organism at the time of sampling. This usually will be a tissue or substance type from the host, but may be another material if the symbiont is external to the host. We recommend using classes from the UBERON ontology, but subclasses of 'environmental material' (http://purl.obolibrary.org/obo/ENVO_00010483) may also be used. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. intestines, heart).MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. intestines, heart)" ;
  skos:example "feces[uberon:0001988]" ;
  schema:keywords "environmental" , "host" , "host." , "symbiosis" ;
  MIXS:Expected_value "An ontology term for a material such as a tissue type or excreted substance" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001328 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host family relationship" ;
  rdfs:comment "Familial relationship of the host of the symbiotic host organisms to other hosts of symbiotic host organism in the same study; can include multiple relationships" ;
  schema:keywords "family" , "host" , "host." , "relationship" , "symbiosis" ;
  MIXS:Expected_value "relationship type;arbitrary identifier" ;
  rdfs:range xsd:string .

MIXS:0001331 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host genotype" ;
  rdfs:comment "Observed genotype of the host of the symbiotic host organism" ;
  schema:keywords "host" , "host." , "symbiosis" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001333 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host gravidity" ;
  rdfs:comment "Whether or not the host of the symbiotic host organism is gravid, and if yes date due or date post-conception, specifying which is used" ;
  schema:keywords "host" , "host." , "symbiosis" ;
  MIXS:Expected_value "gravidity status;timestamp" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001329 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host infra-specific name" ;
  rdfs:comment "Taxonomic name information of the host of the symbiotic host organism below subspecies level" ;
  schema:keywords "host" , "host." , "symbiosis" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001330 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host infra-specific rank" ;
  rdfs:comment "Taxonomic rank information about the host of the symbiotic host organism below subspecies level, such as variety, form, rank etc" ;
  schema:keywords "host" , "host." , "rank" , "symbiosis" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001324 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host common name" ;
  rdfs:comment "Common name of the host of the symbiotic host organism" ;
  skos:example "snail" ;
  schema:keywords "host" , "host." , "symbiosis" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001332 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host phenotype" ;
  rdfs:comment "Phenotype of the host of the symbiotic host organism. For phenotypic quality ontology (PATO) terms, see http://purl.bioontology.org/ontology/pato" ;
  schema:keywords "host" , "host." , "symbiosis" ;
  MIXS:Expected_value "phenotype of the host of the symbiotic organism; PATO" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001327 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host subject id" ;
  rdfs:comment "A unique identifier by which each host of the symbiotic host organism subject can be referred to, de-identified, e.g. #H14" ;
  skos:example "H3" ;
  schema:keywords "host" , "host." , "identifier" , "symbiosis" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001306 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host taxon id" ;
  rdfs:comment "NCBI taxon id of the host of the symbiotic host organism" ;
  skos:example "145637" ;
  schema:keywords "host" , "host." , "identifier" , "symbiosis" , "taxon" ;
  MIXS:Expected_value "NCBI taxon identifier of the host of the symbiotic taxon organism" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001334 a owl:DatatypeProperty ;
  rdfs:label "host of the symbiotic host total mass" ;
  rdfs:comment "Total mass of the host of the symbiotic host organism at collection, the unit depends on the host" ;
  schema:keywords "host" , "host." , "mass" , "symbiosis" , "total" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000874 a owl:DatatypeProperty ;
  rdfs:label "host phenotype" ;
  rdfs:comment "Phenotype of human or other host. Use terms from the phenotypic quality ontology (pato) or the Human Phenotype Ontology (HP)" ;
  schema:keywords "host" , "host." ;
  MIXS:Expected_value "PATO or HP" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000088 a owl:ObjectProperty ;
  rdfs:label "host prediction approach" ;
  rdfs:comment "Tool or approach used for host prediction" ;
  skos:example "CRISPR spacer match" ;
  schema:keywords "host" , "host." , "predict" ;
  rdfs:range MIXS:HostPredApprEnum ;
  a owl:FunctionalProperty .

MIXS:0000089 a owl:DatatypeProperty ;
  rdfs:label "host prediction estimated accuracy" ;
  rdfs:comment "For each tool or approach used for host prediction, estimated false discovery rates should be included, either computed de novo or from the literature" ;
  skos:example "CRISPR spacer match: 0 or 1 mismatches, estimated 8% FDR at the host genus rank (Edwards et al. 2016 doi:10.1093/femsre/fuv048)" ;
  schema:keywords "host" , "host." , "predict" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001371 a owl:DatatypeProperty ;
  rdfs:label "preservation state of sampled host at death" ;
  rdfs:comment "Description of the state of the sampled (ancient) organism/host as originally  preserved in the burial environment at the time of or immediately following death. This can be both natural or artificial, such as mummification or burning for funerary purposes." ;
  skos:example "complete artificial mummification." , "natural partial mummification." , "fully skeletonised." ;
  schema:keywords "ancient" ;
  MIXS:Expected_value "Description of the preservation of the sampled (ancient) organism/host at time/immediately after death." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000333 a owl:DatatypeProperty ;
  rdfs:label "host pulse" ;
  rdfs:comment "Resting pulse, measured as beats per minute" ;
  skos:example "65 beats per minute" ;
  schema:keywords "host" , "host." ;
  MIXS:Preferred_unit "beats per minute" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000811 a owl:DatatypeProperty ;
  rdfs:label "host sex" ;
  rdfs:comment "Gender or physical sex of the host" ;
  skos:note "example of non-binary from Excel sheets does not match any of the enumerated values" ;
  schema:keywords "host" , "host." ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000261 a owl:DatatypeProperty ;
  rdfs:label "host shape" ;
  rdfs:comment "Morphological shape of host" ;
  skos:example "round" ;
  schema:keywords "host" , "host." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000030 a owl:DatatypeProperty ;
  rdfs:label "host specificity or range" ;
  rdfs:comment "The range and diversity of host species that an organism is capable of infecting, defined by NCBI taxonomy identifier" ;
  skos:example "9606" ;
  schema:keywords "host" , "host." , "range" ;
  MIXS:Expected_value "NCBI taxid" ;
  rdfs:range xsd:string .

MIXS:0001308 a owl:ObjectProperty ;
  rdfs:label "host specificity" ;
  rdfs:comment "Level of specificity of symbiont-host interaction: e.g. generalist (symbiont able to establish associations with distantly related hosts) or species-specific" ;
  skos:example "species-specific" ;
  schema:keywords "host" , "host." ;
  rdfs:range MIXS:HostSpecificityEnum ;
  a owl:FunctionalProperty .

MIXS:0000861 a owl:DatatypeProperty ;
  rdfs:label "host subject id" ;
  rdfs:comment "A unique identifier by which each subject can be referred to, de-identified" ;
  schema:keywords "host" , "host." , "identifier" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001318 a owl:DatatypeProperty ;
  rdfs:label "host subspecific genetic lineage" ;
  rdfs:comment "Information about the genetic distinctness of the host organism below the subspecies level e.g., serovar, serotype, biotype, ecotype, variety, cultivar, or any relevant genetic typing schemes like Group I plasmid. Subspecies should not be recorded in this term, but in the NCBI taxonomy. Supply both the lineage name and the lineage rank separated by a colon, e.g., biovar:abc123" ;
  skos:example "serovar:Newport, variety:glabrum, cultivar: Red Delicious" ;
  schema:keywords "host" , "host." , "lineage" ;
  MIXS:Expected_value "Genetic lineage below lowest rank of NCBI taxonomy, which is subspecies, e.g. serovar, biotype, ecotype, variety, cultivar" ;
  rdfs:range xsd:string .

MIXS:0000252 a owl:DatatypeProperty ;
  rdfs:label "host substrate" ;
  rdfs:comment "The growth substrate of the host" ;
  skos:example "rock" ;
  schema:keywords "host" , "host." ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001298 a owl:DatatypeProperty ;
  rdfs:label "observed host symbionts" ;
  rdfs:comment "The taxonomic name of the organism(s) found living in mutualistic, commensalistic, or parasitic symbiosis with the specific host. The sampled symbiont can have its own symbionts. For example, parasites may have hyperparasites (=parasites of the parasite)" ;
  schema:keywords "host" , "host." , "observed" , "symbiosis" ;
  MIXS:Expected_value "species name or common name" ;
  rdfs:range xsd:string .

MIXS:0000250 a owl:DatatypeProperty ;
  rdfs:label "host taxid" ;
  rdfs:comment "NCBI taxon id of the host, e.g. 9606" ;
  schema:keywords "host" , "host." , "taxon" ;
  MIXS:Expected_value "NCBI taxon identifier" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000263 a owl:DatatypeProperty ;
  rdfs:label "host total mass" ;
  rdfs:comment "Total mass of the host at collection, the unit depends on host" ;
  schema:keywords "host" , "host." , "mass" , "total" ;
  MIXS:Preferred_unit "kilogram, gram" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000567 a owl:DatatypeProperty ;
  rdfs:label "host wet mass" ;
  rdfs:comment "Measurement of wet mass" ;
  skos:example "1500 gram" ;
  schema:keywords "host" , "host." , "mass" , "wet" ;
  MIXS:Preferred_unit "kilogram, gram" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000969 a owl:DatatypeProperty ;
  rdfs:label "HRT" ;
  rdfs:comment "Whether subject had hormone replacement theraphy, and if yes start date" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:human_associated_data a owl:ObjectProperty ;
  rdfs:label "HumanAssociated data" ;
  rdfs:comment "Data that comply with Extension HumanAssociated" ;
  rdfs:range MIXS:0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:human_gut_data a owl:ObjectProperty ;
  rdfs:label "HumanGut data" ;
  rdfs:comment "Data that comply with Extension HumanGut" ;
  rdfs:range MIXS:0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:human_oral_data a owl:ObjectProperty ;
  rdfs:label "HumanOral data" ;
  rdfs:comment "Data that comply with Extension HumanOral" ;
  rdfs:range MIXS:0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:human_skin_data a owl:ObjectProperty ;
  rdfs:label "HumanSkin data" ;
  rdfs:comment "Data that comply with Extension HumanSkin" ;
  rdfs:range MIXS:0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "HumanVaginal data" ;
  rdfs:comment "Data that comply with Extension HumanVaginal" ;
  rdfs:range MIXS:0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000100 a owl:DatatypeProperty ;
  rdfs:label "humidity" ;
  rdfs:comment "Amount of water vapour in the air, at the time of sampling" ;
  schema:keywords "humidity" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000568 a owl:DatatypeProperty ;
  rdfs:label "humidity regimen" ;
  rdfs:comment "Information about treatment involving an exposure to varying degree of humidity; information about treatment involving use of growth hormones; should include amount of humidity administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens" ;
  skos:example "25 gram per cubic meter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "humidity" , "regimen" ;
  MIXS:Expected_value "humidity value;treatment interval and duration" ;
  MIXS:Preferred_unit "gram per cubic meter" ;
  rdfs:range xsd:string .

MIXS:hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "HydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with Extension HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "HydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with Extension HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001253 a owl:DatatypeProperty ;
  rdfs:label "hygienic food production area" ;
  rdfs:comment "The subdivision of areas within a food production facility according to hygienic requirements. This field accepts terms listed under hygienic food production area (http://purl.obolibrary.org/obo/ENVO). Please add a term that most accurately indicates the hygienic area your sample was taken from according to the definitions provided" ;
  skos:example "Low Hygiene Area" ;
  schema:keywords "area" , "food" , "production" ;
  MIXS:Expected_value "Expected value" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000287 a owl:DatatypeProperty ;
  rdfs:label "hysterectomy" ;
  rdfs:comment "Specification of whether hysterectomy was performed" ;
  skos:example "no" ;
  rdfs:range xsd:boolean ;
  a owl:FunctionalProperty .

MIXS:0000884 a owl:DatatypeProperty ;
  rdfs:label "IHMC medication code" ;
  rdfs:comment "Can include multiple medication codes" ;
  skos:example "810" ;
  schema:keywords "code" ;
  rdfs:range xsd:integer .

MIXS:0000763 a owl:ObjectProperty ;
  rdfs:label "indoor space" ;
  rdfs:comment "A distinguishable space within a structure, the purpose for which discrete areas of a building is used" ;
  skos:example "foyer" ;
  schema:keywords "indoor" ;
  rdfs:range MIXS:IndoorSpaceEnum ;
  a owl:FunctionalProperty .

MIXS:0000764 a owl:ObjectProperty ;
  rdfs:label "indoor surface" ;
  rdfs:comment "Type of indoor surface" ;
  skos:example "wall" ;
  schema:keywords "indoor" , "surface" ;
  rdfs:range MIXS:IndoorSurfEnum ;
  a owl:FunctionalProperty .

MIXS:0000662 a owl:DatatypeProperty ;
  rdfs:label "industrial effluent percent" ;
  rdfs:comment "Percentage of industrial effluents received by wastewater treatment plant" ;
  schema:keywords "percent" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000664 a owl:DatatypeProperty ;
  rdfs:label "inorganic particles" ;
  rdfs:comment "Concentration of particles such as sand, grit, metal particles, ceramics, etc.; can include multiple particles" ;
  schema:keywords "inorganic" , "particle" ;
  MIXS:Expected_value "inorganic particle name;measurement value" ;
  MIXS:Preferred_unit "mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0000168 a owl:DatatypeProperty ;
  rdfs:label "inside lux light" ;
  rdfs:comment "The recorded value at sampling time (power density)" ;
  schema:keywords "inside" , "light" ;
  MIXS:Preferred_unit "kilowatt per square metre" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000813 a owl:ObjectProperty ;
  rdfs:label "interior wall condition" ;
  rdfs:comment "The physical condition of the wall at the time of sampling; photos or video preferred; use drawings to indicate location of damaged areas" ;
  skos:example "damaged" ;
  schema:keywords "condition" , "interior" , "wall" ;
  rdfs:range MIXS:DamagedEnum ;
  a owl:FunctionalProperty .

MIXS:0001144 a owl:DatatypeProperty ;
  rdfs:label "intended consumer" ;
  rdfs:comment "Food consumer type, human or animal, for which the food product is produced and marketed. This field accepts terms listed under food consumer group (http://purl.obolibrary.org/obo/FOODON_03510136) or NCBI taxid" ;
  skos:example "9606 o rsenior as food consumer [FOODON:03510254]" ;
  schema:keywords "consumer" ;
  MIXS:Expected_value "FOODON_03510136 or NCBI taxid" ;
  rdfs:range xsd:string .

MIXS:0001351 a owl:DatatypeProperty ;
  rdfs:label "internal standard method" ;
  rdfs:comment "Method used for internal standard for SIP fractionation, if an internal standard was used (i.e., spiking in a heavy-labelled DNA sequence)." ;
  skos:example "https://doi.org/10.1101/2022.12.20.521340" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000003 a owl:DatatypeProperty ;
  rdfs:label "isolation and growth condition" ;
  rdfs:comment "Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material" ;
  skos:example "doi:10.1016/j.syapm.2018.01.009" ;
  schema:keywords "condition" , "growth" , "isolation" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001338 a owl:ObjectProperty ;
  rdfs:label "isotope" ;
  rdfs:comment "The element and mass number of the stable isotope used in isotopologue labeling." ;
  skos:example "13C" , "13C | 15N" ;
  rdfs:range MIXS:IsotopeEnum .

MIXS:0001339 a owl:DatatypeProperty ;
  rdfs:label "isotopolog" ;
  rdfs:comment "Isotopologue (isotope source/substrate/molecule) added to the biological sample." ;
  skos:note "List the PubChem Compound Identification (CID) number. If it's an undefined mixture, enter 0." ;
  skos:example "toluene [pubchem.compound:1140]" , "0" ;
  rdfs:range xsd:string .

MIXS:0001341 a owl:ObjectProperty ;
  rdfs:label "Labeling approach (number of labeled isotopologs supplied)" ;
  rdfs:comment "The labelling approach of this SIP experiment. Details if multiple isotopically labelled isotopologues were added to samples (\"multiple\"), or was only one isotopologue added to each sample (\"single\")." ;
  skos:example "single" , "multiple" ;
  rdfs:range MIXS:IsotopologApproachEnum ;
  a owl:FunctionalProperty .

MIXS:0001346 a owl:DatatypeProperty ;
  rdfs:label "atom fraction of isotopolog" ;
  rdfs:comment "The fraction of heavy-labelled atoms out of all atoms of a given element in the isotopolog. Multiple values allowed, separated by a | and should be orded the same as the isotopolog." ;
  skos:example "0.95" , "0.95 | 0.98" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001347 a owl:DatatypeProperty ;
  rdfs:label "set of labeled atoms in isotopologue" ;
  rdfs:comment "InChI label designating set of all isotopically enriched atoms in isotopologue. Multiple values allowed, separated by a | and should be orded the same as the isotopolog." ;
  skos:example "1S/C7H8/c1-7-5-3-2-4-6-7/h2-6H,1H3/i1+1,2+1,3+1,4+1,5+1,6+1,7+1" , "1S/C7H8/c1-7-5-3-2-4-6-7/h2-6H,1H3/i1+1,2+1,3+1,4+1,5+1,6+1,7+1 | 1S/C6H12O6/c7-1-3(9)5(11)6(12)4(10)2-8/h1,3-6,8-12H,2H2/t3-,4+,5+,6+/m0/s1" , "undefined" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001348 a owl:DatatypeProperty ;
  rdfs:label "dose of isotopolog" ;
  rdfs:comment "The concentration (in ppm) of isotopolog added to environmental matrix as a total mass per volume." ;
  skos:note "isotopolog mass / total volume soil; ppm of isotopologue in total container volume" ;
  skos:example "10 ppm" ;
  MIXS:Preferred_unit "ppm" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001350 a owl:DatatypeProperty ;
  rdfs:label "isotopolog incubation time" ;
  rdfs:comment "Total time of incubation after isotopologue addition in hours" ;
  skos:example "12 hour" ;
  MIXS:Preferred_unit "hours" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001340 a owl:ObjectProperty ;
  rdfs:label "isotopolog label status" ;
  rdfs:comment "List whether the isotopologue added to this biological sample was heavy-labelled or natural abundance" ;
  skos:example "natural abundance" , "isotopically labeled" ;
  rdfs:range MIXS:IsotopologLabelEnum ;
  a owl:FunctionalProperty .

MIXS:0001010 a owl:DatatypeProperty ;
  rdfs:label "injection water breakthrough date of specific well" ;
  rdfs:comment "Injection water breakthrough date per well following a secondary and/or tertiary recovery" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  schema:keywords "date" , "water" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000455 a owl:DatatypeProperty ;
  rdfs:label "injection water fraction" ;
  rdfs:comment "Proportion of the produced fluids derived from injected water at the time of sampling. (e.g. 87%)" ;
  skos:note "percent or float?" ;
  skos:example "0.79" ;
  schema:keywords "fraction" , "water" ;
  MIXS:Preferred_unit "percent" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000277 a owl:DatatypeProperty ;
  rdfs:label "urine/kidney disorder" ;
  rdfs:comment "History of kidney disorders; can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, kidney disease (https://disease-ontology.org/?id=DOID:557)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000814 a owl:DatatypeProperty ;
  rdfs:label "last time swept/mopped/vacuumed" ;
  rdfs:comment "The last time the floor was cleaned (swept, mopped, vacuumed)" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  schema:keywords "time" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000009 a owl:DatatypeProperty ;
  rdfs:label "geographic location (latitude and longitude)" ;
  rdfs:comment "The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees, limited to 8 decimal points, and in WGS84 system" ;
  skos:example "50.586825 6.408977" ;
  schema:keywords "geographic" , "location" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001377 a owl:DatatypeProperty ;
  rdfs:label "latest chronometric age" ;
  rdfs:comment "The minimum/latest/youngest possible age of a specimen as determined by a dating method. If multiple dating measurements available, use the most latest/youngest date to provide widest range of age possibilities. The specific age unit should be specified by the term latest_chrono_sys. More information on specific dates (e.g. radiocarbon lab codes) can be specified in the term chrono_age_remarks." ;
  skos:example "100000" , "1700" ;
  skos:broadMatch chrono:latestChronometricAge ;
  MIXS:Expected_value "age value corresponding to unit" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0001378 a owl:ObjectProperty ;
  rdfs:label "latest chronometric age reference system" ;
  rdfs:comment "The reference system associated with the latest_chrono_age." ;
  skos:example "cal BP" , "CE" , "Ma" , "ka" ;
  skos:broadMatch chrono:latestChronometricAgeReferenceSystem ;
  rdfs:range MIXS:ChronoAgeSysEnum ;
  a owl:FunctionalProperty .

MIXS:0001392 a owl:ObjectProperty ;
  rdfs:label "library generation technique" ;
  rdfs:comment "The technique used to generate the library, i.e., amplicon, enriched, or shotgun. An amplicon library is a library that has been amplified to target a single specific region of a genome (e.g. a specific gene). An enriched library is a library that has had a particular genome or multiple genomic regions/positions 'captured' or enriched typically via baits/probes. A shotgun library has undergone no type of targeted amplification/enrichment for a particular genomic region or genome, i.e., random sequencing of any nucleic acid molecule contained in a genomic library." ;
  skos:example "shotgun" , "amplicon" , "enriched" ;
  schema:keywords "library" , "preparation" ;
  rdfs:range MIXS:LibTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000041 a owl:ObjectProperty ;
  rdfs:label "library layout" ;
  rdfs:comment "Specify whether to expect single, paired, or other configuration of reads" ;
  skos:example "paired" ;
  schema:keywords "library" ;
  rdfs:range MIXS:LibLayoutEnum ;
  a owl:FunctionalProperty .

MIXS:0001388 a owl:DatatypeProperty ;
  rdfs:label "description of library multiplex identifiers or indexing configuration" ;
  rdfs:comment "Index/barcode/primer configuration used during library building for sequencing. This includes information such as the number, type and location of indexes, the index/primer kit/list, or if 'inline' barcodes or UMIs were ligated directly onto the template molecules." ;
  skos:example "dual index with single internal barcode." , "UDI index sequences." ;
  schema:keywords "library" , "preparation" ;
  MIXS:Expected_value "Description of the indexing configuration of the library" ;
  rdfs:range xsd:string .

MIXS:0001390 a owl:DatatypeProperty ;
  rdfs:label "library polymerase" ;
  rdfs:comment "The polymerase enzyme used for building nucleic acid libraries. Include formal identifier e.g. SKU or the manufacturers name at minimum." ;
  skos:example "Agilent PfuTurbo Cx HotStart" , "KAPA HiFi HotStart" , "AmpliTaq Gold DNA Polymerase" ;
  schema:keywords "polymerase" , "library" , "preparation" ;
  MIXS:Expected_value "name of polymerase used during library construction" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000040 a owl:DatatypeProperty ;
  rdfs:label "library reads sequenced" ;
  rdfs:comment "Total number of clones sequenced from the library" ;
  skos:example "20" ;
  schema:keywords "library" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000043 a owl:DatatypeProperty ;
  rdfs:label "library screening strategy" ;
  rdfs:comment "Specific enrichment or screening methods applied before and/or after creating libraries" ;
  skos:example "enriched, screened, normalized" ;
  schema:keywords "library" ;
  MIXS:Expected_value "screening strategy name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000039 a owl:DatatypeProperty ;
  rdfs:label "library size" ;
  rdfs:comment "Total number of clones in the library prepared for the project" ;
  skos:example "50" ;
  schema:keywords "library" , "size" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0001391 a owl:ObjectProperty ;
  rdfs:label "nucleic acid strandedness in library creation" ;
  rdfs:comment "The strandedness of the original template nucleic acid molecules used for constructing the sequencing library" ;
  skos:example "single" , "double" ;
  schema:keywords "library" , "preparation" ;
  MIXS:Expected_value "nucleic acid library strandedness" ;
  rdfs:range MIXS:LibStrandEnum .

MIXS:0000042 a owl:DatatypeProperty ;
  rdfs:label "library vector" ;
  rdfs:comment "Cloning vector type(s) used in construction of libraries" ;
  skos:example "Bacteriophage P1" ;
  schema:keywords "library" ;
  MIXS:Expected_value "vector" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001389 a owl:DatatypeProperty ;
  rdfs:label "library name" ;
  rdfs:comment "Any ID or name used for referring to a nucleic acid sequencing library associated with the sample." ;
  skos:example "JK1234" , "JFC001.A0101" , "A003-1-SG1" ;
  schema:keywords "sequencing" ;
  MIXS:Expected_value "name of sequencing library" ;
  rdfs:range xsd:string .

MIXS:0001145 a owl:DatatypeProperty ;
  rdfs:label "library preparation kit" ;
  rdfs:comment "Packaged kits (containing adapters, indexes, enzymes, buffers etc.), tailored for specific sequencing workflows, which allow the simplified preparation of sequencing-ready libraries for small genomes, amplicons, and plasmids" ;
  schema:keywords "kit" , "library" , "preparation" ;
  MIXS:Expected_value "name of library preparation kit" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000706 a owl:DatatypeProperty ;
  rdfs:label "light intensity" ;
  rdfs:comment "Measurement of light intensity" ;
  skos:example "0.3 lux" ;
  schema:keywords "intensity" , "light" ;
  MIXS:Preferred_unit "lux" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000569 a owl:DatatypeProperty ;
  rdfs:label "light regimen" ;
  rdfs:comment "Information about treatment(s) involving exposure to light, including both light intensity and quality" ;
  skos:example "incandescant light;10 lux;450 nanometer" ;
  schema:keywords "light" , "regimen" ;
  MIXS:Expected_value "exposure type;light intensity;light quality" ;
  MIXS:Preferred_unit "lux; micrometer, nanometer, angstrom" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000769 a owl:ObjectProperty ;
  rdfs:label "light type" ;
  rdfs:comment "Application of light to achieve some practical or aesthetic effect. Lighting includes the use of both artificial light sources such as lamps and light fixtures, as well as natural illumination by capturing daylight. Can also include absence of light" ;
  skos:example "desk lamp" ;
  schema:keywords "light" , "type" ;
  rdfs:range MIXS:LightTypeEnum .

MIXS:0000340 a owl:DatatypeProperty ;
  rdfs:label "links to additional analysis" ;
  rdfs:comment "Link to additional analysis results performed on the sample" ;
  schema:keywords "link" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000329 a owl:DatatypeProperty ;
  rdfs:label "link to classification information" ;
  rdfs:comment "Link to digitized soil maps or other soil classification information" ;
  schema:keywords "classification" , "information" , "link" ;
  MIXS:Expected_value "PMID,DOI or url" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000328 a owl:DatatypeProperty ;
  rdfs:label "link to climate information" ;
  rdfs:comment "Link to climate resource" ;
  schema:keywords "information" , "link" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000990 a owl:ObjectProperty ;
  rdfs:label "lithology" ;
  rdfs:comment "Hydrocarbon resource main lithology (Additional information: http://petrowiki.org/Lithology_and_rock_type_determination). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Volcanic" ;
  schema:keywords "lithology" ;
  rdfs:range MIXS:LithologyEnum ;
  a owl:FunctionalProperty .

MIXS:0000282 a owl:DatatypeProperty ;
  rdfs:label "liver disorder" ;
  rdfs:comment "History of liver disorders; can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, liver disease (https://disease-ontology.org/?id=DOID:409)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000330 a owl:DatatypeProperty ;
  rdfs:label "soil_taxonomic/local classification" ;
  rdfs:comment "Soil classification based on local soil classification system" ;
  schema:keywords "classification" ;
  MIXS:Expected_value "local classification name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000331 a owl:DatatypeProperty ;
  rdfs:label "soil_taxonomic/local classification method" ;
  rdfs:comment "Reference or method used in determining the local soil classification" ;
  schema:keywords "classification" , "method" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001147 a owl:DatatypeProperty ;
  rdfs:label "lot number" ;
  rdfs:comment "A distinctive alpha-numeric identification code assigned by the manufacturer or distributor to a specific quantity of manufactured material or product within a batch. Synonym: Batch Number.  The submitter should provide lot number of the item followed by the item name for which the lot number was provided" ;
  skos:example "1239ABC01A, split Cornish hens" ;
  schema:keywords "number" ;
  MIXS:Expected_value "lot number, item" ;
  rdfs:range xsd:string .

MIXS:0000080 a owl:ObjectProperty ;
  rdfs:label "MAG coverage software" ;
  rdfs:comment "Tool(s) used to determine the genome coverage if coverage is used as a binning parameter in the extraction of genomes from metagenomic datasets" ;
  skos:example "bbmap" ;
  schema:keywords "software" ;
  rdfs:range MIXS:MagCovSoftwareEnum ;
  a owl:FunctionalProperty .

MIXS:0000431 a owl:DatatypeProperty ;
  rdfs:label "magnesium" ;
  rdfs:comment "Concentration of magnesium in the sample" ;
  skos:example "52.8 micromole per kilogram" ;
  MIXS:Preferred_unit "mole per liter, milligram per liter, parts per million, micromole per kilogram" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001354 a owl:DatatypeProperty ;
  rdfs:label "taxonomic marker gene recovered" ;
  rdfs:comment "Recovery status of taxonomic marker genes from the assembled genome" ;
  skos:altLabel "x16s_recover" ;
  skos:example "true" ;
  rdfs:seeAlso MIXS:0000065 ;
  schema:keywords "recover" , "marker gene" , "taxonomy" ;
  rdfs:range xsd:boolean ;
  a owl:FunctionalProperty .

MIXS:0001355 a owl:DatatypeProperty ;
  rdfs:label "taxonomic marker gene recovery software" ;
  rdfs:comment "Tools used for taxonomic marker gene extraction from assembled genomes" ;
  skos:altLabel "x16s_recover_software" ;
  skos:example "rambl;v2;default parameters" , "barrnap;0.9;--kingdom bac" , "metaxa2;2.2;-t bacteria" ;
  rdfs:seeAlso MIXS:0000066 ;
  schema:keywords "recover" , "software" , "marker gene" , "taxonomy" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000273 a owl:DatatypeProperty ;
  rdfs:label "amniotic fluid/maternal health status" ;
  rdfs:comment "Specification of the maternal health status" ;
  schema:keywords "status" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000229 a owl:DatatypeProperty ;
  rdfs:label "maximum occupancy" ;
  rdfs:comment "The maximum amount of people allowed in the indoor environment" ;
  schema:keywords "maximum" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000498 a owl:DatatypeProperty ;
  rdfs:label "mean friction velocity" ;
  rdfs:comment "Measurement of mean friction velocity" ;
  skos:example "0.5 meter per second" ;
  schema:keywords "mean" , "velocity" ;
  MIXS:Preferred_unit "meter per second" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000502 a owl:DatatypeProperty ;
  rdfs:label "mean peak friction velocity" ;
  rdfs:comment "Measurement of mean peak friction velocity" ;
  skos:example "1 meter per second" ;
  schema:keywords "mean" , "peak" , "velocity" ;
  MIXS:Preferred_unit "meter per second" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000815 a owl:ObjectProperty ;
  rdfs:label "mechanical structure" ;
  rdfs:comment "mechanical structure: a moving structure" ;
  skos:example "elevator" ;
  rdfs:range MIXS:MechStrucEnum ;
  a owl:FunctionalProperty .

MIXS:0001052 a owl:DatatypeProperty ;
  rdfs:label "mechanical damage" ;
  rdfs:comment "Information about any mechanical damage exerted on the plant; can include multiple damages and sites" ;
  skos:example "pruning;bark" ;
  MIXS:Expected_value "damage type;body site" ;
  rdfs:range xsd:string .

MIXS:0000897 a owl:DatatypeProperty ;
  rdfs:label "medical history performed" ;
  rdfs:comment "Whether full medical history was collected" ;
  skos:example "1" ;
  schema:keywords "history" ;
  rdfs:range xsd:boolean ;
  a owl:FunctionalProperty .

MIXS:0000965 a owl:DatatypeProperty ;
  rdfs:label "menarche" ;
  rdfs:comment "Date of most recent menstruation" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000968 a owl:DatatypeProperty ;
  rdfs:label "menopause" ;
  rdfs:comment "Date of onset of menopause" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000101 a owl:DatatypeProperty ;
  rdfs:label "methane" ;
  rdfs:comment "Methane (gas) amount or concentration at the time of sampling" ;
  MIXS:Preferred_unit "micromole per liter, parts per billion, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000339 a owl:DatatypeProperty ;
  rdfs:label "microbial biomass method" ;
  rdfs:comment "Reference or method used in determining microbial biomass" ;
  skos:note "slot name/scn was microbial_biomass_meth" ;
  skos:example "http://dx.doi.org/10.1016/j.soilbio.2005.01.021" ;
  schema:keywords "biomass" , "method" , "microbial" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001216 a owl:DatatypeProperty ;
  rdfs:label "microbiological culture medium" ;
  rdfs:comment "A culture medium used to select for, grow, and maintain prokaryotic microorganisms. Can be in either liquid (broth) or solidified (e.g. with agar) forms. This field accepts terms listed under microbiological culture medium (http://purl.obolibrary.org/obo/MICRO_0000067). If the proper descriptor is not listed please use text to describe the culture medium" ;
  skos:example "brain heart infusion agar [MICRO:0000566]" ;
  schema:keywords "culture" , "microbiological" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001217 a owl:DatatypeProperty ;
  rdfs:label "microbial starter" ;
  rdfs:comment "Any type of microorganisms used in food production.  This field accepts terms listed under live organisms for food production (http://purl.obolibrary.org/obo/FOODON_0344453)" ;
  skos:example "starter cultures [FOODON:03544454]" ;
  schema:keywords "microbial" ;
  MIXS:Expected_value "FOODON:03544453" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001218 a owl:DatatypeProperty ;
  rdfs:label "microbial starter organism count" ;
  rdfs:comment "Total cell count of starter culture per gram, volume or area of sample and the method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) should also be provided. (example : total prokaryotes; 3.5e7 cells per ml; qPCR)" ;
  skos:example "total prokaryotes;3.5e9 colony forming units per milliliter;spread plate" ;
  schema:keywords "count" , "microbial" , "organism" ;
  MIXS:Expected_value "organism name; measurement value; enumeration" ;
  MIXS:Preferred_unit "colony forming units per milliliter; colony forming units per gram of dry weight" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001219 a owl:DatatypeProperty ;
  rdfs:label "microbial starter inoculation" ;
  rdfs:comment "The amount of starter culture used to inoculate a new batch" ;
  skos:example "100 milligrams" ;
  schema:keywords "microbial" ;
  MIXS:Preferred_unit "milligram or gram" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001220 a owl:DatatypeProperty ;
  rdfs:label "microbial starter preparation" ;
  rdfs:comment "Information about the protocol or method used to prepare the starter inoculum" ;
  skos:example "liquid starter culture, propagated 3 cycles in milk prior to inoculation" ;
  schema:keywords "microbial" , "preparation" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001221 a owl:DatatypeProperty ;
  rdfs:label "microbial starter source" ;
  rdfs:comment "The source from which the microbial starter culture was sourced.  If commercially supplied, list supplier" ;
  skos:example "backslopped, GetCulture" ;
  schema:keywords "microbial" , "source" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001222 a owl:DatatypeProperty ;
  rdfs:label "microbial starter NCBI taxonomy ID" ;
  rdfs:comment "Please include Genus species and strain ID, if known of microorganisms used in food production. For complex communities, pipes can be used to separate two or more microbes" ;
  skos:example "Lactobacillus rhamnosus [NCIT:C123495]" ;
  schema:keywords "identifier" , "microbial" , "ncbi" , "taxon" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000650 a owl:DatatypeProperty ;
  rdfs:label "microbial biomass" ;
  rdfs:comment "The part of the organic matter in the soil that constitutes living microorganisms smaller than 5-10 micrometer. If you keep this, you would need to have correction factors used for conversion to the final units" ;
  schema:keywords "biomass" , "microbial" ;
  MIXS:Preferred_unit "ton, kilogram, gram per kilogram soil" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with Extension MicrobialMatBiofilm" ;
  rdfs:range MIXS:0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000047 a owl:DatatypeProperty ;
  rdfs:label "multiplex identifiers" ;
  rdfs:comment "Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to specifically tag unique samples in a sequencing run. Sequence should be reported in uppercase letters" ;
  skos:example "GTGAATAT" ;
  schema:keywords "identifier" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:migs_ba_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MigsBaAgriculture data" ;
  rdfs:comment "Data that comply with MigsBa combined with Agriculture" ;
  rdfs:range MIXS:0010003_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_air_data a owl:ObjectProperty ;
  rdfs:label "MigsBaAir data" ;
  rdfs:comment "Data that comply with MigsBa combined with Air" ;
  rdfs:range MIXS:0010003_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsBaBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MigsBa combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010003_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_data a owl:ObjectProperty ;
  rdfs:label "MigsBa data" ;
  rdfs:comment "Data that comply with checklist MigsBa" ;
  rdfs:range MIXS:0010003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MigsBaFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MigsBa combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010003_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsBaFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MigsBa combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010003_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MigsBaFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MigsBa combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010003_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MigsBaFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MigsBa combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010003_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsBaHostAssociated data" ;
  rdfs:comment "Data that comply with MigsBa combined with HostAssociated" ;
  rdfs:range MIXS:0010003_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsBaHumanAssociated data" ;
  rdfs:comment "Data that comply with MigsBa combined with HumanAssociated" ;
  rdfs:range MIXS:0010003_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MigsBaHumanGut data" ;
  rdfs:comment "Data that comply with MigsBa combined with HumanGut" ;
  rdfs:range MIXS:0010003_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MigsBaHumanOral data" ;
  rdfs:comment "Data that comply with MigsBa combined with HumanOral" ;
  rdfs:range MIXS:0010003_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MigsBaHumanSkin data" ;
  rdfs:comment "Data that comply with MigsBa combined with HumanSkin" ;
  rdfs:range MIXS:0010003_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MigsBaHumanVaginal data" ;
  rdfs:comment "Data that comply with MigsBa combined with HumanVaginal" ;
  rdfs:range MIXS:0010003_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MigsBaHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MigsBa combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010003_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MigsBaHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MigsBa combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010003_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MigsBaMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MigsBa combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010003_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsBaMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MigsBa combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010003_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsBaPlantAssociated data" ;
  rdfs:comment "Data that comply with MigsBa combined with PlantAssociated" ;
  rdfs:range MIXS:0010003_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_sediment_data a owl:ObjectProperty ;
  rdfs:label "MigsBaSediment data" ;
  rdfs:comment "Data that comply with MigsBa combined with Sediment" ;
  rdfs:range MIXS:0010003_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_soil_data a owl:ObjectProperty ;
  rdfs:label "MigsBaSoil data" ;
  rdfs:comment "Data that comply with MigsBa combined with Soil" ;
  rdfs:range MIXS:0010003_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsBaSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MigsBa combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010003_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MigsBaWastewaterSludge data" ;
  rdfs:comment "Data that comply with MigsBa combined with WastewaterSludge" ;
  rdfs:range MIXS:0010003_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_ba_water_data a owl:ObjectProperty ;
  rdfs:label "MigsBaWater data" ;
  rdfs:comment "Data that comply with MigsBa combined with Water" ;
  rdfs:range MIXS:0010003_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MigsEuAgriculture data" ;
  rdfs:comment "Data that comply with MigsEu combined with Agriculture" ;
  rdfs:range MIXS:0010002_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_air_data a owl:ObjectProperty ;
  rdfs:label "MigsEuAir data" ;
  rdfs:comment "Data that comply with MigsEu combined with Air" ;
  rdfs:range MIXS:0010002_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsEuBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MigsEu combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010002_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_data a owl:ObjectProperty ;
  rdfs:label "MigsEu data" ;
  rdfs:comment "Data that comply with checklist MigsEu" ;
  rdfs:range MIXS:0010002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MigsEuFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MigsEu combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010002_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsEuFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MigsEu combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010002_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MigsEuFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MigsEu combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010002_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MigsEuFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MigsEu combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010002_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsEuHostAssociated data" ;
  rdfs:comment "Data that comply with MigsEu combined with HostAssociated" ;
  rdfs:range MIXS:0010002_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsEuHumanAssociated data" ;
  rdfs:comment "Data that comply with MigsEu combined with HumanAssociated" ;
  rdfs:range MIXS:0010002_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MigsEuHumanGut data" ;
  rdfs:comment "Data that comply with MigsEu combined with HumanGut" ;
  rdfs:range MIXS:0010002_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MigsEuHumanOral data" ;
  rdfs:comment "Data that comply with MigsEu combined with HumanOral" ;
  rdfs:range MIXS:0010002_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MigsEuHumanSkin data" ;
  rdfs:comment "Data that comply with MigsEu combined with HumanSkin" ;
  rdfs:range MIXS:0010002_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MigsEuHumanVaginal data" ;
  rdfs:comment "Data that comply with MigsEu combined with HumanVaginal" ;
  rdfs:range MIXS:0010002_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MigsEuHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MigsEu combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010002_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MigsEuHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MigsEu combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010002_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MigsEuMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MigsEu combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010002_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsEuMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MigsEu combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010002_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsEuPlantAssociated data" ;
  rdfs:comment "Data that comply with MigsEu combined with PlantAssociated" ;
  rdfs:range MIXS:0010002_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_sediment_data a owl:ObjectProperty ;
  rdfs:label "MigsEuSediment data" ;
  rdfs:comment "Data that comply with MigsEu combined with Sediment" ;
  rdfs:range MIXS:0010002_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_soil_data a owl:ObjectProperty ;
  rdfs:label "MigsEuSoil data" ;
  rdfs:comment "Data that comply with MigsEu combined with Soil" ;
  rdfs:range MIXS:0010002_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsEuSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MigsEu combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010002_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MigsEuWastewaterSludge data" ;
  rdfs:comment "Data that comply with MigsEu combined with WastewaterSludge" ;
  rdfs:range MIXS:0010002_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_eu_water_data a owl:ObjectProperty ;
  rdfs:label "MigsEuWater data" ;
  rdfs:comment "Data that comply with MigsEu combined with Water" ;
  rdfs:range MIXS:0010002_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgAgriculture data" ;
  rdfs:comment "Data that comply with MigsOrg combined with Agriculture" ;
  rdfs:range MIXS:0010006_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_air_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgAir data" ;
  rdfs:comment "Data that comply with MigsOrg combined with Air" ;
  rdfs:range MIXS:0010006_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MigsOrg combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010006_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_data a owl:ObjectProperty ;
  rdfs:label "MigsOrg data" ;
  rdfs:comment "Data that comply with checklist MigsOrg" ;
  rdfs:range MIXS:0010006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MigsOrg combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010006_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MigsOrg combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010006_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MigsOrg combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010006_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MigsOrg combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010006_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgHostAssociated data" ;
  rdfs:comment "Data that comply with MigsOrg combined with HostAssociated" ;
  rdfs:range MIXS:0010006_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgHumanAssociated data" ;
  rdfs:comment "Data that comply with MigsOrg combined with HumanAssociated" ;
  rdfs:range MIXS:0010006_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgHumanGut data" ;
  rdfs:comment "Data that comply with MigsOrg combined with HumanGut" ;
  rdfs:range MIXS:0010006_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgHumanOral data" ;
  rdfs:comment "Data that comply with MigsOrg combined with HumanOral" ;
  rdfs:range MIXS:0010006_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgHumanSkin data" ;
  rdfs:comment "Data that comply with MigsOrg combined with HumanSkin" ;
  rdfs:range MIXS:0010006_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgHumanVaginal data" ;
  rdfs:comment "Data that comply with MigsOrg combined with HumanVaginal" ;
  rdfs:range MIXS:0010006_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MigsOrg combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010006_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MigsOrg combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010006_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MigsOrg combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010006_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MigsOrg combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010006_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgPlantAssociated data" ;
  rdfs:comment "Data that comply with MigsOrg combined with PlantAssociated" ;
  rdfs:range MIXS:0010006_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_sediment_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgSediment data" ;
  rdfs:comment "Data that comply with MigsOrg combined with Sediment" ;
  rdfs:range MIXS:0010006_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_soil_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgSoil data" ;
  rdfs:comment "Data that comply with MigsOrg combined with Soil" ;
  rdfs:range MIXS:0010006_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MigsOrg combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010006_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgWastewaterSludge data" ;
  rdfs:comment "Data that comply with MigsOrg combined with WastewaterSludge" ;
  rdfs:range MIXS:0010006_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_org_water_data a owl:ObjectProperty ;
  rdfs:label "MigsOrgWater data" ;
  rdfs:comment "Data that comply with MigsOrg combined with Water" ;
  rdfs:range MIXS:0010006_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MigsPlAgriculture data" ;
  rdfs:comment "Data that comply with MigsPl combined with Agriculture" ;
  rdfs:range MIXS:0010004_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_air_data a owl:ObjectProperty ;
  rdfs:label "MigsPlAir data" ;
  rdfs:comment "Data that comply with MigsPl combined with Air" ;
  rdfs:range MIXS:0010004_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsPlBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MigsPl combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010004_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_data a owl:ObjectProperty ;
  rdfs:label "MigsPl data" ;
  rdfs:comment "Data that comply with checklist MigsPl" ;
  rdfs:range MIXS:0010004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MigsPlFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MigsPl combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010004_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsPlFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MigsPl combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010004_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MigsPlFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MigsPl combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010004_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MigsPlFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MigsPl combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010004_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsPlHostAssociated data" ;
  rdfs:comment "Data that comply with MigsPl combined with HostAssociated" ;
  rdfs:range MIXS:0010004_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsPlHumanAssociated data" ;
  rdfs:comment "Data that comply with MigsPl combined with HumanAssociated" ;
  rdfs:range MIXS:0010004_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MigsPlHumanGut data" ;
  rdfs:comment "Data that comply with MigsPl combined with HumanGut" ;
  rdfs:range MIXS:0010004_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MigsPlHumanOral data" ;
  rdfs:comment "Data that comply with MigsPl combined with HumanOral" ;
  rdfs:range MIXS:0010004_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MigsPlHumanSkin data" ;
  rdfs:comment "Data that comply with MigsPl combined with HumanSkin" ;
  rdfs:range MIXS:0010004_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MigsPlHumanVaginal data" ;
  rdfs:comment "Data that comply with MigsPl combined with HumanVaginal" ;
  rdfs:range MIXS:0010004_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MigsPlHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MigsPl combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010004_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MigsPlHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MigsPl combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010004_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MigsPlMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MigsPl combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010004_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsPlMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MigsPl combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010004_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsPlPlantAssociated data" ;
  rdfs:comment "Data that comply with MigsPl combined with PlantAssociated" ;
  rdfs:range MIXS:0010004_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_sediment_data a owl:ObjectProperty ;
  rdfs:label "MigsPlSediment data" ;
  rdfs:comment "Data that comply with MigsPl combined with Sediment" ;
  rdfs:range MIXS:0010004_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_soil_data a owl:ObjectProperty ;
  rdfs:label "MigsPlSoil data" ;
  rdfs:comment "Data that comply with MigsPl combined with Soil" ;
  rdfs:range MIXS:0010004_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsPlSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MigsPl combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010004_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MigsPlWastewaterSludge data" ;
  rdfs:comment "Data that comply with MigsPl combined with WastewaterSludge" ;
  rdfs:range MIXS:0010004_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_pl_water_data a owl:ObjectProperty ;
  rdfs:label "MigsPlWater data" ;
  rdfs:comment "Data that comply with MigsPl combined with Water" ;
  rdfs:range MIXS:0010004_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MigsViAgriculture data" ;
  rdfs:comment "Data that comply with MigsVi combined with Agriculture" ;
  rdfs:range MIXS:0010005_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_air_data a owl:ObjectProperty ;
  rdfs:label "MigsViAir data" ;
  rdfs:comment "Data that comply with MigsVi combined with Air" ;
  rdfs:range MIXS:0010005_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsViBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MigsVi combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010005_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_data a owl:ObjectProperty ;
  rdfs:label "MigsVi data" ;
  rdfs:comment "Data that comply with checklist MigsVi" ;
  rdfs:range MIXS:0010005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MigsViFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MigsVi combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010005_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsViFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MigsVi combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010005_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MigsViFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MigsVi combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010005_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MigsViFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MigsVi combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010005_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsViHostAssociated data" ;
  rdfs:comment "Data that comply with MigsVi combined with HostAssociated" ;
  rdfs:range MIXS:0010005_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsViHumanAssociated data" ;
  rdfs:comment "Data that comply with MigsVi combined with HumanAssociated" ;
  rdfs:range MIXS:0010005_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MigsViHumanGut data" ;
  rdfs:comment "Data that comply with MigsVi combined with HumanGut" ;
  rdfs:range MIXS:0010005_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MigsViHumanOral data" ;
  rdfs:comment "Data that comply with MigsVi combined with HumanOral" ;
  rdfs:range MIXS:0010005_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MigsViHumanSkin data" ;
  rdfs:comment "Data that comply with MigsVi combined with HumanSkin" ;
  rdfs:range MIXS:0010005_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MigsViHumanVaginal data" ;
  rdfs:comment "Data that comply with MigsVi combined with HumanVaginal" ;
  rdfs:range MIXS:0010005_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MigsViHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MigsVi combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010005_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MigsViHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MigsVi combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010005_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MigsViMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MigsVi combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010005_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MigsViMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MigsVi combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010005_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsViPlantAssociated data" ;
  rdfs:comment "Data that comply with MigsVi combined with PlantAssociated" ;
  rdfs:range MIXS:0010005_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_sediment_data a owl:ObjectProperty ;
  rdfs:label "MigsViSediment data" ;
  rdfs:comment "Data that comply with MigsVi combined with Sediment" ;
  rdfs:range MIXS:0010005_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_soil_data a owl:ObjectProperty ;
  rdfs:label "MigsViSoil data" ;
  rdfs:comment "Data that comply with MigsVi combined with Soil" ;
  rdfs:range MIXS:0010005_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MigsViSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MigsVi combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010005_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MigsViWastewaterSludge data" ;
  rdfs:comment "Data that comply with MigsVi combined with WastewaterSludge" ;
  rdfs:range MIXS:0010005_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:migs_vi_water_data a owl:ObjectProperty ;
  rdfs:label "MigsViWater data" ;
  rdfs:comment "Data that comply with MigsVi combined with Water" ;
  rdfs:range MIXS:0010005_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MimagAgriculture data" ;
  rdfs:comment "Data that comply with Mimag combined with Agriculture" ;
  rdfs:range MIXS:0010011_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_air_data a owl:ObjectProperty ;
  rdfs:label "MimagAir data" ;
  rdfs:comment "Data that comply with Mimag combined with Air" ;
  rdfs:range MIXS:0010011_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MimagBuiltEnvironment data" ;
  rdfs:comment "Data that comply with Mimag combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010011_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_data a owl:ObjectProperty ;
  rdfs:label "Mimag data" ;
  rdfs:comment "Data that comply with checklist Mimag" ;
  rdfs:range MIXS:0010011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MimagFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with Mimag combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010011_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MimagFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with Mimag combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010011_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MimagFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with Mimag combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010011_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MimagFoodHumanFoods data" ;
  rdfs:comment "Data that comply with Mimag combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010011_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MimagHostAssociated data" ;
  rdfs:comment "Data that comply with Mimag combined with HostAssociated" ;
  rdfs:range MIXS:0010011_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MimagHumanAssociated data" ;
  rdfs:comment "Data that comply with Mimag combined with HumanAssociated" ;
  rdfs:range MIXS:0010011_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MimagHumanGut data" ;
  rdfs:comment "Data that comply with Mimag combined with HumanGut" ;
  rdfs:range MIXS:0010011_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MimagHumanOral data" ;
  rdfs:comment "Data that comply with Mimag combined with HumanOral" ;
  rdfs:range MIXS:0010011_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MimagHumanSkin data" ;
  rdfs:comment "Data that comply with Mimag combined with HumanSkin" ;
  rdfs:range MIXS:0010011_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MimagHumanVaginal data" ;
  rdfs:comment "Data that comply with Mimag combined with HumanVaginal" ;
  rdfs:range MIXS:0010011_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MimagHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with Mimag combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010011_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MimagHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with Mimag combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010011_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MimagMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with Mimag combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010011_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MimagMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with Mimag combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010011_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MimagPlantAssociated data" ;
  rdfs:comment "Data that comply with Mimag combined with PlantAssociated" ;
  rdfs:range MIXS:0010011_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_sediment_data a owl:ObjectProperty ;
  rdfs:label "MimagSediment data" ;
  rdfs:comment "Data that comply with Mimag combined with Sediment" ;
  rdfs:range MIXS:0010011_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_soil_data a owl:ObjectProperty ;
  rdfs:label "MimagSoil data" ;
  rdfs:comment "Data that comply with Mimag combined with Soil" ;
  rdfs:range MIXS:0010011_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MimagSymbiontAssociated data" ;
  rdfs:comment "Data that comply with Mimag combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010011_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MimagWastewaterSludge data" ;
  rdfs:comment "Data that comply with Mimag combined with WastewaterSludge" ;
  rdfs:range MIXS:0010011_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimag_water_data a owl:ObjectProperty ;
  rdfs:label "MimagWater data" ;
  rdfs:comment "Data that comply with Mimag combined with Water" ;
  rdfs:range MIXS:0010011_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MimarksCAgriculture data" ;
  rdfs:comment "Data that comply with MimarksC combined with Agriculture" ;
  rdfs:range MIXS:0010009_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_air_data a owl:ObjectProperty ;
  rdfs:label "MimarksCAir data" ;
  rdfs:comment "Data that comply with MimarksC combined with Air" ;
  rdfs:range MIXS:0010009_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksCBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MimarksC combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010009_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_data a owl:ObjectProperty ;
  rdfs:label "MimarksC data" ;
  rdfs:comment "Data that comply with checklist MimarksC" ;
  rdfs:range MIXS:0010009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MimarksCFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MimarksC combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010009_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksCFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MimarksC combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010009_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MimarksCFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MimarksC combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010009_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MimarksCFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MimarksC combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010009_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksCHostAssociated data" ;
  rdfs:comment "Data that comply with MimarksC combined with HostAssociated" ;
  rdfs:range MIXS:0010009_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksCHumanAssociated data" ;
  rdfs:comment "Data that comply with MimarksC combined with HumanAssociated" ;
  rdfs:range MIXS:0010009_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MimarksCHumanGut data" ;
  rdfs:comment "Data that comply with MimarksC combined with HumanGut" ;
  rdfs:range MIXS:0010009_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MimarksCHumanOral data" ;
  rdfs:comment "Data that comply with MimarksC combined with HumanOral" ;
  rdfs:range MIXS:0010009_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MimarksCHumanSkin data" ;
  rdfs:comment "Data that comply with MimarksC combined with HumanSkin" ;
  rdfs:range MIXS:0010009_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MimarksCHumanVaginal data" ;
  rdfs:comment "Data that comply with MimarksC combined with HumanVaginal" ;
  rdfs:range MIXS:0010009_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MimarksCHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MimarksC combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010009_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MimarksCHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MimarksC combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010009_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MimarksC combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010009_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MimarksC combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010009_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipAgriculture data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with Agriculture" ;
  rdfs:range MIXS:0010015_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_air_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipAir data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with Air" ;
  rdfs:range MIXS:0010015_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010015_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisip data" ;
  rdfs:comment "Data that comply with checklist MimarksCMisip" ;
  rdfs:range MIXS:0010015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010015_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010015_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010015_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010015_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipHostAssociated data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with HostAssociated" ;
  rdfs:range MIXS:0010015_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipHumanAssociated data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with HumanAssociated" ;
  rdfs:range MIXS:0010015_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipHumanGut data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with HumanGut" ;
  rdfs:range MIXS:0010015_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipHumanOral data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with HumanOral" ;
  rdfs:range MIXS:0010015_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipHumanSkin data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with HumanSkin" ;
  rdfs:range MIXS:0010015_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipHumanVaginal data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with HumanVaginal" ;
  rdfs:range MIXS:0010015_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010015_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010015_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010015_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010015_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipPlantAssociated data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with PlantAssociated" ;
  rdfs:range MIXS:0010015_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_sediment_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipSediment data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with Sediment" ;
  rdfs:range MIXS:0010015_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_soil_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipSoil data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with Soil" ;
  rdfs:range MIXS:0010015_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010015_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipWastewaterSludge data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with WastewaterSludge" ;
  rdfs:range MIXS:0010015_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_misip_water_data a owl:ObjectProperty ;
  rdfs:label "MimarksCMisipWater data" ;
  rdfs:comment "Data that comply with MimarksCMisip combined with Water" ;
  rdfs:range MIXS:0010015_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksCPlantAssociated data" ;
  rdfs:comment "Data that comply with MimarksC combined with PlantAssociated" ;
  rdfs:range MIXS:0010009_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_sediment_data a owl:ObjectProperty ;
  rdfs:label "MimarksCSediment data" ;
  rdfs:comment "Data that comply with MimarksC combined with Sediment" ;
  rdfs:range MIXS:0010009_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_soil_data a owl:ObjectProperty ;
  rdfs:label "MimarksCSoil data" ;
  rdfs:comment "Data that comply with MimarksC combined with Soil" ;
  rdfs:range MIXS:0010009_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksCSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MimarksC combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010009_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MimarksCWastewaterSludge data" ;
  rdfs:comment "Data that comply with MimarksC combined with WastewaterSludge" ;
  rdfs:range MIXS:0010009_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_c_water_data a owl:ObjectProperty ;
  rdfs:label "MimarksCWater data" ;
  rdfs:comment "Data that comply with MimarksC combined with Water" ;
  rdfs:range MIXS:0010009_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MimarksSAgriculture data" ;
  rdfs:comment "Data that comply with MimarksS combined with Agriculture" ;
  rdfs:range MIXS:0010008_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_air_data a owl:ObjectProperty ;
  rdfs:label "MimarksSAir data" ;
  rdfs:comment "Data that comply with MimarksS combined with Air" ;
  rdfs:range MIXS:0010008_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksSBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MimarksS combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010008_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_data a owl:ObjectProperty ;
  rdfs:label "MimarksS data" ;
  rdfs:comment "Data that comply with checklist MimarksS" ;
  rdfs:range MIXS:0010008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MimarksSFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MimarksS combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010008_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksSFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MimarksS combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010008_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MimarksSFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MimarksS combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010008_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MimarksSFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MimarksS combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010008_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksSHostAssociated data" ;
  rdfs:comment "Data that comply with MimarksS combined with HostAssociated" ;
  rdfs:range MIXS:0010008_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksSHumanAssociated data" ;
  rdfs:comment "Data that comply with MimarksS combined with HumanAssociated" ;
  rdfs:range MIXS:0010008_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MimarksSHumanGut data" ;
  rdfs:comment "Data that comply with MimarksS combined with HumanGut" ;
  rdfs:range MIXS:0010008_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MimarksSHumanOral data" ;
  rdfs:comment "Data that comply with MimarksS combined with HumanOral" ;
  rdfs:range MIXS:0010008_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MimarksSHumanSkin data" ;
  rdfs:comment "Data that comply with MimarksS combined with HumanSkin" ;
  rdfs:range MIXS:0010008_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MimarksSHumanVaginal data" ;
  rdfs:comment "Data that comply with MimarksS combined with HumanVaginal" ;
  rdfs:range MIXS:0010008_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MimarksSHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MimarksS combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010008_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MimarksSHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MimarksS combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010008_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MimarksSMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MimarksS combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010008_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MimarksSMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MimarksS combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010008_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksSPlantAssociated data" ;
  rdfs:comment "Data that comply with MimarksS combined with PlantAssociated" ;
  rdfs:range MIXS:0010008_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_sediment_data a owl:ObjectProperty ;
  rdfs:label "MimarksSSediment data" ;
  rdfs:comment "Data that comply with MimarksS combined with Sediment" ;
  rdfs:range MIXS:0010008_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_soil_data a owl:ObjectProperty ;
  rdfs:label "MimarksSSoil data" ;
  rdfs:comment "Data that comply with MimarksS combined with Soil" ;
  rdfs:range MIXS:0010008_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MimarksSSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MimarksS combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010008_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MimarksSWastewaterSludge data" ;
  rdfs:comment "Data that comply with MimarksS combined with WastewaterSludge" ;
  rdfs:range MIXS:0010008_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimarks_s_water_data a owl:ObjectProperty ;
  rdfs:label "MimarksSWater data" ;
  rdfs:comment "Data that comply with MimarksS combined with Water" ;
  rdfs:range MIXS:0010008_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MimsAgriculture data" ;
  rdfs:comment "Data that comply with Mims combined with Agriculture" ;
  rdfs:range MIXS:0010007_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_air_data a owl:ObjectProperty ;
  rdfs:label "MimsAir data" ;
  rdfs:comment "Data that comply with Mims combined with Air" ;
  rdfs:range MIXS:0010007_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MimsBuiltEnvironment data" ;
  rdfs:comment "Data that comply with Mims combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010007_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_data a owl:ObjectProperty ;
  rdfs:label "Mims data" ;
  rdfs:comment "Data that comply with checklist Mims" ;
  rdfs:range MIXS:0010007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MimsFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with Mims combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010007_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MimsFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with Mims combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010007_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MimsFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with Mims combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010007_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MimsFoodHumanFoods data" ;
  rdfs:comment "Data that comply with Mims combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010007_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MimsHostAssociated data" ;
  rdfs:comment "Data that comply with Mims combined with HostAssociated" ;
  rdfs:range MIXS:0010007_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_hostassociated_ancient_data a owl:ObjectProperty ;
  rdfs:label "MimsHostAssociatedAncient Data" ;
  rdfs:comment "Data that comply with Ancient combined with MimsHostAssociated" ;
  rdfs:range MIXS:0010007_0016002_0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanAssociated data" ;
  rdfs:comment "Data that comply with Mims combined with HumanAssociated" ;
  rdfs:range MIXS:0010007_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanGut data" ;
  rdfs:comment "Data that comply with Mims combined with HumanGut" ;
  rdfs:range MIXS:0010007_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanOral data" ;
  rdfs:comment "Data that comply with Mims combined with HumanOral" ;
  rdfs:range MIXS:0010007_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanSkin data" ;
  rdfs:comment "Data that comply with Mims combined with HumanSkin" ;
  rdfs:range MIXS:0010007_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanVaginal data" ;
  rdfs:comment "Data that comply with Mims combined with HumanVaginal" ;
  rdfs:range MIXS:0010007_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_humanassociated_ancient_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanAssociatedAncient Data" ;
  rdfs:comment "Data that comply with Ancient combined with MimsHumanAssociated" ;
  rdfs:range MIXS:0010007_0016003_0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_humangut_ancient_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanGutAncient Data" ;
  rdfs:comment "Data that comply with Ancient combined with MimsHumanGut" ;
  rdfs:range MIXS:0010007_0016004_0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_humanoral_ancient_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanOralAncient Data" ;
  rdfs:comment "Data that comply with Ancient combined with MimsHumanOral" ;
  rdfs:range MIXS:0010007_0016005_0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_humanskin_ancient_data a owl:ObjectProperty ;
  rdfs:label "MimsHumanSkinAncient Data" ;
  rdfs:comment "Data that comply with Ancient combined with MimsHumanSkin" ;
  rdfs:range MIXS:0010007_0016006_0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MimsHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with Mims combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010007_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MimsHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with Mims combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010007_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MimsMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with Mims combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010007_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MimsMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with Mims combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010007_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MimsPlantAssociated data" ;
  rdfs:comment "Data that comply with Mims combined with PlantAssociated" ;
  rdfs:range MIXS:0010007_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_plantassociated_ancient_data a owl:ObjectProperty ;
  rdfs:label "MimsPlantAssociatedAncient Data" ;
  rdfs:comment "Data that comply with Ancient combined with MimsPlantAssociated" ;
  rdfs:range MIXS:0010007_0016010_0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_sediment_ancient_data a owl:ObjectProperty ;
  rdfs:label "MimsSedimentAncient Data" ;
  rdfs:comment "Data that comply with Ancient combined with MimsSediment" ;
  rdfs:range MIXS:0010007_0016011_0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_sediment_data a owl:ObjectProperty ;
  rdfs:label "MimsSediment data" ;
  rdfs:comment "Data that comply with Mims combined with Sediment" ;
  rdfs:range MIXS:0010007_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_soil_ancient_data a owl:ObjectProperty ;
  rdfs:label "MimsSoilAncient Data" ;
  rdfs:comment "Data that comply with Ancient combined with MimsSoil" ;
  rdfs:range MIXS:0010007_0016012_0016024 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_soil_data a owl:ObjectProperty ;
  rdfs:label "MimsSoil data" ;
  rdfs:comment "Data that comply with Mims combined with Soil" ;
  rdfs:range MIXS:0010007_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MimsSymbiontAssociated data" ;
  rdfs:comment "Data that comply with Mims combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010007_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MimsWastewaterSludge data" ;
  rdfs:comment "Data that comply with Mims combined with WastewaterSludge" ;
  rdfs:range MIXS:0010007_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mims_water_data a owl:ObjectProperty ;
  rdfs:label "MimsWater data" ;
  rdfs:comment "Data that comply with Mims combined with Water" ;
  rdfs:range MIXS:0010007_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipAgriculture data" ;
  rdfs:comment "Data that comply with MimsMisip combined with Agriculture" ;
  rdfs:range MIXS:0010014_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_air_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipAir data" ;
  rdfs:comment "Data that comply with MimsMisip combined with Air" ;
  rdfs:range MIXS:0010014_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipBuiltEnvironment data" ;
  rdfs:comment "Data that comply with MimsMisip combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010014_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_data a owl:ObjectProperty ;
  rdfs:label "MimsMisip data" ;
  rdfs:comment "Data that comply with checklist MimsMisip" ;
  rdfs:range MIXS:0010014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with MimsMisip combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010014_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with MimsMisip combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010014_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimmisip_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with MimsMisip combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010014_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipFoodHumanFoods data" ;
  rdfs:comment "Data that comply with MimsMisip combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010014_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipHostAssociated data" ;
  rdfs:comment "Data that comply with MimsMisip combined with HostAssociated" ;
  rdfs:range MIXS:0010014_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipHumanAssociated data" ;
  rdfs:comment "Data that comply with MimsMisip combined with HumanAssociated" ;
  rdfs:range MIXS:0010014_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipHumanGut data" ;
  rdfs:comment "Data that comply with MimsMisip combined with HumanGut" ;
  rdfs:range MIXS:0010014_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipHumanOral data" ;
  rdfs:comment "Data that comply with MimsMisip combined with HumanOral" ;
  rdfs:range MIXS:0010014_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipHumanSkin data" ;
  rdfs:comment "Data that comply with MimsMisip combined with HumanSkin" ;
  rdfs:range MIXS:0010014_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipHumanVaginal data" ;
  rdfs:comment "Data that comply with MimsMisip combined with HumanVaginal" ;
  rdfs:range MIXS:0010014_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with MimsMisip combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010014_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with MimsMisip combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010014_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with MimsMisip combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010014_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with MimsMisip combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010014_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipPlantAssociated data" ;
  rdfs:comment "Data that comply with MimsMisip combined with PlantAssociated" ;
  rdfs:range MIXS:0010014_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_sediment_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipSediment data" ;
  rdfs:comment "Data that comply with MimsMisip combined with Sediment" ;
  rdfs:range MIXS:0010014_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_soil_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipSoil data" ;
  rdfs:comment "Data that comply with MimsMisip combined with Soil" ;
  rdfs:range MIXS:0010014_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipSymbiontAssociated data" ;
  rdfs:comment "Data that comply with MimsMisip combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010014_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipWastewaterSludge data" ;
  rdfs:comment "Data that comply with MimsMisip combined with WastewaterSludge" ;
  rdfs:range MIXS:0010014_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:mimsmisip_water_data a owl:ObjectProperty ;
  rdfs:label "MimsMisipWater data" ;
  rdfs:comment "Data that comply with MimsMisip combined with Water" ;
  rdfs:range MIXS:0010014_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000570 a owl:DatatypeProperty ;
  rdfs:label "mineral nutrient regimen" ;
  rdfs:comment "Information about treatment involving the use of mineral supplements; should include the name of mineral nutrient, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple mineral nutrient regimens" ;
  skos:example "potassium;15 gram;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "mineral" , "nutrient" , "regimen" ;
  MIXS:Expected_value "mineral nutrient name;mineral nutrient amount;treatment interval and duration" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:misag_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MisagAgriculture data" ;
  rdfs:comment "Data that comply with Misag combined with Agriculture" ;
  rdfs:range MIXS:0010010_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_air_data a owl:ObjectProperty ;
  rdfs:label "MisagAir data" ;
  rdfs:comment "Data that comply with Misag combined with Air" ;
  rdfs:range MIXS:0010010_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MisagBuiltEnvironment data" ;
  rdfs:comment "Data that comply with Misag combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010010_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_data a owl:ObjectProperty ;
  rdfs:label "Misag data" ;
  rdfs:comment "Data that comply with checklist Misag" ;
  rdfs:range MIXS:0010010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MisagFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with Misag combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010010_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MisagFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with Misag combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010010_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MisagFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with Misag combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010010_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MisagFoodHumanFoods data" ;
  rdfs:comment "Data that comply with Misag combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010010_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MisagHostAssociated data" ;
  rdfs:comment "Data that comply with Misag combined with HostAssociated" ;
  rdfs:range MIXS:0010010_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MisagHumanAssociated data" ;
  rdfs:comment "Data that comply with Misag combined with HumanAssociated" ;
  rdfs:range MIXS:0010010_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MisagHumanGut data" ;
  rdfs:comment "Data that comply with Misag combined with HumanGut" ;
  rdfs:range MIXS:0010010_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MisagHumanOral data" ;
  rdfs:comment "Data that comply with Misag combined with HumanOral" ;
  rdfs:range MIXS:0010010_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MisagHumanSkin data" ;
  rdfs:comment "Data that comply with Misag combined with HumanSkin" ;
  rdfs:range MIXS:0010010_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MisagHumanVaginal data" ;
  rdfs:comment "Data that comply with Misag combined with HumanVaginal" ;
  rdfs:range MIXS:0010010_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MisagHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with Misag combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010010_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MisagHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with Misag combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010010_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MisagMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with Misag combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010010_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MisagMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with Misag combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010010_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MisagPlantAssociated data" ;
  rdfs:comment "Data that comply with Misag combined with PlantAssociated" ;
  rdfs:range MIXS:0010010_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_sediment_data a owl:ObjectProperty ;
  rdfs:label "MisagSediment data" ;
  rdfs:comment "Data that comply with Misag combined with Sediment" ;
  rdfs:range MIXS:0010010_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_soil_data a owl:ObjectProperty ;
  rdfs:label "MisagSoil data" ;
  rdfs:comment "Data that comply with Misag combined with Soil" ;
  rdfs:range MIXS:0010010_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MisagSymbiontAssociated data" ;
  rdfs:comment "Data that comply with Misag combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010010_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MisagWastewaterSludge data" ;
  rdfs:comment "Data that comply with Misag combined with WastewaterSludge" ;
  rdfs:range MIXS:0010010_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:misag_water_data a owl:ObjectProperty ;
  rdfs:label "MisagWater data" ;
  rdfs:comment "Data that comply with Misag combined with Water" ;
  rdfs:range MIXS:0010010_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000752 a owl:DatatypeProperty ;
  rdfs:label "miscellaneous parameter" ;
  rdfs:comment "Any other measurement performed or parameter collected, that is not listed here" ;
  skos:example "Bicarbonate ion concentration;2075 micromole per kilogram" ;
  schema:keywords "parameter" ;
  MIXS:Expected_value "parameter name;measurement value" ;
  rdfs:range xsd:string .

MIXS:miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with Extension MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_agriculture_data a owl:ObjectProperty ;
  rdfs:label "MiuvigAgriculture data" ;
  rdfs:comment "Data that comply with Miuvig combined with Agriculture" ;
  rdfs:range MIXS:0010012_0016018 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_air_data a owl:ObjectProperty ;
  rdfs:label "MiuvigAir data" ;
  rdfs:comment "Data that comply with Miuvig combined with Air" ;
  rdfs:range MIXS:0010012_0016000 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_built_environment_data a owl:ObjectProperty ;
  rdfs:label "MiuvigBuiltEnvironment data" ;
  rdfs:comment "Data that comply with Miuvig combined with BuiltEnvironment" ;
  rdfs:range MIXS:0010012_0016001 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_data a owl:ObjectProperty ;
  rdfs:label "Miuvig data" ;
  rdfs:comment "Data that comply with checklist Miuvig" ;
  rdfs:range MIXS:0010012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_food_animal_and_animal_feed_data a owl:ObjectProperty ;
  rdfs:label "MiuvigFoodAnimalAndAnimalFeed data" ;
  rdfs:comment "Data that comply with Miuvig combined with FoodAnimalAndAnimalFeed" ;
  rdfs:range MIXS:0010012_0016019 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_food_farm_environment_data a owl:ObjectProperty ;
  rdfs:label "MiuvigFoodFarmEnvironment data" ;
  rdfs:comment "Data that comply with Miuvig combined with FoodFarmEnvironment" ;
  rdfs:range MIXS:0010012_0016020 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_food_food_production_facility_data a owl:ObjectProperty ;
  rdfs:label "MiuvigFoodFoodProductionFacility data" ;
  rdfs:comment "Data that comply with Miuvig combined with FoodFoodProductionFacility" ;
  rdfs:range MIXS:0010012_0016021 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_food_human_foods_data a owl:ObjectProperty ;
  rdfs:label "MiuvigFoodHumanFoods data" ;
  rdfs:comment "Data that comply with Miuvig combined with FoodHumanFoods" ;
  rdfs:range MIXS:0010012_0016022 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_host_associated_data a owl:ObjectProperty ;
  rdfs:label "MiuvigHostAssociated data" ;
  rdfs:comment "Data that comply with Miuvig combined with HostAssociated" ;
  rdfs:range MIXS:0010012_0016002 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_human_associated_data a owl:ObjectProperty ;
  rdfs:label "MiuvigHumanAssociated data" ;
  rdfs:comment "Data that comply with Miuvig combined with HumanAssociated" ;
  rdfs:range MIXS:0010012_0016003 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_human_gut_data a owl:ObjectProperty ;
  rdfs:label "MiuvigHumanGut data" ;
  rdfs:comment "Data that comply with Miuvig combined with HumanGut" ;
  rdfs:range MIXS:0010012_0016004 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_human_oral_data a owl:ObjectProperty ;
  rdfs:label "MiuvigHumanOral data" ;
  rdfs:comment "Data that comply with Miuvig combined with HumanOral" ;
  rdfs:range MIXS:0010012_0016005 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_human_skin_data a owl:ObjectProperty ;
  rdfs:label "MiuvigHumanSkin data" ;
  rdfs:comment "Data that comply with Miuvig combined with HumanSkin" ;
  rdfs:range MIXS:0010012_0016006 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_human_vaginal_data a owl:ObjectProperty ;
  rdfs:label "MiuvigHumanVaginal data" ;
  rdfs:comment "Data that comply with Miuvig combined with HumanVaginal" ;
  rdfs:range MIXS:0010012_0016007 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_hydrocarbon_resources_cores_data a owl:ObjectProperty ;
  rdfs:label "MiuvigHydrocarbonResourcesCores data" ;
  rdfs:comment "Data that comply with Miuvig combined with HydrocarbonResourcesCores" ;
  rdfs:range MIXS:0010012_0016015 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_hydrocarbon_resources_fluids_swabs_data a owl:ObjectProperty ;
  rdfs:label "MiuvigHydrocarbonResourcesFluidsSwabs data" ;
  rdfs:comment "Data that comply with Miuvig combined with HydrocarbonResourcesFluidsSwabs" ;
  rdfs:range MIXS:0010012_0016016 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_microbial_mat_biofilm_data a owl:ObjectProperty ;
  rdfs:label "MiuvigMicrobialMatBiofilm data" ;
  rdfs:comment "Data that comply with Miuvig combined with MicrobialMatBiofilm" ;
  rdfs:range MIXS:0010012_0016008 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_miscellaneous_natural_or_artificial_environment_data a owl:ObjectProperty ;
  rdfs:label "MiuvigMiscellaneousNaturalOrArtificialEnvironment data" ;
  rdfs:comment "Data that comply with Miuvig combined with MiscellaneousNaturalOrArtificialEnvironment" ;
  rdfs:range MIXS:0010012_0016009 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_plant_associated_data a owl:ObjectProperty ;
  rdfs:label "MiuvigPlantAssociated data" ;
  rdfs:comment "Data that comply with Miuvig combined with PlantAssociated" ;
  rdfs:range MIXS:0010012_0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_sediment_data a owl:ObjectProperty ;
  rdfs:label "MiuvigSediment data" ;
  rdfs:comment "Data that comply with Miuvig combined with Sediment" ;
  rdfs:range MIXS:0010012_0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_soil_data a owl:ObjectProperty ;
  rdfs:label "MiuvigSoil data" ;
  rdfs:comment "Data that comply with Miuvig combined with Soil" ;
  rdfs:range MIXS:0010012_0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "MiuvigSymbiontAssociated data" ;
  rdfs:comment "Data that comply with Miuvig combined with SymbiontAssociated" ;
  rdfs:range MIXS:0010012_0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "MiuvigWastewaterSludge data" ;
  rdfs:comment "Data that comply with Miuvig combined with WastewaterSludge" ;
  rdfs:range MIXS:0010012_0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:miuvig_water_data a owl:ObjectProperty ;
  rdfs:label "MiuvigWater data" ;
  rdfs:comment "Data that comply with Miuvig combined with Water" ;
  rdfs:range MIXS:0010012_0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001312 a owl:ObjectProperty ;
  rdfs:label "mode of transmission" ;
  rdfs:comment "The process through which the symbiotic host organism entered the host from which it was sampled" ;
  skos:example "horizontal:castrator" ;
  rdfs:range MIXS:ModeTransmissionEnum ;
  a owl:FunctionalProperty .

MIXS:0000503 a owl:DatatypeProperty ;
  rdfs:label "n-alkanes" ;
  rdfs:comment "Concentration of n-alkanes; can include multiple n-alkanes" ;
  skos:example "n-hexadecane;100 milligram per liter" ;
  MIXS:Expected_value "n-alkane name;measurement value" ;
  rdfs:range xsd:string .

MIXS:0001321 a owl:ObjectProperty ;
  rdfs:label "negative control type" ;
  rdfs:comment "The substance or equipment used as a negative control in an investigation" ;
  schema:keywords "type" ;
  MIXS:Expected_value "enumeration or text" ;
  rdfs:range MIXS:NegContTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000425 a owl:DatatypeProperty ;
  rdfs:label "nitrate" ;
  rdfs:comment "Concentration of nitrate in the sample" ;
  skos:example "65 micromole per liter" ;
  schema:keywords "nitrate" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000426 a owl:DatatypeProperty ;
  rdfs:label "nitrite" ;
  rdfs:comment "Concentration of nitrite in the sample" ;
  skos:example "0.5 micromole per liter" ;
  schema:keywords "nitrite" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000504 a owl:DatatypeProperty ;
  rdfs:label "nitrogen" ;
  rdfs:comment "Concentration of nitrogen (total)" ;
  skos:example "4.2 micromole per liter" ;
  schema:keywords "nitrogen" ;
  MIXS:Preferred_unit "micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000571 a owl:DatatypeProperty ;
  rdfs:label "non-mineral nutrient regimen" ;
  rdfs:comment "Information about treatment involving the exposure of plant to non-mineral nutrient such as oxygen, hydrogen or carbon; should include the name of non-mineral nutrient, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple non-mineral nutrient regimens" ;
  skos:example "https://phylogenomics.me/protocols/16s-pcr-protocol/" ;
  schema:keywords "non-mineral" , "nutrient" , "regimen" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0000283 a owl:DatatypeProperty ;
  rdfs:label "nose/mouth/teeth/throat disorder" ;
  rdfs:comment """History of nose/mouth/teeth/throat disorders; can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, nose disease (https://disease-ontology.org/?id=DOID:2825), mouth disease (https://disease-ontology.org/?id=DOID:403), tooth disease (https://disease-ontology.org/?id=DOID:1091), or upper respiratory tract disease (https://disease-ontology.org/?id=DOID:974)
""" ;
  schema:keywords "disorder" ;
  owl:deprecated "true, replace with MIXS:0000270 https://github.com/GenomicsStandardsConsortium/mixs/issues/743" ;
  rdfs:range xsd:string .

MIXS:0000270 a owl:DatatypeProperty ;
  rdfs:label "nose throat disorder" ;
  rdfs:comment """Report any history of nose, mouth, teeth and/or throat disorders in the subject. May include multiple disorders.
""" ;
  skos:altLabel "nose_mouth_teeth_throat_disord" ;
  skos:note """The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, lung disease (https://disease-ontology.org/?id=DOID:850), upper respiratory tract disease (https://disease-ontology.org/?id=DOID:974)
""" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000038 a owl:DatatypeProperty ;
  rdfs:label "nucleic acid amplification" ;
  rdfs:comment "A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids" ;
  skos:example "https://phylogenomics.me/protocols/16s-pcr-protocol/" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000037 a owl:DatatypeProperty ;
  rdfs:label "nucleic acid extraction" ;
  rdfs:comment "A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample" ;
  skos:example "https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001223 a owl:DatatypeProperty ;
  rdfs:label "nucleic acid extraction kit" ;
  rdfs:comment "The name of the extraction kit used to recover the nucleic acid fraction of an input material is performed" ;
  skos:example "Qiagen PowerSoil Kit" ;
  schema:keywords "kit" ;
  MIXS:Expected_value "The name of an extraction kit" ;
  rdfs:range xsd:string .

MIXS:0001386 a owl:DatatypeProperty ;
  rdfs:label "date of extraction of nucleic acids from sample" ;
  rdfs:comment "The date when the nucleic acid extraction was started from the sample material. In case no exact time is available, the date can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant" ;
  skos:example "2023-12-01" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0001353 a owl:DatatypeProperty ;
  rdfs:label "nucleic acid elution volume" ;
  rdfs:comment "Volume the nucleic acid (DNA or RNA) sample is eluted in" ;
  skos:note "Unit is microliter" ;
  skos:example "15 uL" ;
  MIXS:Preferred_unit "uL" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001349 a owl:DatatypeProperty ;
  rdfs:label "nucleobase excess atom fraction" ;
  rdfs:comment "Excess atom fraction of the nucleobases in this fraction." ;
  skos:example "0.25" ;
  rdfs:range [
    a rdfs:Datatype ;
    owl:onDatatype xsd:float ;
    owl:withRestrictions ( _:o6967 _:o6968 )
  ] ;
  a owl:FunctionalProperty .

_:o6967 xsd:minInclusive "0"^^xsd:float .

_:o6968 xsd:maxInclusive "1"^^xsd:float .

MIXS:0000022 a owl:DatatypeProperty ;
  rdfs:label "number of replicons" ;
  rdfs:comment "Reports the number of replicons in a nuclear genome of eukaryotes, in the genome of a bacterium or archaea or the number of segments in a segmented virus. Always applied to the haploid chromosome count of a eukaryote" ;
  skos:example "2" ;
  schema:keywords "number" ;
  MIXS:Expected_value "for eukaryotes and bacteria: chromosomes (haploid count); for viruses: segments" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0001224 a owl:DatatypeProperty ;
  rdfs:label "number of samples collected" ;
  rdfs:comment "The number of samples collected during the current sampling event" ;
  skos:example "116 samples" ;
  schema:keywords "number" , "sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000060 a owl:DatatypeProperty ;
  rdfs:label "number of contigs" ;
  rdfs:comment "Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG" ;
  skos:example "40" ;
  schema:keywords "number" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000231 a owl:DatatypeProperty ;
  rdfs:label "number of pets" ;
  rdfs:comment "The number of pets residing in the sampled space" ;
  schema:keywords "number" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000230 a owl:DatatypeProperty ;
  rdfs:label "number of houseplants" ;
  rdfs:comment "The number of plant(s) in the sampling space" ;
  schema:keywords "number" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000232 a owl:DatatypeProperty ;
  rdfs:label "number of residents" ;
  rdfs:comment "The number of individuals currently occupying in the sampling location" ;
  schema:keywords "number" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000217 a owl:DatatypeProperty ;
  rdfs:label "occupant density at sampling" ;
  rdfs:comment "Average number of occupants at time of sampling per square footage" ;
  skos:example "0.1" ;
  schema:keywords "density" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000816 a owl:ObjectProperty ;
  rdfs:label "occupancy documentation" ;
  rdfs:comment "The type of documentation of occupancy" ;
  skos:example "estimate" ;
  schema:keywords "documentation" ;
  rdfs:range MIXS:OccupDocumentEnum ;
  a owl:FunctionalProperty .

MIXS:0000772 a owl:DatatypeProperty ;
  rdfs:label "occupancy at sampling" ;
  rdfs:comment "Number of occupants present at time of sample within the given space" ;
  skos:example "10" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000508 a owl:DatatypeProperty ;
  rdfs:label "organic carbon" ;
  rdfs:comment "Concentration of organic carbon" ;
  skos:example "1.5 microgram per liter" ;
  schema:keywords "carbon" , "organic" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000099 a owl:DatatypeProperty ;
  rdfs:label "organism count qPCR information" ;
  rdfs:comment "If qpcr was used for the cell count, the target gene name, the primer sequence and the cycling conditions should also be provided. (Example: 16S rrna; FWD:ACGTAGCTATGACGT REV:GTGCTAGTCGAGTAC; initial denaturation:90C_5min; denaturation:90C_2min; annealing:52C_30 sec; elongation:72C_30 sec; 90 C for 1 min; final elongation:72C_5min; 30 cycles)" ;
  schema:keywords "count" , "information" , "organism" ;
  MIXS:Expected_value "gene name;FWD:forward primer sequence;REV:reverse primer sequence;initial denaturation:degrees_minutes;denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final elongation:degrees_minutes; total cycles" ;
  MIXS:Preferred_unit "number of cells per gram (or ml or cm^2)" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000204 a owl:DatatypeProperty ;
  rdfs:label "organic matter" ;
  rdfs:comment "Concentration of organic matter" ;
  skos:example "1.75 milligram per cubic meter" ;
  schema:keywords "organic" ;
  MIXS:Preferred_unit "microgram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000205 a owl:DatatypeProperty ;
  rdfs:label "organic nitrogen" ;
  rdfs:comment "Concentration of organic nitrogen" ;
  skos:example "4 micromole per liter" ;
  schema:keywords "nitrogen" , "organic" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000665 a owl:DatatypeProperty ;
  rdfs:label "organic particles" ;
  rdfs:comment "Concentration of particles such as faeces, hairs, food, vomit, paper fibers, plant material, humus, etc" ;
  schema:keywords "organic" , "particle" ;
  MIXS:Expected_value "particle name;measurement value" ;
  MIXS:Preferred_unit "gram per liter" ;
  rdfs:range xsd:string .

MIXS:0000103 a owl:DatatypeProperty ;
  rdfs:label "organism count" ;
  rdfs:comment "Total cell count of any organism (or group of organisms) per gram, volume or area of sample, should include name of organism followed by count. The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)" ;
  schema:keywords "count" , "organism" ;
  MIXS:Expected_value "organism name;measurement value;enumeration" ;
  rdfs:range xsd:string .

MIXS:0001358 a owl:DatatypeProperty ;
  rdfs:label "original geographic location (latitude)" ;
  rdfs:comment "The latitude coordinate of the original geographical origin of the sample, e.g. the original place the sample was buried, deposited, or formed. In cases where the sample was directly sampled in the burial environment for the purposes of scientific investigation, this will be the same as geo_loc_name, and lat_lon. For samples kept in collections, the geo_loc_name and lat_lon terms are used to refer to the collection where the sample is stored, but this term is used for the original geographic location the sample existed in prior to archiving in a collection (i.e., should correspond to  orig_site_loc, not the collection itself as recorded in site_name). The values should be reported in decimal degrees, limited to 8 decimal points, and in WGS84 system." ;
  skos:example "50.586825" , "-0.123" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001357 a owl:DatatypeProperty ;
  rdfs:label "original site location" ;
  rdfs:comment "The original geographical origin of the sample, when sampled outside its original natural environment (e.g. sampled in a museum collection), as defined by the country or sea name followed by specific region name.  Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ)." ;
  skos:example "South Africa: Western Cape" , "Germany: Baden-Württemberg, Geißenklösterle Cave" , "Northern Italy: Lombardy" ;
  schema:keywords "location" , "site" ;
  MIXS:Expected_value "Name of original geographic origin of the sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001359 a owl:DatatypeProperty ;
  rdfs:label "original geographic location (longitude)" ;
  rdfs:comment "The longitude coordinate of the original geographical origin of the sample, e.g. the original place the sample was buried, deposited, or formed. In cases where the sample was directly sampled in the burial environment for the purposes of scientific investigation, this will be the same as geo_loc_name, and lat_lon. For samples kept in collections, the geo_loc_name and lat_lon terms are used to refer to the collection where the sample is stored, but this term is used for the original geographic location the sample existed in prior to archiving in a collection (i.e., should correspond to orig_site_loc, not the collection itself, as recorded in site_name). The values should be reported in decimal degrees, limited to 8 decimal points, and in WGS84 system." ;
  skos:example "6.408977" , "-12.12" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001356 a owl:DatatypeProperty ;
  rdfs:label "name of site or location where sample originated" ;
  rdfs:comment "Designated name of the archaeological or ecological site, ancient settlement, or location etc. where the sample was originally collected. Can be a non-geographical name, such as a field-specific name or code, the official name of an excavation, or a colloquial name that is used in academic literature. Typically names that would not be found on official maps. If the site name is unclear please use the name of the closest location or region as best as possible. Can also include different transliterations or languages used in the literature." ;
  skos:example "Valley of the Kings" , "Krakow Spadzista B" , "Coopers Cave" , "Cutler Fossil Site" , "Kap København Formation" , "Northern Italy, Lombardy, exact location unknown" ;
  schema:keywords "environment" , "sample" ;
  MIXS:Expected_value "Name of site or location where sample was originated" ;
  rdfs:range xsd:string .

MIXS:0000085 a owl:DatatypeProperty ;
  rdfs:label "OTU classification approach" ;
  rdfs:comment "Cutoffs and approach used when clustering species-level OTUs. Note that results from standard 95% ANI / 85% AF clustering should be provided alongside OTUs defined from another set of thresholds, even if the latter are the ones primarily used during the analysis" ;
  skos:example "95% ANI;85% AF; greedy incremental clustering" ;
  schema:keywords "classification" , "otu" ;
  MIXS:Expected_value "cutoffs and method used" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000087 a owl:DatatypeProperty ;
  rdfs:label "OTU database" ;
  rdfs:comment "Reference database (i.e. sequences not generated as part of the current study) used to cluster new genomes in \"species-level\" OTUs, if any" ;
  skos:example "NCBI Viral RefSeq;83" ;
  schema:keywords "database" , "otu" ;
  MIXS:Expected_value "database and version" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000086 a owl:DatatypeProperty ;
  rdfs:label "OTU sequence comparison approach" ;
  rdfs:comment "Tool and thresholds used to compare sequences when computing \"species-level\" OTUs" ;
  skos:example "blastn;2.6.0+;e-value cutoff: 0.001" ;
  schema:keywords "otu" ;
  MIXS:Expected_value "software name, version and relevant parameters" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000405 a owl:DatatypeProperty ;
  rdfs:label "oil water contact depth" ;
  rdfs:comment "Depth of the original oil water contact (OWC) zone (average) (m TVDSS)" ;
  schema:keywords "depth" , "oil" , "water" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000753 a owl:ObjectProperty ;
  rdfs:label "oxygenation status of sample" ;
  rdfs:comment "Oxygenation status of sample" ;
  skos:example "aerobic" ;
  schema:keywords "oxygen" , "sample" , "status" ;
  rdfs:range MIXS:OxyStatSampEnum ;
  a owl:FunctionalProperty .

MIXS:0000104 a owl:DatatypeProperty ;
  rdfs:label "oxygen" ;
  rdfs:comment "Oxygen (gas) amount or concentration at the time of sampling" ;
  skos:example "600 parts per million" ;
  schema:keywords "oxygen" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001381 a owl:DatatypeProperty ;
  rdfs:label "palaeopathology status" ;
  rdfs:comment "Describe briefly any relevant palaeopathological or health-related observations of the remains of the individual or subject under study." ;
  skos:example "Osteoporosis." , "Parasites found in pelvic area." , "Caries on right upper molar." ;
  schema:keywords "palaeopathology" , "host health" , "ancient" ;
  MIXS:Expected_value "description of health related observation on ancient remains" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000515 a owl:DatatypeProperty ;
  rdfs:label "particulate organic carbon" ;
  rdfs:comment "Concentration of particulate organic carbon" ;
  skos:example "1.92 micromole per liter" ;
  schema:keywords "carbon" , "organic" , "particle" , "particulate" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000719 a owl:DatatypeProperty ;
  rdfs:label "particulate organic nitrogen" ;
  rdfs:comment "Concentration of particulate organic nitrogen" ;
  skos:example "0.3 micromole per liter" ;
  schema:keywords "nitrogen" , "organic" , "particle" , "particulate" ;
  MIXS:Preferred_unit "microgram per liter, micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001149 a owl:DatatypeProperty ;
  rdfs:label "part of plant or animal" ;
  rdfs:comment "The anatomical part of the organism being involved in food production or consumption; e.g., a carrot is the root of the plant (root vegetable). This field accepts terms listed under part of plant or animal (http://purl.obolibrary.org/obo/FOODON_03420116)" ;
  skos:example "chuck [FOODON:03530021]" ;
  schema:keywords "animal" , "plant" ;
  MIXS:Expected_value "FOODON:03420116" ;
  rdfs:range xsd:string .

MIXS:0000206 a owl:DatatypeProperty ;
  rdfs:label "particle classification" ;
  rdfs:comment "Particles are classified, based on their size, into six general categories:clay, silt, sand, gravel, cobbles, and boulders; should include amount of particle preceded by the name of the particle type; can include multiple values" ;
  schema:keywords "classification" , "particle" ;
  MIXS:Expected_value "particle name;measurement value" ;
  MIXS:Preferred_unit "micrometer" ;
  rdfs:range xsd:string .

MIXS:0001360 a owl:DatatypeProperty ;
  rdfs:label "broad-scale past environmental context" ;
  rdfs:comment "Report information about the general ancient broad environmental system that the sample or specimen existed or lived within, as it was at the time of deposition or burial (e.g. in the desert or a forest). This should not describe the environment as it is today (e.g. farmland), but specifically the state as it was in the past (i.e. the palaeo- or (pre)historical ecosystem). Compared to `env_broad_scale` which is taken from direct observation, the information about the past environment will normally be derived from inference from archaeological, palaeontological, geological, or other scientific methods. We recommend using subclasses of EnvO s biome class:  http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field for present day equivalents: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS\\\"\"" ;
  skos:example "dessert biome [ENVO:01000247]" ;
  schema:keywords "context" , "environmental" , "ancient" ;
  rdfs:range [
    a rdfs:Datatype ;
    owl:onDatatype xsd:string ;
    owl:withRestrictions ( _:o6970 )
  ] ;
  a owl:FunctionalProperty .

_:o6970 xsd:pattern "([^\\s-]{1,2}|[^\\s-]+.+[^\\s-]+) \\[[a-zA-Z]{2,}:[a-zA-Z0-9]\\d+\\]" .

MIXS:0001361 a owl:DatatypeProperty ;
  rdfs:label "local past environmental context" ;
  rdfs:comment "Report information about the smaller-scale environmental system of the local vicinity of the sample or specimen at the time of deposition or burial (e.g. in hillside, burial mound, or midden). This should not describe the environment as it is today (e.g. carpark), but specifically the entity or entities surrounding the sample that may have significant causal influences as it was in the past. Compared to `env_local_scale` which is taken from direct observation, the information about the past environment will normally be derived from inference from archaeological, palaeontological, geological, or other scientific methods. We recommend using EnvO terms which are of smaller than your entry for past_env_broad. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field for present day equivalents: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS\\" ;
  skos:example "hillside [ENVO:01000333]" ;
  schema:keywords "context" , "environmental" , "ancient" ;
  MIXS:Expected_value "Report information about smaller environmental entities having causal influences upon the sample or specimen at/during the time of burial" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000027 a owl:DatatypeProperty ;
  rdfs:label "known pathogenicity" ;
  rdfs:comment "To what is the entity pathogenic" ;
  skos:example "human, animal, plant, fungi, bacteria" ;
  MIXS:Expected_value "names of organisms that the entity is pathogenic to" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000049 a owl:DatatypeProperty ;
  rdfs:label "pcr conditions" ;
  rdfs:comment "Description of reaction conditions and components of polymerase chain reaction performed during library preparation." ;
  skos:example "initial denaturation:94_3;annealing:50_1;elongation:72_1.5;final elongation:72_10;35" , "initial denaturation:94degC_1.5min" ;
  schema:keywords "condition" , "pcr" ;
  MIXS:Expected_value "initial denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final elongation:degrees_minutes;total cycles" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000046 a owl:DatatypeProperty ;
  rdfs:label "pcr primers" ;
  rdfs:comment "PCR primers that were used to amplify the sequence of the targeted gene, locus or subfragment. This field should contain all the primers used for a single PCR reaction if multiple forward or reverse primers are present in a single PCR reaction. The primer sequence should be reported in uppercase letters" ;
  skos:example "FWD:GTGCCAGCMGCCGCGGTAA;REV:GGACTACHVGGGTWTCTAAT" ;
  schema:keywords "pcr" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000404 a owl:DatatypeProperty ;
  rdfs:label "permeability" ;
  rdfs:comment "Measure of the ability of a hydrocarbon resource to allow fluids to pass through it. (Additional information: https://en.wikipedia.org/wiki/Permeability_(earth_sciences))" ;
  MIXS:Expected_value "measurement value range" ;
  MIXS:Preferred_unit "mD" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001365 a owl:DatatypeProperty ;
  rdfs:label "permit authority" ;
  rdfs:comment "Name of the authorit(ies) or institution(s) that granted sampling and analysis (e.g. human remains) and/or export permission (e.g. animal remains), as well any form of ethical approval (whether from institutional research ethics boards such as REB or IRBs, or indigenous or native community associations), if available." ;
  skos:example "University of Copenhagen" , "Federal Foreign Office (Germany)" ;
  schema:keywords "ethics" , "location" ;
  skos:closeMatch dc:rightsHolder ;
  MIXS:Expected_value "Name of authority providing permission or ethical approval." ;
  rdfs:range xsd:string .

MIXS:0001366 a owl:DatatypeProperty ;
  rdfs:label "date of permit approval" ;
  rdfs:comment "Date on which a permit was granted. The date can be right truncated i.e. all of these are valid times: 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant." ;
  skos:example "2023-12-01" ;
  rdfs:range xsd:dateTime .

MIXS:0001364 a owl:DatatypeProperty ;
  rdfs:label "permit or approval ID" ;
  rdfs:comment "A permit ID, code, or any form of identify provided by any authority (ethical, local, legal, academic etc.) associated with the approval of the analysis of this particular sample, if available." ;
  skos:example "DE-123-JK" ;
  schema:keywords "ethics" ;
  rdfs:range xsd:string .

MIXS:0001367 a owl:DatatypeProperty ;
  rdfs:label "permit scope" ;
  rdfs:comment "Description of the original scope and permissions of the research on the genetic material, as was approved by a legal, ethical, or relevant authority (e.g. bacteria only, DNA only, bacteria and human, no host read analysis allowed). Note this description is only informative, and will not necessarily automatically apply restrictions to associated data to other researchers." ;
  skos:example "Defined scope only includes the study of bacterial sequences and any human sequence is not covered under the agreement." ;
  schema:keywords "ethics" ;
  skos:closeMatch dc:accessRights , dc:license ;
  MIXS:Expected_value "Description of the scope of ethical permissions for data use." ;
  rdfs:range xsd:string .

MIXS:0000754 a owl:DatatypeProperty ;
  rdfs:label "perturbation" ;
  rdfs:comment "Type of perturbation, e.g. chemical administration, physical disturbance, etc., coupled with perturbation regimen including how many times the perturbation was repeated, how long each perturbation lasted, and the start and end time of the entire perturbation period; can include multiple perturbation types" ;
  skos:example "antibiotic addition;R2/2018-05-11T14:30Z/2018-05-11T19:30Z/P1H30M" ;
  schema:keywords "perturbation" ;
  MIXS:Expected_value "perturbation type name;perturbation interval and duration" ;
  rdfs:range xsd:string .

MIXS:0000573 a owl:DatatypeProperty ;
  rdfs:label "pesticide regimen" ;
  rdfs:comment "Information about treatment involving use of insecticides; should include the name of pesticide, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple pesticide regimens" ;
  skos:example "pyrethrum;0.6 milligram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter" ;
  rdfs:range xsd:string .

MIXS:0000267 a owl:DatatypeProperty ;
  rdfs:label "presence of pets or farm animals" ;
  rdfs:comment "Specification of presence of pets or farm animals in the environment of subject, if yes the animals should be specified; can include multiple animals present" ;
  skos:example "yes; 5 cats" ;
  schema:keywords "animal" , "farm" , "presence" ;
  MIXS:Expected_value "presence status;type of animal or pet" ;
  rdfs:range xsd:string .

MIXS:0000516 a owl:DatatypeProperty ;
  rdfs:label "petroleum hydrocarbon" ;
  rdfs:comment "Concentration of petroleum hydrocarbon" ;
  skos:example "0.05 micromole per liter" ;
  schema:keywords "hydrocarbon" , "petroleum" ;
  MIXS:Preferred_unit "micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001001 a owl:DatatypeProperty ;
  rdfs:label "pH" ;
  rdfs:comment "pH measurement of the sample, or liquid portion of sample, or aqueous phase of the fluid" ;
  skos:example "7.2" ;
  schema:keywords "ph" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0001106 a owl:DatatypeProperty ;
  rdfs:label "pH method" ;
  rdfs:comment "Reference or method used in determining pH" ;
  skos:example "https://www.epa.gov/sites/production/files/2015-12/documents/9040c.pdf" ;
  schema:keywords "method" , "ph" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001056 a owl:DatatypeProperty ;
  rdfs:label "pH regimen" ;
  rdfs:comment "Information about treatment involving exposure of plants to varying levels of ph of the growth media, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimen" ;
  skos:example "7.6;R2/2018-05-11:T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "ph" , "regimen" ;
  rdfs:range xsd:string .

MIXS:0000180 a owl:DatatypeProperty ;
  rdfs:label "phaeopigments" ;
  rdfs:comment "Concentration of phaeopigments; can include multiple phaeopigments" ;
  skos:example "2.5 milligram per cubic meter" ;
  MIXS:Expected_value "phaeopigment name;measurement value" ;
  MIXS:Preferred_unit "milligram per cubic meter" ;
  rdfs:range xsd:string .

MIXS:0000505 a owl:DatatypeProperty ;
  rdfs:label "phosphate" ;
  rdfs:comment "Concentration of phosphate" ;
  skos:example "0.7 micromole per liter" ;
  schema:keywords "phosphate" ;
  MIXS:Preferred_unit "micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000181 a owl:DatatypeProperty ;
  rdfs:label "phospholipid fatty acid" ;
  rdfs:comment "Concentration of phospholipid fatty acids; can include multiple values" ;
  skos:example "2.98 milligram per liter" ;
  MIXS:Expected_value "phospholipid fatty acid name;measurement value" ;
  rdfs:range xsd:string .

MIXS:0000725 a owl:DatatypeProperty ;
  rdfs:label "photon flux" ;
  rdfs:comment "Measurement of photon flux" ;
  skos:example "3.926 micromole photons per second per square meter" ;
  MIXS:Preferred_unit "number of photons per second per unit area" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001296 a owl:DatatypeProperty ;
  rdfs:label "photosynthetic activity" ;
  rdfs:comment "Measurement of photosythetic activity (i.e. leaf gas exchange / chlorophyll fluorescence emissions / reflectance / transpiration) Please also include the term method term detailing the method of activity measurement" ;
  skos:example "0.1 mol CO2 m-2 s-1" ;
  MIXS:Preferred_unit "mol m-2 s-1" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001336 a owl:DatatypeProperty ;
  rdfs:label "photosynthetic activity method" ;
  rdfs:comment "Reference or method used in measurement of photosythetic activity" ;
  schema:keywords "method" ;
  rdfs:range xsd:string .

MIXS:plant_associated_data a owl:ObjectProperty ;
  rdfs:label "PlantAssociated data" ;
  rdfs:comment "Data that comply with Extension PlantAssociated" ;
  rdfs:range MIXS:0016010 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001057 a owl:DatatypeProperty ;
  rdfs:label "plant growth medium" ;
  rdfs:comment "Specification of the media for growing the plants or tissue cultured samples, e.g. soil, aeroponic, hydroponic, in vitro solid culture medium, in vitro liquid culture medium. Recommended value is a specific value from PECO:plant growth medium exposure (follow this link for terms http://purl.obolibrary.org/obo/PECO_0007147) or other controlled vocabulary" ;
  skos:example "hydroponic plant culture media exposure [PECO:0007067]" ;
  schema:keywords "growth" , "plant" ;
  MIXS:Expected_value "PECO or enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001120 a owl:DatatypeProperty ;
  rdfs:label "degree of plant part maturity" ;
  rdfs:comment "A description of the stage of development of a plant or plant part based on maturity or ripeness. This field accepts terms listed under degree of plant maturity (http://purl.obolibrary.org/obo/FOODON_03530050)" ;
  skos:example "ripe or mature [FOODON:03530052]" ;
  schema:keywords "degree" , "plant" ;
  MIXS:Expected_value "FOODON:03530050" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001058 a owl:DatatypeProperty ;
  rdfs:label "plant product" ;
  rdfs:comment "Substance produced by the plant, where the sample was obtained from" ;
  skos:example "xylem sap [PO:0025539]" ;
  schema:keywords "plant" , "product" ;
  MIXS:Expected_value "product name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001150 a owl:ObjectProperty ;
  rdfs:label "plant reproductive part" ;
  rdfs:comment "Plant reproductive part used in the field during planting to start the crop" ;
  skos:example "seedling" ;
  schema:keywords "plant" ;
  rdfs:range MIXS:PlantReprodCropEnum .

MIXS:0001059 a owl:ObjectProperty ;
  rdfs:label "plant sex" ;
  rdfs:comment "Sex of the reproductive parts on the whole plant, e.g. pistillate, staminate, monoecieous, hermaphrodite" ;
  skos:example "Hermaphroditic" ;
  schema:keywords "plant" ;
  rdfs:range MIXS:PlantSexEnum ;
  a owl:FunctionalProperty .

MIXS:0001060 a owl:DatatypeProperty ;
  rdfs:label "plant structure" ;
  rdfs:comment "Name of plant structure the sample was obtained from; for Plant Ontology (PO) (v releases/2017-12-14) terms, see http://purl.bioontology.org/ontology/PO, e.g. petiole epidermis (PO_0000051). If an individual flower is sampled, the sex of it can be recorded here" ;
  skos:example "epidermis [PO:0005679]" ;
  schema:keywords "plant" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001111 a owl:DatatypeProperty ;
  rdfs:label "plant water delivery method" ;
  rdfs:comment "Description of the equipment or method used to distribute water to crops. This field accepts termed listed under irrigation process (http://purl.obolibrary.org/obo/AGRO_00000006). Multiple terms can be separated by pipes" ;
  skos:example "drip irrigation process [AGRO:00000056]" ;
  schema:keywords "delivery" , "method" , "plant" , "water" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000021 a owl:DatatypeProperty ;
  rdfs:label "ploidy" ;
  rdfs:comment "The ploidy level of the genome (e.g. allopolyploid, haploid, diploid, triploid, tetraploid). It has implications for the downstream study of duplicated gene and regions of the genomes (and perhaps for difficulties in assembly). For terms, please select terms listed under class ploidy (PATO:001374) of Phenotypic Quality Ontology (PATO), and for a browser of PATO (v 2018-03-27) please refer to http://purl.bioontology.org/ontology/PATO" ;
  skos:example "allopolyploidy [PATO:0001379]" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000107 a owl:DatatypeProperty ;
  rdfs:label "pollutants" ;
  rdfs:comment "Pollutant types and, amount or concentrations measured at the time of sampling; can report multiple pollutants by entering numeric values preceded by name of pollutant" ;
  skos:example "lead;0.15 microgram per cubic meter" ;
  MIXS:Expected_value "pollutant name;measurement value" ;
  MIXS:Preferred_unit "gram, mole per liter, milligram per liter, microgram per cubic meter" ;
  rdfs:range xsd:string .

MIXS:0000325 a owl:DatatypeProperty ;
  rdfs:label "pooling of DNA extracts (if done)" ;
  rdfs:comment "Indicate whether multiple DNA extractions were mixed. If the answer yes, the number of extracts that were pooled should be given" ;
  skos:example "yes, 5" ;
  schema:keywords "dna" , "pooling" ;
  MIXS:Expected_value "pooling status;number of pooled extracts" ;
  MIXS:Preferred_unit "gram, milliliter, microliter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000211 a owl:DatatypeProperty ;
  rdfs:label "porosity" ;
  rdfs:comment "Porosity of deposited sediment is volume of voids divided by the total volume of sample" ;
  schema:keywords "porosity" ;
  MIXS:Expected_value "measurement value or range" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001322 a owl:DatatypeProperty ;
  rdfs:label "positive control type" ;
  rdfs:comment "The substance, mixture, product, or apparatus used to verify that a process which is part of an investigation delivers a true positive" ;
  schema:keywords "type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000430 a owl:DatatypeProperty ;
  rdfs:label "potassium" ;
  rdfs:comment "Concentration of potassium in the sample" ;
  skos:example "463 milligram per liter" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000127 a owl:DatatypeProperty ;
  rdfs:label "pour point" ;
  rdfs:comment "Temperature at which a liquid becomes semi solid and loses its flow characteristics. In crude oil a high pour point is generally associated with a high paraffin content, typically found in crude deriving from a larger proportion of plant material." ;
  rdfs:seeAlso <https://en.wikipedia.org/wiki/pour_point> ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000348 a owl:DatatypeProperty ;
  rdfs:label "pre-treatment" ;
  rdfs:comment "The process of pre-treatment removes materials that can be easily collected from the raw wastewater" ;
  MIXS:Expected_value "pre-treatment type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000083 a owl:ObjectProperty ;
  rdfs:label "predicted genome structure" ;
  rdfs:comment "Expected structure of the viral genome" ;
  skos:example "non-segmented" ;
  schema:keywords "predict" ;
  rdfs:range MIXS:PredGenomeStrucEnum ;
  a owl:FunctionalProperty .

MIXS:0000082 a owl:ObjectProperty ;
  rdfs:label "predicted genome type" ;
  rdfs:comment "Type of genome predicted for the UViG" ;
  skos:example "dsDNA" ;
  schema:keywords "predict" , "type" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range MIXS:ViralGenomeTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000966 a owl:DatatypeProperty ;
  rdfs:label "pregnancy" ;
  rdfs:comment "Date due of pregnancy" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0000819 a owl:DatatypeProperty ;
  rdfs:label "presence of pets, animals, or insects" ;
  rdfs:comment "The type and number of animals or insects present in the sampling space" ;
  skos:example "cat;5" ;
  schema:keywords "animal" , "presence" ;
  MIXS:Expected_value "enumeration;count" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000412 a owl:DatatypeProperty ;
  rdfs:label "pressure" ;
  rdfs:comment "Pressure to which the sample is subject to, in atmospheres" ;
  skos:example "50 atmosphere" ;
  schema:keywords "pressure" ;
  MIXS:Preferred_unit "atmosphere" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000316 a owl:DatatypeProperty ;
  rdfs:label "history/previous land use method" ;
  rdfs:comment "Reference or method used in determining previous land use and dates" ;
  schema:keywords "history" , "land" , "method" , "use" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001370 a owl:DatatypeProperty ;
  rdfs:label "previous publications" ;
  rdfs:comment "Any previous publications that report non-nucleic acid data from the same sample or ultimate source of the sample" ;
  skos:example "doi:10.1016/j.jas.2015.02.0181" ;
  rdfs:range [
    a rdfs:Datatype ;
    owl:onDatatype xsd:string ;
    owl:withRestrictions ( _:o6972 )
  ] .

_:o6972 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0000315 a owl:DatatypeProperty ;
  rdfs:label "history/previous land use" ;
  rdfs:comment "Previous land use and dates" ;
  skos:example "fallow;2018-05-11T14:30Z" ;
  schema:keywords "history" , "land" , "use" ;
  MIXS:Expected_value "land use name;date" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000728 a owl:DatatypeProperty ;
  rdfs:label "primary production" ;
  rdfs:comment "Measurement of primary production, generally measured as isotope uptake" ;
  skos:example "100 milligram per cubic meter per day" ;
  schema:keywords "primary" , "production" ;
  MIXS:Preferred_unit "milligram per cubic meter per day, gram per square meter per day" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000349 a owl:DatatypeProperty ;
  rdfs:label "primary treatment" ;
  rdfs:comment "The process to produce both a generally homogeneous liquid capable of being treated biologically and a sludge that can be separately treated or processed" ;
  schema:keywords "primary" , "treatment" ;
  MIXS:Expected_value "primary treatment type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001337 a owl:DatatypeProperty ;
  rdfs:label "production labeling claims" ;
  rdfs:comment "Labeling claims containing descriptors such as wild caught, free-range, organic, free-range, industrial, hormone-free, antibiotic free, cage free. Can include more than one term, separated by \";\"" ;
  skos:example "free range" ;
  schema:keywords "production" ;
  rdfs:range xsd:string .

MIXS:0000452 a owl:DatatypeProperty ;
  rdfs:label "production rate" ;
  rdfs:comment "Oil and/or gas production rates per well (e.g. 524 m3 / day)" ;
  schema:keywords "production" , "rate" ;
  MIXS:Preferred_unit "cubic meter per day" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001008 a owl:DatatypeProperty ;
  rdfs:label "production start date" ;
  rdfs:comment "Date of field's first production" ;
  skos:example "2013-03-25T12:42:31+01:00" ;
  schema:keywords "date" , "production" , "start" ;
  rdfs:range xsd:dateTime ;
  a owl:FunctionalProperty .

MIXS:0001084 a owl:ObjectProperty ;
  rdfs:label "profile position" ;
  rdfs:comment "Cross-sectional position in the hillslope where sample was collected.sample area position in relation to surrounding areas" ;
  skos:example "summit" ;
  rdfs:range MIXS:ProfilePositionEnum ;
  a owl:FunctionalProperty .

MIXS:0000092 a owl:DatatypeProperty ;
  rdfs:label "project name" ;
  rdfs:comment "Name of the project within which the sequencing was organized" ;
  skos:example "Forest soil metagenome" ;
  schema:keywords "project" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000033 a owl:DatatypeProperty ;
  rdfs:label "propagation" ;
  rdfs:comment "The type of reproduction from the parent stock. Values for this field is specific to different taxa. For phage or virus: lytic/lysogenic/temperate/obligately lytic. For plasmids: incompatibility group. For eukaryotes: sexual/asexual" ;
  skos:example "lytic" ;
  MIXS:Expected_value "for virus: lytic, lysogenic, temperate, obligately lytic; for plasmid: incompatibility group; for eukaryote: asexual, sexual; other more specific values (e.g., incompatibility group) are allowed" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000269 a owl:DatatypeProperty ;
  rdfs:label "lung/pulmonary disorder" ;
  rdfs:comment "History of pulmonary disorders; can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, lung disease (https://disease-ontology.org/?id=DOID:850)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000820 a owl:ObjectProperty ;
  rdfs:label "quadrant position" ;
  rdfs:comment "The quadrant position of the sampling room within the building" ;
  skos:example "West side" ;
  rdfs:range MIXS:QuadPosEnum ;
  a owl:FunctionalProperty .

MIXS:0000575 a owl:DatatypeProperty ;
  rdfs:label "radiation regimen" ;
  rdfs:comment "Information about treatment involving exposure of plant or a plant part to a particular radiation regimen; should include the radiation type, amount or intensity administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple radiation regimens" ;
  skos:example "gamma radiation;60 gray;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" ;
  MIXS:Expected_value "radiation type name;radiation amount;treatment interval and duration" ;
  MIXS:Preferred_unit "rad, gray" ;
  rdfs:range xsd:string .

MIXS:0000576 a owl:DatatypeProperty ;
  rdfs:label "rainfall regimen" ;
  rdfs:comment "Information about treatment involving an exposure to a given amount of rainfall, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens" ;
  skos:example "15 millimeter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "rain" , "regimen" ;
  MIXS:Expected_value "measurement value;treatment interval and duration" ;
  MIXS:Preferred_unit "millimeter" ;
  rdfs:range xsd:string .

MIXS:0000350 a owl:DatatypeProperty ;
  rdfs:label "reactor type" ;
  rdfs:comment "Anaerobic digesters can be designed and engineered to operate using a number of different process configurations, as batch or continuous, mesophilic, high solid or low solid, and single stage or multistage" ;
  schema:keywords "type" ;
  MIXS:Expected_value "reactor type name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001399 a owl:DatatypeProperty ;
  rdfs:label "description of reads removal" ;
  rdfs:comment "Specify whether associated data was filtered in some form prior to upload, such as host reads removal. Detailed description of the the data filtering that was carried out should be described in term 'preprocessing of sequencing reads description'." ;
  skos:example "no" , "yes" ;
  schema:keywords "data analysis" ;
  MIXS:Expected_value "Whether any sequencing reads were removed from the data files after sequencing" ;
  rdfs:range xsd:boolean ;
  a owl:FunctionalProperty .

MIXS:0001394 a owl:DatatypeProperty ;
  rdfs:label "number of reamplification cycles" ;
  rdfs:comment "Number of amplification cycles after library indexing PCR. If capture data, this refers to amplifications prior to the capture experiments." ;
  skos:example "12" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000079 a owl:DatatypeProperty ;
  rdfs:label "reassembly post binning" ;
  rdfs:comment "Has an assembly been performed on a genome bin extracted from a metagenomic assembly?" ;
  skos:example "no" ;
  schema:keywords "post" ;
  rdfs:range xsd:boolean ;
  a owl:FunctionalProperty .

MIXS:0000182 a owl:DatatypeProperty ;
  rdfs:label "redox potential" ;
  rdfs:comment "Redox potential, measured relative to a hydrogen cell, indicating oxidation or reduction potential" ;
  skos:example "300 millivolt" ;
  MIXS:Preferred_unit "millivolt" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000025 a owl:DatatypeProperty ;
  rdfs:label "reference for biomaterial" ;
  rdfs:comment "Primary publication if isolated before genome publication; otherwise, primary genome report" ;
  skos:example "doi:10.1016/j.syapm.2018.01.009" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000062 a owl:DatatypeProperty ;
  rdfs:label "reference database(s)" ;
  rdfs:comment "List of database(s) used for ORF annotation, along with version number and reference to website or publication" ;
  skos:example "pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975" ;
  schema:keywords "database" ;
  MIXS:Expected_value "names, versions, and references of databases" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000121 a owl:DatatypeProperty ;
  rdfs:label "relative air humidity" ;
  rdfs:comment "Partial vapor and air pressure, density of the vapor and air, or by the actual mass of the vapor and air" ;
  skos:note "percent or float?" ;
  skos:example "0.8" ;
  schema:keywords "air" , "humidity" , "relative" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000188 a owl:DatatypeProperty ;
  rdfs:label "outside relative humidity" ;
  rdfs:comment "The recorded outside relative humidity value at the time of sampling" ;
  skos:example "12 per kilogram of air" ;
  schema:keywords "humidity" , "relative" ;
  MIXS:Preferred_unit "gram of air, kilogram of air" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001161 a owl:DatatypeProperty ;
  rdfs:label "relative location of sample" ;
  rdfs:comment "Location of sampled soil to other parts of the farm e.g. under crop plant, near irrigation ditch, from the dirt road" ;
  skos:example "furrow" ;
  schema:keywords "location" , "relative" , "sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000821 a owl:ObjectProperty ;
  rdfs:label "relative sampling location" ;
  rdfs:comment "The sampling location within the train car" ;
  skos:example "center of car" ;
  schema:keywords "location" , "relative" ;
  rdfs:range MIXS:RelSampLocEnum ;
  a owl:FunctionalProperty .

MIXS:0000015 a owl:ObjectProperty ;
  rdfs:label "relationship to oxygen" ;
  rdfs:comment "Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic are valid descriptors for microbial environments" ;
  skos:example "aerobe" ;
  schema:keywords "oxygen" , "relationship" ;
  rdfs:range MIXS:RelToOxygenEnum ;
  a owl:FunctionalProperty .

MIXS:0001152 a owl:DatatypeProperty ;
  rdfs:label "repository name" ;
  rdfs:comment "The name of the institution where the sample or DNA extract is held or \"sample not available\" if the sample was used in its entirety for analysis or otherwise not retained" ;
  skos:example "FDA CFSAN Microbiology Laboratories" ;
  MIXS:Expected_value "Institution" ;
  rdfs:range xsd:string .

MIXS:0000303 a owl:DatatypeProperty ;
  rdfs:label "reservoir name" ;
  rdfs:comment "Name of the reservoir (e.g. Carapebus)" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000134 a owl:DatatypeProperty ;
  rdfs:label "resins wt%" ;
  rdfs:comment "Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that divides crude oil components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)" ;
  MIXS:Preferred_unit "percent" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000169 a owl:DatatypeProperty ;
  rdfs:label "room air exchange rate" ;
  rdfs:comment "The rate at which outside air replaces indoor air in a given space" ;
  schema:keywords "air" , "rate" , "room" ;
  MIXS:Preferred_unit "liter per hour" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000233 a owl:DatatypeProperty ;
  rdfs:label "room architectural elements" ;
  rdfs:comment "The unique details and component parts that, together, form the architecture of a distinguishable space within a built structure" ;
  schema:keywords "room" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000822 a owl:ObjectProperty ;
  rdfs:label "room condition" ;
  rdfs:comment "The condition of the room at the time of sampling" ;
  skos:example "new" ;
  schema:keywords "condition" , "room" ;
  rdfs:range MIXS:RoomCondtEnum ;
  a owl:FunctionalProperty .

MIXS:0000826 a owl:ObjectProperty ;
  rdfs:label "rooms connected by a doorway" ;
  rdfs:comment "List of rooms connected to the sampling room by a doorway" ;
  skos:example "office" ;
  schema:keywords "doorway" , "room" ;
  rdfs:range MIXS:RoomConnectedEnum ;
  a owl:FunctionalProperty .

MIXS:0000234 a owl:DatatypeProperty ;
  rdfs:label "room count" ;
  rdfs:comment "The total count of rooms in the built structure including all room types" ;
  schema:keywords "count" , "room" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000192 a owl:DatatypeProperty ;
  rdfs:label "room dimensions" ;
  rdfs:comment "The length, width and height of sampling room" ;
  skos:example "4 meter x 4 meter x 4 meter" ;
  schema:keywords "dimensions" , "room" ;
  MIXS:Expected_value "measurement value" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000193 a owl:DatatypeProperty ;
  rdfs:label "room door distance" ;
  rdfs:comment "Distance between doors (meters) in the hallway between the sampling room and adjacent rooms" ;
  schema:keywords "distance" , "door" , "room" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000242 a owl:DatatypeProperty ;
  rdfs:label "rooms that share a door with sampling room" ;
  rdfs:comment "List of room(s) (room number, room name) sharing a door with the sampling room" ;
  schema:keywords "door" , "room" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000238 a owl:DatatypeProperty ;
  rdfs:label "rooms that are on the same hallway" ;
  rdfs:comment "List of room(s) (room number, room name) located in the same hallway as sampling room" ;
  schema:keywords "hallway" , "room" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000823 a owl:ObjectProperty ;
  rdfs:label "room location in building" ;
  rdfs:comment "The position of the room within the building" ;
  skos:example "interior room" ;
  schema:keywords "location" , "room" ;
  rdfs:range MIXS:RoomLocEnum ;
  a owl:FunctionalProperty .

MIXS:0000235 a owl:DatatypeProperty ;
  rdfs:label "room moisture damage or mold history" ;
  rdfs:comment "The history of moisture damage or mold in the past 12 months. Number of events of moisture damage or mold observed" ;
  schema:keywords "history" , "moisture" , "room" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000194 a owl:DatatypeProperty ;
  rdfs:label "room net area" ;
  rdfs:comment "The net floor area of sampling room. Net area excludes wall thicknesses" ;
  schema:keywords "area" , "room" ;
  MIXS:Preferred_unit "square feet, square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000236 a owl:DatatypeProperty ;
  rdfs:label "room occupancy" ;
  rdfs:comment "Count of room occupancy at time of sampling" ;
  schema:keywords "room" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000824 a owl:ObjectProperty ;
  rdfs:label "room sampling position" ;
  rdfs:comment "The horizontal sampling position in the room relative to architectural elements" ;
  skos:example "south corner" ;
  schema:keywords "room" ;
  rdfs:range MIXS:RoomSampPosEnum ;
  a owl:FunctionalProperty .

MIXS:0000825 a owl:DatatypeProperty ;
  rdfs:label "room type" ;
  rdfs:comment "The main purpose or activity of the sampling room. A room is any distinguishable space within a structure" ;
  skos:example "bathroom" ;
  schema:keywords "room" , "type" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000195 a owl:DatatypeProperty ;
  rdfs:label "room volume" ;
  rdfs:comment "Volume of sampling room" ;
  schema:keywords "room" , "volume" ;
  MIXS:Preferred_unit "cubic feet, cubic meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000243 a owl:DatatypeProperty ;
  rdfs:label "rooms that share a wall with sampling room" ;
  rdfs:comment "List of room(s) (room number, room name) sharing a wall with the sampling room" ;
  schema:keywords "room" , "wall" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000237 a owl:DatatypeProperty ;
  rdfs:label "room window count" ;
  rdfs:comment "Number of windows in the room" ;
  schema:keywords "count" , "room" , "window" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0001061 a owl:DatatypeProperty ;
  rdfs:label "rooting conditions" ;
  rdfs:comment "Relevant rooting conditions such as field plot size, sowing density, container dimensions, number of plants per container" ;
  skos:example "http://himedialabs.com/TD/PT158.pdf" ;
  schema:keywords "condition" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000577 a owl:DatatypeProperty ;
  rdfs:label "rooting medium carbon" ;
  rdfs:comment "Source of organic carbon in the culture rooting medium; e.g. sucrose" ;
  skos:example "sucrose" ;
  schema:keywords "carbon" ;
  MIXS:Expected_value "carbon source name;measurement value" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000578 a owl:DatatypeProperty ;
  rdfs:label "rooting medium macronutrients" ;
  rdfs:comment "Measurement of the culture rooting medium macronutrients (N,P, K, Ca, Mg, S); e.g. KH2PO4 (170 mg/L)" ;
  skos:example "KH2PO4;170  milligram per liter" ;
  schema:keywords "macronutrients" ;
  MIXS:Expected_value "macronutrient name;measurement value" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000579 a owl:DatatypeProperty ;
  rdfs:label "rooting medium micronutrients" ;
  rdfs:comment "Measurement of the culture rooting medium micronutrients (Fe, Mn, Zn, B, Cu, Mo); e.g. H3BO3 (6.2 mg/L)" ;
  skos:example "H3BO3;6.2  milligram per liter" ;
  schema:keywords "micronutrients" ;
  MIXS:Expected_value "micronutrient name;measurement value" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001062 a owl:DatatypeProperty ;
  rdfs:label "rooting medium pH" ;
  rdfs:comment "pH measurement of the culture rooting medium; e.g. 5.5" ;
  skos:example "7.5" ;
  schema:keywords "ph" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000581 a owl:DatatypeProperty ;
  rdfs:label "rooting medium regulators" ;
  rdfs:comment "Growth regulators in the culture rooting medium such as cytokinins, auxins, gybberellins, abscisic acid; e.g. 0.5  mg/L NAA" ;
  skos:example "abscisic acid;0.75 milligram per liter" ;
  MIXS:Expected_value "regulator name;measurement value" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001063 a owl:DatatypeProperty ;
  rdfs:label "rooting medium solidifier" ;
  rdfs:comment "Specification of the solidifying agent in the culture rooting medium; e.g. agar" ;
  skos:example "agar" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000580 a owl:DatatypeProperty ;
  rdfs:label "rooting medium organic supplements" ;
  rdfs:comment "Organic supplements of the culture rooting medium, such as vitamins, amino acids, organic acids, antibiotics activated charcoal; e.g. nicotinic acid (0.5  mg/L)" ;
  skos:example "nicotinic acid;0.5 milligram per liter" ;
  schema:keywords "organic" ;
  MIXS:Expected_value "supplement name;measurement value" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001316 a owl:ObjectProperty ;
  rdfs:label "route of transmission" ;
  rdfs:comment "Description of path taken by the symbiotic host organism being sampled in order to establish a symbiotic relationship with the host (with which it was observed at the time of sampling) via a mode of transmission (specified in mode_transmission)" ;
  schema:keywords "route" ;
  rdfs:range MIXS:RouteTransmissionEnum ;
  a owl:FunctionalProperty .

MIXS:0000183 a owl:DatatypeProperty ;
  rdfs:label "salinity" ;
  rdfs:comment "The total concentration of all dissolved salts in a liquid or solid sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater" ;
  skos:example "25 practical salinity unit" ;
  schema:keywords "salinity" ;
  MIXS:Preferred_unit "practical salinity unit, percentage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000582 a owl:DatatypeProperty ;
  rdfs:label "salt regimen" ;
  rdfs:comment "Information about treatment involving use of salts as supplement to liquid and soil growth media; should include the name of salt, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple salt regimens" ;
  skos:example "NaCl;5 gram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" , "salt" ;
  MIXS:Preferred_unit "gram, microgram, mole per liter, gram per liter" ;
  rdfs:range xsd:string .

MIXS:0001369 a owl:DatatypeProperty ;
  rdfs:label "alternative sample IDs" ;
  rdfs:comment "An alternative sample or material ID related to the sample not already covered by terms samp_name and source_mat_id, including from associated other non-genetic analyses of the same sample, that can be used synonymously with the main ID. For example: external database IDs, internal lab sample ID from sampling such as bone drilling, or IDs from other scientific analyses. Can be specified multiple times for different ID contexts." ;
  skos:example "ABC_24" , "Grave 6" , "Museum ID: NHM_AR_123, Drilling ID: DRL_001, Extraction ID: ABC_24" ;
  rdfs:range xsd:string .

MIXS:0000860 a owl:ObjectProperty ;
  rdfs:label "sample capture status" ;
  rdfs:comment "Reason for the sample" ;
  skos:example "farm sample" ;
  schema:keywords "sample" , "status" ;
  rdfs:range MIXS:SampCaptStatusEnum ;
  a owl:FunctionalProperty .

MIXS:0001383 a owl:ObjectProperty ;
  rdfs:label "sample category" ;
  rdfs:comment "The type/category of a sample. \"Sample\" includes biological and technical replicates." ;
  skos:example "sample" , "negative control" , "positive control" ;
  schema:keywords "control" ;
  rdfs:range MIXS:SampCategoryEnum ;
  a owl:FunctionalProperty .

MIXS:0000002 a owl:DatatypeProperty ;
  rdfs:label "sample collection device" ;
  rdfs:comment "The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094)" ;
  schema:keywords "device" , "sample" ;
  MIXS:Expected_value "device name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001225 a owl:DatatypeProperty ;
  rdfs:label "sample collection method" ;
  rdfs:comment "The method employed for collecting the sample" ;
  schema:keywords "method" , "sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001015 a owl:ObjectProperty ;
  rdfs:label "sample collection point" ;
  rdfs:comment "Sampling point on the asset were sample was collected (e.g. Wellhead, storage tank, separator, etc). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "well" ;
  schema:keywords "sample" ;
  rdfs:range MIXS:SampCollectPointEnum ;
  a owl:FunctionalProperty .

MIXS:0001384 a owl:DatatypeProperty ;
  rdfs:label "sample decontamination pretreatment" ;
  rdfs:comment "Protocols employed for sample surface decontamination of external  modern nucleic acids; Treatment used on the samples immediately prior to nucleic acid extraction. Dependant on the sample type.  More relevant for bones than environmental samples. E.g. buffers, EDTA, etc." ;
  skos:example "doi:10.1016/j.jas.2015.02.0181" ;
  rdfs:range [
    a rdfs:Datatype ;
    owl:onDatatype xsd:string ;
    owl:withRestrictions ( _:o6974 )
  ] .

_:o6974 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0000249 a owl:ObjectProperty ;
  rdfs:label "sample disease stage" ;
  rdfs:comment "Stage of the disease at the time of sample collection, e.g. inoculation, penetration, infection, growth and reproduction, dissemination of pathogen" ;
  skos:example "infection" ;
  schema:keywords "disease" , "sample" ;
  rdfs:range MIXS:SampDisStageEnum ;
  a owl:FunctionalProperty .

MIXS:0001352 a owl:DatatypeProperty ;
  rdfs:label "sample dna concentration" ;
  rdfs:comment "DNA concentration of sample after dna extraction prior to pooling. Typically measured spectrophotometrically or with a fluorophore." ;
  skos:note "Unit is nanograms per microliter" ;
  skos:example "15.1 ng/uL" ;
  MIXS:Preferred_unit "ng/uL" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000828 a owl:DatatypeProperty ;
  rdfs:label "sampling floor" ;
  rdfs:comment "The floor of the building, where the sampling room is located" ;
  skos:example "4th floor" ;
  schema:keywords "floor" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range [
    a rdfs:Datatype ;
    owl:onDatatype xsd:string ;
    owl:withRestrictions ( _:o6976 )
  ] ;
  a owl:FunctionalProperty .

_:o6976 xsd:pattern "(?:(?:\\d*1[1-3]th|\\d*1st|\\d*2nd|\\d*3rd|\\d*[04-9]th) floor|basement|lobby)" .

MIXS:0001257 a owl:ObjectProperty ;
  rdfs:label "sample location condition" ;
  rdfs:comment "The condition of the sample location at the time of sampling" ;
  skos:example "new" ;
  schema:keywords "condition" , "location" , "sample" ;
  rdfs:range MIXS:SampLocConditionEnum ;
  a owl:FunctionalProperty .

MIXS:0000136 a owl:DatatypeProperty ;
  rdfs:label "corrosion rate at sample location" ;
  rdfs:comment "Metal corrosion rate is the speed of metal deterioration due to environmental conditions. As environmental conditions change corrosion rates change accordingly. Therefore, long term corrosion rates are generally more informative than short term rates and for that reason they are preferred during reporting. In the case of suspected MIC, corrosion rate measurements at the time of sampling might provide insights into the involvement of certain microbial community members in MIC as well as potential microbial interplays" ;
  schema:keywords "location" , "rate" , "sample" ;
  MIXS:Preferred_unit "millimeter per year" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000016 a owl:DatatypeProperty ;
  rdfs:label "sample material processing" ;
  rdfs:comment "A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed" ;
  skos:example "filtering of seawater, storing samples in ethanol" ;
  schema:keywords "material" , "process" , "sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000413 a owl:DatatypeProperty ;
  rdfs:label "sample measured depth" ;
  rdfs:comment "In non deviated well, measured depth is equal to the true vertical depth, TVD (TVD=TVDSS plus the reference or datum it refers to). In deviated wells, the MD is the length of trajectory of the borehole measured from the same reference or datum. Common datums used are ground level (GL), drilling rig floor (DF), rotary table (RT), kelly bushing (KB) and mean sea level (MSL). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "1534 meter;MSL" ;
  schema:keywords "depth" , "measurement" , "sample" ;
  MIXS:Expected_value "measurement value;enumeration" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001107 a owl:DatatypeProperty ;
  rdfs:label "sample name" ;
  rdfs:comment "A local identifier or name that for the material sample used for extracting nucleic acids, and subsequent sequencing. It can refer either to the original material collected or to any derived sub-samples. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. INSDC requires every sample name from a single Submitter to be unique. Use of a globally unique identifier for the field source_mat_id is recommended in addition to sample_name" ;
  skos:example "ISDsoil1" ;
  schema:keywords "sample" ;
  MIXS:Preferred_unit "" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001153 a owl:DatatypeProperty ;
  rdfs:label "sample pooling" ;
  rdfs:comment "Physical combination of several instances of like material, e.g. RNA extracted from samples or dishes of cell cultures into one big aliquot of cells. Please provide a short description of the samples that were pooled" ;
  skos:example "5uL of extracted genomic DNA from 5 leaves were pooled" ;
  schema:keywords "pooling" , "sample" ;
  rdfs:range xsd:string .

MIXS:0000463 a owl:DatatypeProperty ;
  rdfs:label "preservative added to sample" ;
  rdfs:comment "Preservative added to the sample (e.g. Rnalater, alcohol, formaldehyde, etc.). Where appropriate include volume added (e.g. Rnalater; 2 ml)" ;
  schema:keywords "sample" ;
  MIXS:Preferred_unit "milliliter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001372 a owl:DatatypeProperty ;
  rdfs:label "preservational treatment" ;
  rdfs:comment "Description of any treatment applied directly to samples for the specific purpose of  maximising longevity of sample preservation in archives and/or collections by curators  that may influence downstream nucleic acid recovery or library construction, such as storage fluid or  reconstructive glue." ;
  skos:example "stored in formalin" , "reconstructive glue applied" , "alcohol preserved" ;
  schema:keywords "ancient" ;
  rdfs:range xsd:string .

MIXS:0001151 a owl:DatatypeProperty ;
  rdfs:label "purpose of sampling" ;
  rdfs:comment "The reason that the sample was collected" ;
  skos:example "field trial" ;
  schema:keywords "purpose" ;
  MIXS:Expected_value "enumeration or {text}" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001226 a owl:DatatypeProperty ;
  rdfs:label "biological sample replicate" ;
  rdfs:comment "Measurements of biologically distinct samples that show biological variation" ;
  skos:example "6 replicates" ;
  schema:keywords "sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001227 a owl:DatatypeProperty ;
  rdfs:label "technical sample replicate" ;
  rdfs:comment "Repeated measurements of the same sample that show independent measures of the noise associated with the equipment and the protocols" ;
  skos:example "10 replicates" ;
  schema:keywords "sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000244 a owl:DatatypeProperty ;
  rdfs:label "sampling room ID or name" ;
  rdfs:comment "Sampling room number. This ID should be consistent with the designations on the building floor plans" ;
  schema:keywords "identifier" , "room" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000001 a owl:DatatypeProperty ;
  rdfs:label "amount or size of sample collected" ;
  rdfs:comment "The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected" ;
  skos:example "5 liter" ;
  schema:keywords "sample" , "size" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000216 a owl:DatatypeProperty ;
  rdfs:label "sample size sorting method" ;
  rdfs:comment "Method by which samples are sorted; open face filter collecting total suspended particles, prefilter to remove particles larger than X micrometers in diameter, where common values of X would be 10 and 2.5 full size sorting in a cascade impactor" ;
  schema:keywords "method" , "sample" , "size" ;
  rdfs:range xsd:string .

MIXS:0001154 a owl:DatatypeProperty ;
  rdfs:label "sample source material category" ;
  rdfs:comment "This is the scientific role or category that the subject organism or material has with respect to an investigation.  This field accepts terms listed under specimen source material category (http://purl.obolibrary.org/obo/GENEPIO_0001237 or http://purl.obolibrary.org/obo/OBI_0100051)" ;
  skos:example "environmental (swab or sampling) [GENEPIO:0001732]" ;
  schema:keywords "material" , "sample" , "source" ;
  MIXS:Expected_value "GENEPIO:0001237" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001228 a owl:DatatypeProperty ;
  rdfs:label "sample storage device" ;
  rdfs:comment "The container used to store the  sample. This field accepts terms listed under container (http://purl.obolibrary.org/obo/NCIT_C43186). If the proper descriptor is not listed please use text to describe the storage device" ;
  skos:example "Whirl Pak sampling bag [GENEPIO:0002122]" ;
  schema:keywords "device" , "sample" , "storage" ;
  MIXS:Expected_value "NCIT:C4318" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001229 a owl:DatatypeProperty ;
  rdfs:label "sample storage media" ;
  rdfs:comment "The liquid that is added to the sample collection device prior to sampling. If the sample is pre-hydrated, indicate the liquid media the sample is pre-hydrated with for storage purposes. This field accepts terms listed under microbiological culture medium (http://purl.obolibrary.org/obo/MICRO_0000067). If the proper descriptor is not listed please use text to describe the sample storage media" ;
  skos:example "peptone water medium [MICRO:0000548]" ;
  schema:keywords "sample" , "storage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000116 a owl:DatatypeProperty ;
  rdfs:label "sample storage duration" ;
  rdfs:comment "Duration for which the sample was stored. Indicate the duration for which the sample was stored written in ISO 8601 format" ;
  skos:example "P1Y6M" ;
  schema:keywords "duration" , "period" , "sample" , "storage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000755 a owl:DatatypeProperty ;
  rdfs:label "sample storage location" ;
  rdfs:comment "Location at which sample was stored, usually name of a specific freezer/room" ;
  skos:example "Freezer no:5" ;
  schema:keywords "location" , "sample" , "storage" ;
  MIXS:Expected_value "location name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001317 a owl:DatatypeProperty ;
  rdfs:label "sample storage solution" ;
  rdfs:comment "Solution within which sample was stored, if any" ;
  skos:example "5% ethanol" ;
  schema:keywords "sample" , "storage" ;
  MIXS:Expected_value "solution name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000110 a owl:DatatypeProperty ;
  rdfs:label "sample storage temperature" ;
  rdfs:comment "Temperature at which sample was stored, e.g. -80 degree Celsius" ;
  skos:example "-80 degree Celsius" ;
  schema:keywords "sample" , "storage" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000999 a owl:ObjectProperty ;
  rdfs:label "sample subtype" ;
  rdfs:comment "Name of sample sub-type. For example if \"sample type\" is \"Produced Water\" then subtype could be \"Oil Phase\" or \"Water Phase\". If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "biofilm" ;
  schema:keywords "sample" ;
  rdfs:range MIXS:SampSubtypeEnum ;
  a owl:FunctionalProperty .

MIXS:0001256 a owl:ObjectProperty ;
  rdfs:label "sample surface moisture" ;
  rdfs:comment "Degree of water held on a sampled surface.  If present, user can state the degree of water held on surface (intermittent moisture, submerged). If no surface moisture is present indicate not present" ;
  skos:example "submerged" ;
  schema:keywords "moisture" , "sample" , "surface" ;
  rdfs:range MIXS:SampSurfMoistureEnum .

MIXS:0001320 a owl:DatatypeProperty ;
  rdfs:label "taxonomy ID of DNA sample" ;
  rdfs:comment "NCBI taxon id of the sample.  Maybe be a single taxon or mixed taxa sample. Use 'synthetic metagenome  for mock community/positive controls, or 'blank sample' for negative controls" ;
  skos:example "Gut Metagenome [NCBITaxon:749906]" ;
  schema:keywords "dna" , "identifier" , "sample" , "taxon" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000196 a owl:DatatypeProperty ;
  rdfs:label "sampling time outside" ;
  rdfs:comment "The recent and long term history of outside sampling" ;
  schema:keywords "time" ;
  MIXS:Expected_value "time" ;
  MIXS:Preferred_unit "hour" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000410 a owl:DatatypeProperty ;
  rdfs:label "sample transport conditions" ;
  rdfs:comment "Sample transport duration (in days or hrs) and temperature the sample was exposed to (e.g. 5.5 days; 20   C)" ;
  skos:example "5 days;-20 degree Celsius" ;
  schema:keywords "condition" , "sample" , "transport" ;
  MIXS:Expected_value "measurement value;measurement value" ;
  MIXS:Preferred_unit "days;degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001230 a owl:ObjectProperty ;
  rdfs:label "sample transport container" ;
  rdfs:comment "Container in which the sample was stored during transport. Indicate the location name" ;
  skos:example "cooler" ;
  schema:keywords "sample" , "transport" ;
  rdfs:range MIXS:SampTransportContEnum ;
  a owl:FunctionalProperty .

MIXS:0001231 a owl:DatatypeProperty ;
  rdfs:label "sample transport duration" ;
  rdfs:comment "The duration of time from when the sample was collected until processed. Indicate the duration for which the sample was stored written in ISO 8601 format" ;
  skos:example "P10D" ;
  schema:keywords "duration" , "period" , "sample" , "transport" ;
  MIXS:Preferred_unit "days" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001232 a owl:DatatypeProperty ;
  rdfs:label "sample transport temperature" ;
  rdfs:comment "Temperature at which sample was transported, e.g. -20 or 4 degree Celsius" ;
  skos:example "4 degree Celsius" ;
  schema:keywords "sample" , "temperature" , "transport" ;
  MIXS:Expected_value "text or measurement value" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000409 a owl:DatatypeProperty ;
  rdfs:label "sample true vertical depth subsea" ;
  rdfs:comment "Depth of the sample i.e. The vertical distance between the sea level and the sampled position in the subsurface. Depth can be reported as an interval for subsurface samples e.g. 1325.75-1362.25 m" ;
  schema:keywords "depth" , "sample" ;
  MIXS:Expected_value "measurement value or measurement value range" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000998 a owl:DatatypeProperty ;
  rdfs:label "sample type" ;
  rdfs:comment "The type of material from which the sample was obtained. For the Hydrocarbon package, samples include types like core, rock trimmings, drill cuttings, piping section, coupon, pigging debris, solid deposit, produced fluid, produced water, injected water, swabs, etc. For the Food Package, samples are usually categorized as food, body products or tissues, or environmental material. This field accepts terms listed under environmental specimen (http://purl.obolibrary.org/obo/GENEPIO_0001246)" ;
  skos:example "built environment sample [GENEPIO:0001248]" ;
  schema:keywords "sample" , "type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000111 a owl:DatatypeProperty ;
  rdfs:label "sample volume or weight for DNA extraction" ;
  rdfs:comment "Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001)" ;
  skos:example "1500 milliliter" ;
  schema:keywords "dna" , "sample" , "volume" , "weight" ;
  MIXS:Preferred_unit "milliliter, gram, milligram, square centimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000827 a owl:ObjectProperty ;
  rdfs:label "sampling day weather" ;
  rdfs:comment "The weather on the sampling day" ;
  skos:example "foggy" ;
  schema:keywords "day" , "weather" ;
  rdfs:range MIXS:SampWeatherEnum ;
  a owl:FunctionalProperty .

MIXS:0000296 a owl:DatatypeProperty ;
  rdfs:label "sample well name" ;
  rdfs:comment "Name of the well (e.g. BXA1123) where sample was taken" ;
  schema:keywords "sample" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000131 a owl:DatatypeProperty ;
  rdfs:label "saturates wt%" ;
  rdfs:comment "Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that divides crude oil components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)" ;
  MIXS:Preferred_unit "percent" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000076 a owl:ObjectProperty ;
  rdfs:label "single cell or viral particle lysis approach" ;
  rdfs:comment "Method used to free DNA from interior of the cell(s) or particle(s)" ;
  skos:example "enzymatic" ;
  schema:keywords "particle" , "single" ;
  rdfs:range MIXS:ScLysisApproachEnum ;
  a owl:FunctionalProperty .

MIXS:0000054 a owl:DatatypeProperty ;
  rdfs:label "single cell or viral particle lysis kit protocol" ;
  rdfs:comment "Name of the kit or standard protocol used for cell(s) or particle(s) lysis" ;
  skos:example "ambion single cell lysis kit" ;
  schema:keywords "kit" , "particle" , "protocol" , "single" ;
  MIXS:Expected_value "kit, protocol name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000829 a owl:ObjectProperty ;
  rdfs:label "season" ;
  rdfs:comment "The season when sampling occurred. Any of the four periods into which the year is divided by the equinoxes and solstices." ;
  skos:example "autumn [NCIT:C94733]" ;
  schema:keywords "season" ;
  rdfs:range MIXS:SeasonEnum ;
  a owl:FunctionalProperty .

MIXS:0001068 a owl:DatatypeProperty ;
  rdfs:label "seasonal environment" ;
  rdfs:comment "Treatment involving an exposure to a particular season (e.g. Winter, summer, rabi, rainy etc.), treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment" ;
  skos:example "rainy;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "environment" , "season" ;
  rdfs:range xsd:string .

MIXS:0001148 a owl:DatatypeProperty ;
  rdfs:label "mean seasonal humidity" ;
  rdfs:comment "Average humidity of the region throughout the growing season" ;
  skos:note "percent or float?" ;
  skos:example "0.25" ;
  schema:keywords "humidity" , "mean" , "season" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000645 a owl:DatatypeProperty ;
  rdfs:label "mean seasonal precipitation" ;
  rdfs:comment "The average of all seasonal precipitation values known, or an estimated equivalent value derived by such methods as regional indexes or Isohyetal maps" ;
  skos:example "75 millimeters" ;
  schema:keywords "mean" , "season" ;
  MIXS:Preferred_unit "millimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000643 a owl:DatatypeProperty ;
  rdfs:label "mean seasonal temperature" ;
  rdfs:comment "Mean seasonal temperature" ;
  skos:note "this slot should not be populated unless season is also populated" ;
  skos:example "18 degree Celsius" ;
  schema:keywords "mean" , "season" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000830 a owl:ObjectProperty ;
  rdfs:label "seasonal use" ;
  rdfs:comment "The seasons the space is occupied" ;
  skos:example "Winter" ;
  schema:keywords "season" , "use" ;
  rdfs:range MIXS:SeasonUseEnum ;
  a owl:FunctionalProperty .

MIXS:0000351 a owl:DatatypeProperty ;
  rdfs:label "secondary treatment" ;
  rdfs:comment "The process for substantially degrading the biological content of the sewage" ;
  schema:keywords "secondary" , "treatment" ;
  MIXS:Expected_value "secondary treatment type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:sediment_data a owl:ObjectProperty ;
  rdfs:label "Sediment data" ;
  rdfs:comment "Data that comply with Extension Sediment" ;
  schema:keywords "sediment" ;
  rdfs:range MIXS:0016011 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001078 a owl:ObjectProperty ;
  rdfs:label "sediment type" ;
  rdfs:comment "Information about the sediment type based on major constituents" ;
  skos:example "biogenous" ;
  schema:keywords "sediment" , "type" ;
  rdfs:range MIXS:SedimentTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000050 a owl:DatatypeProperty ;
  rdfs:label "sequencing method" ;
  rdfs:comment "Sequencing machine used. Where possible the term should be taken from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103)" ;
  skos:example "454 Genome Sequencer FLX [OBI:0000702]" ;
  schema:keywords "method" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000051 a owl:ObjectProperty ;
  rdfs:label "sequence quality check" ;
  rdfs:comment "Indicate if the sequence has been called by automatic systems (none) or undergone a manual editing procedure (e.g. by inspecting the raw data or chromatograms). Applied only for sequences that are not submitted to SRA,ENA or DRA" ;
  skos:example "none" ;
  schema:keywords "quality" ;
  MIXS:Expected_value "none or manually edited" ;
  rdfs:range MIXS:SeqQualityCheckEnum ;
  a owl:FunctionalProperty .

MIXS:0001155 a owl:DatatypeProperty ;
  rdfs:label "sequencing kit" ;
  rdfs:comment "Pre-filled, ready-to-use reagent cartridges. Used to produce improved chemistry, cluster density and read length as well as improve quality (Q) scores. Reagent components are encoded to interact with the sequencing system to validate compatibility with user-defined applications. Indicate name of the sequencing kit" ;
  skos:example "NextSeq 500/550 High Output Kit v2.5 (75 Cycles)" ;
  schema:keywords "kit" ;
  MIXS:Expected_value "name of sequencing kit used" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001156 a owl:DatatypeProperty ;
  rdfs:label "sequencing location" ;
  rdfs:comment "The location the sequencing run was performed. Indicate the name of the lab or core facility where samples were sequenced" ;
  skos:example "University of Maryland Genomics Resource Center" ;
  schema:keywords "location" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001157 a owl:DatatypeProperty ;
  rdfs:label "serovar or serotype" ;
  rdfs:comment "A characterization of a cell or microorganism based on the antigenic properties of the molecules on its surface. Indicate the name of a serovar or serotype of interest. This field accepts terms under organism (http://purl.obolibrary.org/obo/NCIT_C14250). This field also accepts identification numbers from NCBI under https://www.ncbi.nlm.nih.gov/taxonomy" ;
  skos:example "Escherichia coli strain O157:H7 [NCIT:C86883]" ;
  rdfs:range xsd:string .

MIXS:0000215 a owl:DatatypeProperty ;
  rdfs:label "sewage type" ;
  rdfs:comment "Type of wastewater treatment plant as municipial or industrial" ;
  schema:keywords "type" ;
  MIXS:Expected_value "sewage type name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000285 a owl:DatatypeProperty ;
  rdfs:label "sexual activity" ;
  rdfs:comment "Current sexual partner and frequency of sex" ;
  MIXS:Expected_value "partner sex;frequency" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000834 a owl:ObjectProperty ;
  rdfs:label "shading device signs of water/mold" ;
  rdfs:comment "Signs of the presence of mold or mildew on the shading device" ;
  skos:example "no presence of mold visible" ;
  schema:keywords "device" ;
  rdfs:range MIXS:MoldVisibilityEnum ;
  a owl:FunctionalProperty .

MIXS:0000831 a owl:ObjectProperty ;
  rdfs:label "shading device condition" ;
  rdfs:comment "The physical condition of the shading device at the time of sampling" ;
  skos:example "new" ;
  schema:keywords "condition" , "device" ;
  rdfs:range MIXS:DamagedRupturedEnum ;
  a owl:FunctionalProperty .

MIXS:0000832 a owl:ObjectProperty ;
  rdfs:label "shading device location" ;
  rdfs:comment "The location of the shading device in relation to the built structure" ;
  skos:example "exterior" ;
  schema:keywords "device" , "location" ;
  rdfs:range MIXS:ShadingDeviceLocEnum ;
  a owl:FunctionalProperty .

MIXS:0000245 a owl:DatatypeProperty ;
  rdfs:label "shading device material" ;
  rdfs:comment "The material the shading device is composed of" ;
  schema:keywords "device" , "material" ;
  MIXS:Expected_value "material name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000835 a owl:ObjectProperty ;
  rdfs:label "shading device type" ;
  rdfs:comment "The type of shading device" ;
  skos:example "slatted aluminum" ;
  schema:keywords "device" , "type" ;
  rdfs:range MIXS:ShadingDeviceTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000322 a owl:DatatypeProperty ;
  rdfs:label "sieving" ;
  rdfs:comment "Collection design of pooled samples and/or sieve size and amount of sample sieved" ;
  MIXS:Expected_value "design name and/or size;amount" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000184 a owl:DatatypeProperty ;
  rdfs:label "silicate" ;
  rdfs:comment "Concentration of silicate" ;
  skos:example "0.05 micromole per liter" ;
  MIXS:Preferred_unit "micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000063 a owl:DatatypeProperty ;
  rdfs:label "similarity search method" ;
  rdfs:comment "Tool used to compare ORFs with database, along with version and cutoffs used" ;
  skos:example "HMMER3;3.1b2;hmmsearch, cutoff of 50 on score" ;
  schema:keywords "method" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001345 a owl:DatatypeProperty ;
  rdfs:label "method for SIP fractionating" ;
  rdfs:comment "Method used to fractionate nucleic acids." ;
  skos:example "https://doi.org/10.1038/s41396-018-0279-6" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000017 a owl:DatatypeProperty ;
  rdfs:label "size fraction selected" ;
  rdfs:comment "Filtering pore size used in sample preparation" ;
  skos:example "0-0.22 micrometer" ;
  schema:keywords "fraction" , "size" ;
  MIXS:Expected_value "filter size value range" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000735 a owl:DatatypeProperty ;
  rdfs:label "size-fraction lower threshold" ;
  rdfs:comment "Refers to the mesh/pore size used to pre-filter/pre-sort the sample. Materials smaller than the size threshold are excluded from the sample" ;
  skos:example "0.2 micrometer" ;
  schema:keywords "lower" ;
  MIXS:Preferred_unit "micrometer" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000736 a owl:DatatypeProperty ;
  rdfs:label "size-fraction upper threshold" ;
  rdfs:comment "Mesh or pore size of the device used to retain the sample. Materials larger than the size threshold are excluded from the sample." ;
  skos:example "20 micrometer" ;
  schema:keywords "upper" ;
  MIXS:Preferred_unit "micrometer" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000647 a owl:DatatypeProperty ;
  rdfs:label "slope aspect" ;
  rdfs:comment "The direction a slope faces. While looking down a slope use a compass to record the direction you are facing (direction or degrees); e.g., nw or 315 degrees. This measure provides an indication of sun and wind exposure that will influence soil temperature and evapotranspiration" ;
  schema:keywords "slope" ;
  MIXS:Preferred_unit "degree" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000646 a owl:DatatypeProperty ;
  rdfs:label "slope gradient" ;
  rdfs:comment "Commonly called 'slope'. The angle between ground surface and a horizontal line (in percent). This is the direction that overland water would flow. This measure is usually taken with a hand level meter or clinometer" ;
  schema:keywords "slope" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000669 a owl:DatatypeProperty ;
  rdfs:label "sludge retention time" ;
  rdfs:comment "The time activated sludge remains in reactor" ;
  schema:keywords "time" ;
  MIXS:Preferred_unit "hours" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000262 a owl:DatatypeProperty ;
  rdfs:label "smoker" ;
  rdfs:comment "Specification of smoking status" ;
  skos:example "yes" ;
  rdfs:range xsd:boolean ;
  a owl:FunctionalProperty .

MIXS:0000428 a owl:DatatypeProperty ;
  rdfs:label "sodium" ;
  rdfs:comment "Sodium concentration in the sample" ;
  skos:example "10.5 milligram per liter" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001158 a owl:DatatypeProperty ;
  rdfs:label "soil conductivity" ;
  rdfs:comment "Conductivity of some soil." ;
  skos:note "Soil electrical conductivity (EC) is a measure of how well soil water can carry an electrical current. Electrical conductivity of soil solution is a reliable indicator of its solute (cation or anion) concentration with 1 dS/m approximately equivalent to 10 meq/L (U.S. Salinity Laboratory Staff, 1954)." ;
  skos:example "10 milliSiemens per centimeter" ;
  schema:keywords "soil" ;
  MIXS:Preferred_unit "milliSiemens per centimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001159 a owl:DatatypeProperty ;
  rdfs:label "soil cover" ;
  rdfs:comment "Material covering the sampled soil. This field accepts terms under ENVO:00010483, environmental material" ;
  skos:example "bare soil [ENVO01001616]" ;
  schema:keywords "soil" ;
  MIXS:Expected_value "subclass of 'environmental material', http://purl.obolibrary.org/obo/ENVO_00010483" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:soil_data a owl:ObjectProperty ;
  rdfs:label "Soil data" ;
  rdfs:comment "Data that comply with Extension Soil" ;
  schema:keywords "soil" ;
  rdfs:range MIXS:0016012 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001082 a owl:ObjectProperty ;
  rdfs:label "soil horizon" ;
  rdfs:comment "Specific layer in the land area which measures parallel to the soil surface and possesses physical characteristics which differ from the layers above and beneath" ;
  skos:example "A horizon" ;
  schema:keywords "horizon" , "soil" ;
  rdfs:range MIXS:SoilHorizonEnum ;
  a owl:FunctionalProperty .

MIXS:0001160 a owl:DatatypeProperty ;
  rdfs:label "soil pH" ;
  rdfs:comment "pH measurement of some soil at the time of sampling" ;
  skos:example "7.2" ;
  schema:keywords "ph" , "soil" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0001162 a owl:DatatypeProperty ;
  rdfs:label "soil sediment porosity" ;
  rdfs:comment "Porosity of soil or deposited sediment is volume of voids divided by the total volume of sample" ;
  skos:example "0.2" ;
  schema:keywords "porosity" , "sediment" , "soil" ;
  MIXS:Expected_value "percent porosity" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001163 a owl:DatatypeProperty ;
  rdfs:label "soil temperature" ;
  rdfs:comment "Temperature of soil at the time of sampling" ;
  skos:example "25 degrees Celsius" ;
  schema:keywords "soil" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000335 a owl:DatatypeProperty ;
  rdfs:label "soil texture" ;
  rdfs:comment "The relative proportion of different grain sizes of mineral particles in a soil, as described using a standard system; express as % sand (50 um to 2 mm), silt (2 um to 50 um), and clay (<2 um) with textural name (e.g., silty clay loam) optional" ;
  schema:keywords "soil" , "texture" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001164 a owl:ObjectProperty ;
  rdfs:label "soil texture classification" ;
  rdfs:comment "One of the 12 soil texture classes use to describe soil texture based on the relative proportion of different grain sizes  of mineral particles [sand (50 um to 2 mm), silt (2 um to 50 um), and clay (<2 um)] in a soil" ;
  skos:example "silty clay loam" ;
  schema:keywords "classification" , "soil" , "texture" ;
  rdfs:range MIXS:SoilTextureClassEnum ;
  a owl:FunctionalProperty .

MIXS:0000336 a owl:DatatypeProperty ;
  rdfs:label "soil texture method" ;
  rdfs:comment "Reference or method used in determining soil texture" ;
  skos:example "https://uwlab.soils.wisc.edu/wp-content/uploads/sites/17/2015/09/particle_size.pdf" ;
  schema:keywords "method" , "soil" , "texture" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000332 a owl:DatatypeProperty ;
  rdfs:label "soil type" ;
  rdfs:comment "Description of the soil type or classification. This field accepts terms under soil (http://purl.obolibrary.org/obo/ENVO_00001998).  Multiple terms can be separated by pipes" ;
  skos:example "plinthosol [ENVO:00002250]" ;
  schema:keywords "soil" , "type" ;
  MIXS:Expected_value "ENVO:00001998" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000334 a owl:DatatypeProperty ;
  rdfs:label "soil type method" ;
  rdfs:comment "Reference or method used in determining soil series name or other lower-level classification" ;
  skos:example "https://www.lrh.usace.army.mil/Portals/38/docs/PR/BluestoneSFEIS/Appendix%20K-Soil%20Descriptions.pdf" ;
  schema:keywords "method" , "soil" , "type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000112 a owl:DatatypeProperty ;
  rdfs:label "solar irradiance" ;
  rdfs:comment "The amount of solar energy that arrives at a specific area of a surface during a specific time interval" ;
  skos:example "1.36 kilowatts per square meter per day" ;
  MIXS:Preferred_unit "kilowatts per square meter per day, ergs per square centimeter per second" ;
  rdfs:range xsd:string .

MIXS:0000672 a owl:DatatypeProperty ;
  rdfs:label "soluble inorganic material" ;
  rdfs:comment "Concentration of substances such as ammonia, road-salt, sea-salt, cyanide, hydrogen sulfide, thiocyanates, thiosulfates, etc" ;
  schema:keywords "inorganic" , "material" , "soluble" ;
  MIXS:Expected_value "soluble inorganic material name;measurement value" ;
  MIXS:Preferred_unit "gram, microgram, mole per liter, gram per liter, parts per million" ;
  rdfs:range xsd:string .

MIXS:0000673 a owl:DatatypeProperty ;
  rdfs:label "soluble organic material" ;
  rdfs:comment "Concentration of substances such as urea, fruit sugars, soluble proteins, drugs, pharmaceuticals, etc" ;
  schema:keywords "material" , "organic" , "soluble" ;
  MIXS:Expected_value "soluble organic material name;measurement value" ;
  MIXS:Preferred_unit "gram, microgram, mole per liter, gram per liter, parts per million" ;
  rdfs:range xsd:string .

MIXS:0000738 a owl:DatatypeProperty ;
  rdfs:label "soluble reactive phosphorus" ;
  rdfs:comment "Concentration of soluble reactive phosphorus" ;
  skos:example "0.1 milligram per liter" ;
  schema:keywords "phosphorus" , "soluble" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000090 a owl:DatatypeProperty ;
  rdfs:label "relevant standard operating procedures" ;
  rdfs:comment "Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences" ;
  skos:example "http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/" ;
  schema:keywords "procedures" ;
  MIXS:Expected_value "reference to SOP" ;
  rdfs:range xsd:string .

MIXS:0001387 a owl:DatatypeProperty ;
  rdfs:label "experimental standard operating procedure" ;
  rdfs:comment "Provide a DOI or URL to refer to the paper where the field report, nucleic acid extraction,  library construction, and other procedures are explained in more detail, e.g. the paper reporting the data." ;
  skos:example "doi:10.1093/nar/gkr771" ;
  rdfs:range [
    a rdfs:Datatype ;
    owl:onDatatype xsd:string ;
    owl:withRestrictions ( _:o6978 )
  ] .

_:o6978 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0001393 a owl:DatatypeProperty ;
  rdfs:label "library preparation protocols" ;
  rdfs:comment "Citation(s) for the nucleic acid library preparation protocol." ;
  skos:example "doi:10.1093/nar/gkr771" ;
  rdfs:range [
    a rdfs:Datatype ;
    owl:onDatatype xsd:string ;
    owl:withRestrictions ( _:o6980 )
  ] .

_:o6980 xsd:pattern "(PMID:\\d+$|^doi:10.\\d{2,9}/.*$|^https?:\\/\\/(?:www\\.)?[-a-zA-Z0-9@:%._\\+~#=]{1,256}\\.[a-zA-Z0-9()]{1,6}\\b(?:[-a-zA-Z0-9()@:%_\\+.~#?&\\/=]*))" .

MIXS:0000075 a owl:ObjectProperty ;
  rdfs:label "sorting technology" ;
  rdfs:comment "Method used to sort/isolate cells or particles of interest" ;
  skos:example "optical manipulation" ;
  rdfs:range MIXS:SortTechEnum ;
  a owl:FunctionalProperty .

MIXS:0000026 a owl:DatatypeProperty ;
  rdfs:label "source material identifiers" ;
  rdfs:comment "A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2)" ;
  skos:example "MPI012345" ;
  schema:keywords "identifier" , "material" , "source" ;
  MIXS:Expected_value "for cultures of microorganisms: identifiers for two culture collections; for other material a unique arbitrary identifer" ;
  rdfs:range xsd:string .

MIXS:0000035 a owl:DatatypeProperty ;
  rdfs:label "source of UViGs" ;
  rdfs:comment "Type of dataset from which the UViG was obtained" ;
  skos:example "viral fraction metagenome (virome)" ;
  schema:keywords "source" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000770 a owl:ObjectProperty ;
  rdfs:label "space typical state" ;
  rdfs:comment "Customary or normal state of the space" ;
  skos:example "typically occupied" ;
  rdfs:range MIXS:SpaceTypStateEnum ;
  a owl:FunctionalProperty .

MIXS:0001234 a owl:DatatypeProperty ;
  rdfs:label "specific intended consumer" ;
  rdfs:comment "Food consumer type, human or animal, for which the food product is produced and marketed. This field accepts terms listed under food consumer group (http://purl.obolibrary.org/obo/FOODON_03510136)" ;
  skos:example "senior as food consumer [FOODON:03510254]" ;
  schema:keywords "consumer" ;
  rdfs:range xsd:string .

MIXS:0000905 a owl:DatatypeProperty ;
  rdfs:label "special diet" ;
  rdfs:comment "Specification of special diet; can include multiple special diets" ;
  skos:example "other:vegan" ;
  schema:keywords "diet" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string .

MIXS:0000836 a owl:ObjectProperty ;
  rdfs:label "specifications" ;
  rdfs:comment "The building specifications. If design is chosen, indicate phase: conceptual, schematic, design development, construction documents" ;
  skos:example "construction" ;
  rdfs:range MIXS:SpecificEnum ;
  a owl:FunctionalProperty .

MIXS:0000029 a owl:DatatypeProperty ;
  rdfs:label "host scientific name" ;
  rdfs:comment "Report the host's taxonomic name and/or NCBI taxonomy ID" ;
  skos:example "Homo sapiens and/or 9606" ;
  schema:keywords "host" , "host." ;
  MIXS:Expected_value "host scientific name, taxonomy ID" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000214 a owl:DatatypeProperty ;
  rdfs:label "specific humidity" ;
  rdfs:comment "The mass of water vapour in a unit mass of moist air, usually expressed as grams of vapour per kilogram of air, or, in air conditioning, as grains per pound" ;
  skos:example "15 per kilogram of air" ;
  schema:keywords "humidity" ;
  MIXS:Preferred_unit "gram of air, kilogram of air" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001235 a owl:DatatypeProperty ;
  rdfs:label "antimicrobial phenotype of spike-in bacteria" ;
  rdfs:comment "Qualitative description of a microbial response to antimicrobial agents. Bacteria may be susceptible or resistant to a broad range of antibiotic drugs or drug classes, with several intermediate states or phases. This field accepts terms under antimicrobial phenotype (http://purl.obolibrary.org/obo/ARO_3004299)" ;
  skos:example "wild type [ARO:3004432]" ;
  schema:keywords "antimicrobial" , "spike" ;
  MIXS:Expected_value "measurement value ARO:3004299" ;
  rdfs:range xsd:string .

MIXS:0001171 a owl:DatatypeProperty ;
  rdfs:label "spike-in with antibiotics" ;
  rdfs:comment "Antimicrobials used in research study to assess effects of exposure on microbiome of a specific site.  Please list antimicrobial, common name and/or class and concentration used for spike-in" ;
  skos:example "Tetracycline at 5 mg/ml" ;
  schema:keywords "spike" ;
  MIXS:Expected_value "drug name; concentration" ;
  rdfs:range xsd:string .

MIXS:0001335 a owl:DatatypeProperty ;
  rdfs:label "spike-in organism count" ;
  rdfs:comment "Total cell count of any organism (or group of organisms) per gram, volume or area of sample, should include name of organism followed by count. The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) should also be provided (example: total prokaryotes; 3.5e7 cells per ml; qPCR)" ;
  skos:example "total prokaryotes;3.5e7 colony forming units per milliliter;qPCR" ;
  schema:keywords "count" , "organism" , "spike" ;
  MIXS:Expected_value "organism name;measurement value;enumeration" ;
  MIXS:Preferred_unit "colony forming units per milliliter; colony forming units per gram of dry weight" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001169 a owl:DatatypeProperty ;
  rdfs:label "spike-in growth medium" ;
  rdfs:comment "A liquid or gel containing nutrients, salts, and other factors formulated to support the growth of microorganisms, cells, or plants (National Cancer Institute Thesaurus).  A growth medium is a culture medium which has the disposition to encourage growth of particular bacteria to the exclusion of others in the same growth environment.  In this case, list the culture medium used to propagate the spike-in bacteria during preparation of spike-in inoculum. This field accepts terms listed under microbiological culture medium (http://purl.obolibrary.org/obo/MICRO_0000067). If the proper descriptor is not listed please use text to describe the spike in growth media" ;
  skos:example "LB broth [MCO:0000036]" ;
  schema:keywords "growth" , "spike" ;
  rdfs:range xsd:string .

MIXS:0001172 a owl:DatatypeProperty ;
  rdfs:label "spike-in with heavy metals" ;
  rdfs:comment "Heavy metals used in research study to assess effects of exposure on microbiome of a specific site.  Please list heavy metals and concentration used for spike-in" ;
  skos:example "Cd at 20 ppm" ;
  schema:keywords "heavy" , "spike" ;
  MIXS:Expected_value "heavy metal name or chemical symbol; concentration" ;
  rdfs:range xsd:string .

MIXS:0001167 a owl:DatatypeProperty ;
  rdfs:label "spike in organism" ;
  rdfs:comment "Taxonomic information about the spike-in organism(s). This field accepts terms under organism (http://purl.obolibrary.org/obo/NCIT_C14250). This field also accepts identification numbers from NCBI under https://www.ncbi.nlm.nih.gov/taxonomy. Multiple terms can be separated by pipes" ;
  skos:example "Listeria monocytogenes [NCIT:C86502]|28901" ;
  schema:keywords "organism" , "spike" ;
  rdfs:range xsd:string .

MIXS:0001168 a owl:DatatypeProperty ;
  rdfs:label "spike-in bacterial serovar or serotype" ;
  rdfs:comment "Taxonomic information about the spike-in organism(s) at the serovar or serotype level. This field accepts terms under organism (http://purl.obolibrary.org/obo/NCIT_C14250). This field also accepts identification numbers from NCBI under https://www.ncbi.nlm.nih.gov/taxonomy. Multiple terms can be separated by pipes" ;
  skos:example "Escherichia coli strain O157:H7 [NCIT:C86883]|83334" ;
  schema:keywords "spike" ;
  MIXS:Expected_value "NCIT:C14250 or antigenic formula or serovar name" ;
  rdfs:range xsd:string .

MIXS:0001170 a owl:DatatypeProperty ;
  rdfs:label "spike-in microbial strain" ;
  rdfs:comment "Taxonomic information about the spike-in organism(s) at the strain level. This field accepts terms under organism (http://purl.obolibrary.org/obo/NCIT_C14250). This field also accepts identification numbers from NCBI under https://www.ncbi.nlm.nih.gov/taxonomy. Multiple terms can be separated by pipes" ;
  skos:example "169963" ;
  schema:keywords "microbial" , "spike" ;
  MIXS:Expected_value "NCIT:C14250 or NCBI taxid or text" ;
  rdfs:range xsd:string .

MIXS:0000996 a owl:ObjectProperty ;
  rdfs:label "source rock depositional environment" ;
  rdfs:comment "Source rock depositional environment (https://en.wikipedia.org/wiki/Source_rock). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Marine" ;
  schema:keywords "environment" , "source" ;
  rdfs:range MIXS:SrDepEnvEnum ;
  a owl:FunctionalProperty .

MIXS:0000997 a owl:ObjectProperty ;
  rdfs:label "source rock geological age" ;
  rdfs:comment "Geological age of source rock (Additional info: https://en.wikipedia.org/wiki/Period_(geology)). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Silurian" ;
  schema:keywords "age" , "source" ;
  rdfs:range MIXS:GeolAgeEnum ;
  a owl:FunctionalProperty .

MIXS:0000994 a owl:ObjectProperty ;
  rdfs:label "source rock kerogen type" ;
  rdfs:comment "Origin of kerogen. Type I: Algal (aquatic), Type II: planktonic and soft plant material (aquatic or terrestrial), Type III: terrestrial woody/ fibrous plant material (terrestrial), Type IV: oxidized recycled woody debris (terrestrial) (additional information: https://en.wikipedia.org/wiki/Kerogen). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Type IV" ;
  schema:keywords "source" , "type" ;
  rdfs:range MIXS:SrKerogTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000995 a owl:ObjectProperty ;
  rdfs:label "source rock lithology" ;
  rdfs:comment "Lithology of source rock (https://en.wikipedia.org/wiki/Source_rock). If \"other\" is specified, please propose entry in \"additional info\" field" ;
  skos:example "Coal" ;
  schema:keywords "lithology" , "source" ;
  rdfs:range MIXS:SrLithologyEnum ;
  a owl:FunctionalProperty .

MIXS:0001069 a owl:DatatypeProperty ;
  rdfs:label "standing water regimen" ;
  rdfs:comment "Treatment involving an exposure to standing water during a plant's life span, types can be flood water or standing water, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens" ;
  skos:example "standing water;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" , "water" ;
  rdfs:range xsd:string .

MIXS:0001259 a owl:DatatypeProperty ;
  rdfs:label "sampling room sterilization method" ;
  rdfs:comment "The method used to sterilize the sampling room. This field accepts terms listed under electromagnetic radiation (http://purl.obolibrary.org/obo/ENVO_01001026). If the proper descriptor is not listed, please use text to describe the sampling room sterilization method. Multiple terms can be separated by pipes" ;
  skos:example "ultraviolet radiation [ENVO:21001216]|infrared radiation [ENVO:21001214]" ;
  schema:keywords "method" , "room" ;
  MIXS:Expected_value "ENVO:01001026" ;
  rdfs:range xsd:string .

MIXS:0000327 a owl:DatatypeProperty ;
  rdfs:label "storage conditions" ;
  rdfs:comment "Explain how and for how long the sample was stored before DNA extraction (for example, fresh/frozen/other). Include factors that may influence nucleic acid recovery or library construction. For example, specify temperature, humidity, presence of microbial overgrowth etc.." ;
  skos:example "-20 degree Celsius freezer;P2Y10D" , "climate-controlled" , "Mould growth in storage box observed" , "Stored at -20oC until 2025-05-15" , "Stored in the museum from 1924 to 2021" ;
  schema:keywords "condition" , "storage" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001362 a owl:DatatypeProperty ;
  rdfs:label "stratigraphic context" ;
  rdfs:comment "Associated stratigraphic context(s) that the sample was retrieved from, usually from an archaeological or palaeontological excavation. Description(s) or identifier(s) of stratigraphic units or layer names within and/or relative to the site (e.g., stratigraphic unit ID, archaeological feature ID, layer name or a description, grid location)." ;
  skos:example "Layer 5" , "Layer UE" , "Horizon IIc, Quadrant 77" , "HF_23447_77_410_IIc" , "KrSp C2/2011/B5" , "US10" , "YSL" , "Subunit 1" , "Black Mousterian (BM)" ;
  schema:keywords "identifiers" , "excavation" ;
  MIXS:Expected_value "Stratigraphic context that the sample was retrieved from" ;
  rdfs:range xsd:string .

MIXS:0000898 a owl:DatatypeProperty ;
  rdfs:label "study completion status" ;
  rdfs:comment "Specification of study completion status, if no the reason should be specified" ;
  skos:example "no;non-compliance" ;
  schema:keywords "status" ;
  MIXS:Expected_value "YES or NO due to (1)adverse event (2) non-compliance (3) lost to follow up (4)other-specify" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001236 a owl:DatatypeProperty ;
  rdfs:label "study design" ;
  rdfs:comment "A plan specification comprised of protocols (which may specify how and what kinds of data will be gathered) that are executed as part of an investigation and is realized during a study design execution. This field accepts terms under study design (http://purl.obolibrary.org/obo/OBI_0500000). If the proper descriptor is not listed please use text to describe the study design. Multiple terms can be separated by pipes" ;
  skos:example "in vitro design [OBI:0001285]" ;
  MIXS:Expected_value "OBI:0500000" ;
  rdfs:range xsd:string .

MIXS:0001237 a owl:DatatypeProperty ;
  rdfs:label "study incubation duration" ;
  rdfs:comment "Sample incubation duration if unpublished or unvalidated method is used. Indicate the timepoint written in ISO 8601 format" ;
  skos:example "PT24H" ;
  schema:keywords "duration" , "incubation" , "period" ;
  MIXS:Preferred_unit "hours or days" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001238 a owl:DatatypeProperty ;
  rdfs:label "study incubation temperature" ;
  rdfs:comment "Sample incubation temperature if unpublished or unvalidated method is used" ;
  skos:example "37 degree Celsius" ;
  schema:keywords "incubation" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001239 a owl:DatatypeProperty ;
  rdfs:label "time-course duration" ;
  rdfs:comment "For time-course research studies involving samples of the food commodity, indicate the total duration of the time-course study" ;
  skos:example "2 days post inoculation" ;
  schema:keywords "duration" , "period" , "time" ;
  MIXS:Preferred_unit "dpi" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001240 a owl:DatatypeProperty ;
  rdfs:label "study treatment" ;
  rdfs:comment "A process in which the act is intended to modify or alter some other material entity.  From the study design, each treatment is comprised of one level of one or multiple factors. This field accepts terms listed under treatment (http://purl.obolibrary.org/obo/MCO_0000866). If the proper descriptor is not listed please use text to describe the study treatment. Multiple terms can be separated by one or more pipes" ;
  skos:example "Factor A|spike-in|levels high, medium, low" ;
  schema:keywords "treatment" ;
  MIXS:Expected_value "MCO:0000866" ;
  rdfs:range xsd:string .

MIXS:0000020 a owl:DatatypeProperty ;
  rdfs:label "subspecific genetic lineage" ;
  rdfs:comment "Information about the genetic distinctness of the sequenced organism below the subspecies level, e.g., serovar, serotype, biotype, ecotype, or any relevant genetic typing schemes like Group I plasmid. Subspecies should not be recorded in this term, but in the NCBI taxonomy. Supply both the lineage name and the lineage rank separated by a colon, e.g., biovar:abc123" ;
  skos:example "serovar:Newport" ;
  schema:keywords "lineage" ;
  MIXS:Expected_value "Genetic lineage below lowest rank of NCBI taxonomy, which is subspecies, e.g. serovar, biotype, ecotype, variety, cultivar" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000767 a owl:ObjectProperty ;
  rdfs:label "substructure type" ;
  rdfs:comment "The substructure or under building is that largely hidden section of the building which is built off the foundations to the ground floor level" ;
  skos:example "basement" ;
  schema:keywords "type" ;
  rdfs:range MIXS:SubstructureTypeEnum .

MIXS:0000423 a owl:DatatypeProperty ;
  rdfs:label "sulfate" ;
  rdfs:comment "Concentration of sulfate in the sample" ;
  skos:example "5 micromole per liter" ;
  schema:keywords "sulfate" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000407 a owl:DatatypeProperty ;
  rdfs:label "sulfate in formation water" ;
  rdfs:comment "Original sulfate concentration in the hydrocarbon resource" ;
  schema:keywords "sulfate" , "water" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000424 a owl:DatatypeProperty ;
  rdfs:label "sulfide" ;
  rdfs:comment "Concentration of sulfide in the sample" ;
  skos:example "2 micromole per liter" ;
  schema:keywords "sulfide" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000759 a owl:ObjectProperty ;
  rdfs:label "surface-air contaminant" ;
  rdfs:comment "Contaminant identified on surface" ;
  skos:example "radon" ;
  rdfs:range MIXS:SurfAirContEnum .

MIXS:0000123 a owl:DatatypeProperty ;
  rdfs:label "surface humidity" ;
  rdfs:comment "Surfaces: water activity as a function of air and material moisture" ;
  skos:note "percent or float?" ;
  skos:example "0.1" ;
  schema:keywords "humidity" , "surface" ;
  MIXS:Preferred_unit "percentage" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000758 a owl:ObjectProperty ;
  rdfs:label "surface material" ;
  rdfs:comment "Surface materials at the point of sampling" ;
  skos:example "wood" ;
  schema:keywords "material" , "surface" ;
  rdfs:range MIXS:SurfMaterialEnum ;
  a owl:FunctionalProperty .

MIXS:0000128 a owl:DatatypeProperty ;
  rdfs:label "surface moisture" ;
  rdfs:comment "Water held on a surface" ;
  skos:example "0.01 gram per square meter" ;
  schema:keywords "moisture" , "surface" ;
  MIXS:Preferred_unit "parts per million, gram per cubic meter, gram per square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000760 a owl:DatatypeProperty ;
  rdfs:label "surface moisture pH" ;
  rdfs:comment "ph measurement of surface" ;
  skos:example "7" ;
  schema:keywords "moisture" , "ph" , "surface" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000125 a owl:DatatypeProperty ;
  rdfs:label "surface temperature" ;
  rdfs:comment "Temperature of the surface at the time of sampling" ;
  skos:example "15 degree Celsius" ;
  schema:keywords "surface" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000741 a owl:DatatypeProperty ;
  rdfs:label "suspended particulate matter" ;
  rdfs:comment "Concentration of suspended particulate matter" ;
  skos:example "0.5 milligram per liter" ;
  schema:keywords "particle" , "particulate" , "suspended" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000150 a owl:DatatypeProperty ;
  rdfs:label "suspended solids" ;
  rdfs:comment "Concentration of substances including a wide variety of material, such as silt, decaying plant and animal matter; can include multiple substances" ;
  schema:keywords "solids" , "suspended" ;
  MIXS:Expected_value "suspended solid name;measurement value" ;
  MIXS:Preferred_unit "gram, microgram, milligram per liter, mole per liter, gram per liter, part per million" ;
  rdfs:range xsd:string .

MIXS:0001300 a owl:ObjectProperty ;
  rdfs:label "symbiotic host organism life cycle type" ;
  rdfs:comment "Type of life cycle of the symbiotic host species (the thing being sampled). Simple life cycles occur within a single host, complex ones within multiple different hosts over the course of their normal life cycle" ;
  skos:example "complex life cycle" ;
  schema:keywords "host" , "host." , "life" , "organism" , "symbiosis" , "type" ;
  MIXS:Expected_value "type of life cycle of the symbiotic organism (host of the samples)" ;
  rdfs:range MIXS:SymLifeCycleTypeEnum ;
  a owl:FunctionalProperty .

MIXS:symbiont_associated_data a owl:ObjectProperty ;
  rdfs:label "SymbiontAssociated data" ;
  rdfs:comment "Data that comply with Extension SymbiontAssociated" ;
  rdfs:range MIXS:0016023 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0001303 a owl:ObjectProperty ;
  rdfs:label "host of the symbiont role" ;
  rdfs:comment "Role of the host in the life cycle of the symbiotic organism" ;
  skos:example "intermediate" ;
  schema:keywords "host" , "host." , "symbiosis" ;
  rdfs:range MIXS:SymbiontHostRoleEnum ;
  a owl:FunctionalProperty .

MIXS:0000120 a owl:DatatypeProperty ;
  rdfs:label "total acid number" ;
  rdfs:comment "Total Acid Number (TAN) is a measurement of acidity that is determined by the amount of potassium hydroxide in milligrams that is needed to neutralize the acids in one gram of oil. It is an important quality measurement of crude oil. (source: https://en.wikipedia.org/wiki/Total_acid_number)" ;
  schema:keywords "number" , "total" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000044 a owl:DatatypeProperty ;
  rdfs:label "target gene" ;
  rdfs:comment "Targeted gene or locus name for marker gene studies" ;
  skos:example "16S rRNA, 18S rRNA, nif, amoA, rpo" ;
  schema:keywords "target" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000045 a owl:DatatypeProperty ;
  rdfs:label "target subfragment" ;
  rdfs:comment "Name of subfragment of a gene or locus. Important to e.g. identify special regions on marker genes like V6 on 16S rRNA" ;
  skos:example "V6, V9, ITS" ;
  schema:keywords "target" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000064 a owl:DatatypeProperty ;
  rdfs:label "taxonomic classification" ;
  rdfs:comment "Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes" ;
  skos:example "vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters)" ;
  schema:keywords "classification" , "taxon" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000053 a owl:ObjectProperty ;
  rdfs:label "taxonomic identity marker" ;
  rdfs:comment "The phylogenetic marker(s) used to assign an organism name to the SAG or MAG" ;
  skos:example "other" ;
  schema:keywords "identifier" , "marker" , "taxon" ;
  rdfs:range MIXS:TaxIdentEnum ;
  a owl:FunctionalProperty .

MIXS:0000113 a owl:DatatypeProperty ;
  rdfs:label "temperature" ;
  rdfs:comment "Temperature of the sample at the time of sampling" ;
  skos:example "25 degree Celsius" ;
  schema:keywords "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000197 a owl:DatatypeProperty ;
  rdfs:label "temperature outside house" ;
  rdfs:comment "The recorded temperature value at sampling time outside" ;
  skos:example "5 degree Celsius" ;
  schema:keywords "house" , "temperature" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000352 a owl:DatatypeProperty ;
  rdfs:label "tertiary treatment" ;
  rdfs:comment "The process providing a final treatment stage to raise the effluent quality before it is discharged to the receiving environment" ;
  schema:keywords "treatment" ;
  MIXS:Expected_value "tertiary treatment type" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000750 a owl:ObjectProperty ;
  rdfs:label "tidal stage" ;
  rdfs:comment "Stage of tide" ;
  skos:example "high tide" ;
  rdfs:range MIXS:TidalStageEnum ;
  a owl:FunctionalProperty .

MIXS:0001081 a owl:ObjectProperty ;
  rdfs:label "history/tillage" ;
  rdfs:comment "Note method(s) used for tilling" ;
  skos:example "chisel" ;
  schema:keywords "history" ;
  rdfs:range MIXS:TillageEnum .

MIXS:0000924 a owl:DatatypeProperty ;
  rdfs:label "time since last toothbrushing" ;
  rdfs:comment "Specification of the time since last toothbrushing" ;
  skos:note "P2H45M does not match ^P(?!$)(\\\\d+Y)?(\\\\d+M)?(\\\\d+W)?(\\\\d+D)?(T(?=\\\\d+[HMS])(\\\\d+H)?(\\\\d+M)?(\\\\d+S)?)?$" , "problematic ISO 8601 period validation" ;
  skos:example "PT2H45M" ;
  schema:keywords "time" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000943 a owl:DatatypeProperty ;
  rdfs:label "time since last wash" ;
  rdfs:comment "Specification of the time since last wash" ;
  skos:example "P1D" ;
  schema:keywords "time" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001173 a owl:DatatypeProperty ;
  rdfs:label "timepoint" ;
  rdfs:comment "Time point at which a sample or observation is made or taken from a biomaterial as measured from some reference point. Indicate the timepoint written in ISO 8601 format" ;
  skos:example "PT24H" ;
  schema:keywords "time" ;
  MIXS:Preferred_unit "hours or days" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001070 a owl:DatatypeProperty ;
  rdfs:label "tissue culture growth media" ;
  rdfs:comment "Description of plant tissue culture growth media used" ;
  skos:example "https://link.springer.com/content/pdf/10.1007/BF02796489.pdf" ;
  schema:keywords "culture" , "growth" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000154 a owl:DatatypeProperty ;
  rdfs:label "toluene" ;
  rdfs:comment "Concentration of toluene in the sample" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000525 a owl:DatatypeProperty ;
  rdfs:label "total carbon" ;
  rdfs:comment "Total carbon content" ;
  schema:keywords "carbon" , "total" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000634 a owl:DatatypeProperty ;
  rdfs:label "total depth of water column" ;
  rdfs:comment "Measurement of total depth of water column" ;
  skos:example "500 meter" ;
  schema:keywords "depth" , "total" , "water" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000744 a owl:DatatypeProperty ;
  rdfs:label "total dissolved nitrogen" ;
  rdfs:comment "Total dissolved nitrogen concentration, reported as nitrogen, measured by: total dissolved nitrogen = NH4 + NO3NO2 + dissolved organic nitrogen" ;
  skos:example "40 microgram per liter" ;
  schema:keywords "dissolved" , "nitrogen" , "total" ;
  MIXS:Preferred_unit "microgram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000745 a owl:DatatypeProperty ;
  rdfs:label "total inorganic nitrogen" ;
  rdfs:comment "Total inorganic nitrogen content" ;
  skos:example "40 microgram per liter" ;
  schema:keywords "inorganic" , "nitrogen" , "total" ;
  MIXS:Preferred_unit "microgram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000105 a owl:DatatypeProperty ;
  rdfs:label "total iron" ;
  rdfs:comment "Concentration of total iron in the sample" ;
  schema:keywords "total" ;
  MIXS:Preferred_unit "milligram per liter, milligram per kilogram" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000102 a owl:DatatypeProperty ;
  rdfs:label "total nitrogen concentration" ;
  rdfs:comment "Total nitrogen concentration of water samples, calculated by: total nitrogen = total dissolved nitrogen + particulate nitrogen. Can also be measured without filtering, reported as nitrogen" ;
  skos:example "50 micromole per liter" ;
  schema:keywords "concentration" , "nitrogen" , "total" ;
  MIXS:Preferred_unit "microgram per liter, micromole per liter, milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000338 a owl:DatatypeProperty ;
  rdfs:label "total nitrogen content method" ;
  rdfs:comment "Reference or method used in determining the total nitrogen" ;
  skos:example "https://currentprotocols.onlinelibrary.wiley.com/doi/abs/10.1002/0471142913.fab0102s00" ;
  schema:keywords "content" , "method" , "nitrogen" , "total" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000530 a owl:DatatypeProperty ;
  rdfs:label "total nitrogen content" ;
  rdfs:comment "Total nitrogen content of the sample" ;
  skos:example "35 milligrams Nitrogen per kilogram of soil" ;
  schema:keywords "content" , "nitrogen" , "total" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000337 a owl:DatatypeProperty ;
  rdfs:label "total organic carbon method" ;
  rdfs:comment "Reference or method used in determining total organic carbon" ;
  skos:example "https://www.epa.gov/sites/production/files/2015-12/documents/9060a.pdf" ;
  schema:keywords "carbon" , "method" , "organic" , "total" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000533 a owl:DatatypeProperty ;
  rdfs:label "total organic carbon" ;
  rdfs:comment "Total organic carbon content" ;
  skos:example "0.02" ;
  schema:keywords "carbon" , "organic" , "total" ;
  MIXS:Preferred_unit "gram Carbon per kilogram sample material" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000747 a owl:DatatypeProperty ;
  rdfs:label "total particulate carbon" ;
  rdfs:comment "Total particulate carbon content" ;
  skos:example "35 micromole per liter" ;
  schema:keywords "carbon" , "particle" , "particulate" , "total" ;
  MIXS:Preferred_unit "microgram per liter, micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000117 a owl:DatatypeProperty ;
  rdfs:label "total phosphorus" ;
  rdfs:comment "Total phosphorus concentration in the sample, calculated by: total phosphorus = total dissolved phosphorus + particulate phosphorus" ;
  skos:example "0.03 milligram per liter" ;
  schema:keywords "phosphorus" , "total" ;
  MIXS:Preferred_unit "micromole per liter, milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000689 a owl:DatatypeProperty ;
  rdfs:label "total phosphate" ;
  rdfs:comment "Total amount or concentration of phosphate" ;
  schema:keywords "phosphate" , "total" ;
  MIXS:Preferred_unit "microgram per liter, micromole per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000419 a owl:DatatypeProperty ;
  rdfs:label "total sulfur" ;
  rdfs:comment "Concentration of total sulfur in the sample" ;
  schema:keywords "sulfur" , "total" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000837 a owl:ObjectProperty ;
  rdfs:label "train line" ;
  rdfs:comment "The subway line name" ;
  skos:example "red" ;
  schema:keywords "train" ;
  rdfs:range MIXS:TrainLineEnum ;
  a owl:FunctionalProperty .

MIXS:0000838 a owl:ObjectProperty ;
  rdfs:label "train station collection location" ;
  rdfs:comment "The train station collection location" ;
  skos:example "forest hills" ;
  schema:keywords "location" , "train" ;
  rdfs:range MIXS:TrainStatLocEnum ;
  a owl:FunctionalProperty .

MIXS:0000839 a owl:ObjectProperty ;
  rdfs:label "train stop collection location" ;
  rdfs:comment "The train stop collection location" ;
  skos:example "end" ;
  schema:keywords "location" , "stop" , "train" ;
  rdfs:range MIXS:TrainStopLocEnum ;
  a owl:FunctionalProperty .

MIXS:0000268 a owl:DatatypeProperty ;
  rdfs:label "travel outside the country in last six months" ;
  rdfs:comment "Specification of the countries travelled in the last six months; can include multiple travels" ;
  schema:keywords "months" ;
  MIXS:Expected_value "country name" ;
  rdfs:range xsd:string .

MIXS:0000068 a owl:DatatypeProperty ;
  rdfs:label "tRNA extraction software" ;
  rdfs:comment "Tools used for tRNA identification" ;
  skos:example "infernal;v2;default parameters" ;
  schema:keywords "software" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000067 a owl:DatatypeProperty ;
  rdfs:label "number of standard tRNAs extracted" ;
  rdfs:comment "The total number of tRNAs identified from the SAG or MAG" ;
  skos:example "18" ;
  schema:keywords "number" ;
  MIXS:Expected_value "value from 0-21" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000032 a owl:ObjectProperty ;
  rdfs:label "trophic level" ;
  rdfs:comment "Trophic levels are the feeding position in a food chain. Microbes can be a range of producers (e.g. chemolithotroph)" ;
  skos:example "heterotroph" ;
  schema:keywords "level" ;
  rdfs:range MIXS:TrophicLevelEnum ;
  a owl:FunctionalProperty .

MIXS:0000191 a owl:DatatypeProperty ;
  rdfs:label "turbidity" ;
  rdfs:comment "Measure of the amount of cloudiness or haziness in water caused by individual particles" ;
  skos:example "0.3 nephelometric turbidity units" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000397 a owl:DatatypeProperty ;
  rdfs:label "depth (TVDSS) of hydrocarbon resource pressure" ;
  rdfs:comment "True vertical depth subsea (TVDSS) of the hydrocarbon resource where the original pressure was measured (e.g. 1578 m)" ;
  schema:keywords "depth" , "hydrocarbon" , "pressure" , "resource" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000394 a owl:DatatypeProperty ;
  rdfs:label "depth (TVDSS) of hydrocarbon resource temperature" ;
  rdfs:comment "True vertical depth subsea (TVDSS) of the hydrocarbon resource where the original temperature was measured (e.g. 1345 m)" ;
  schema:keywords "depth" , "hydrocarbon" , "resource" , "temperature" ;
  MIXS:Preferred_unit "meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000326 a owl:DatatypeProperty ;
  rdfs:label "twin sibling presence" ;
  rdfs:comment "Specification of twin sibling presence" ;
  skos:example "yes" ;
  schema:keywords "presence" ;
  rdfs:range xsd:boolean ;
  a owl:FunctionalProperty .

MIXS:0000771 a owl:DatatypeProperty ;
  rdfs:label "typical occupant density" ;
  rdfs:comment "Customary or normal density of occupants" ;
  skos:example "25" ;
  schema:keywords "density" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0001307 a owl:ObjectProperty ;
  rdfs:label "type of symbiosis" ;
  rdfs:comment "Type of biological interaction established between the symbiotic host organism being sampled and its respective host" ;
  skos:example "parasitic" ;
  schema:keywords "symbiosis" , "type" ;
  rdfs:range MIXS:TypeOfSymbiosisEnum ;
  a owl:FunctionalProperty .

MIXS:0000899 a owl:ObjectProperty ;
  rdfs:label "urine/collection method" ;
  rdfs:comment "Specification of urine collection method" ;
  skos:example "catheter" ;
  schema:keywords "method" ;
  rdfs:range MIXS:UrineCollectMethEnum ;
  a owl:FunctionalProperty .

MIXS:0000862 a owl:ObjectProperty ;
  rdfs:label "urobiome sex" ;
  rdfs:comment "Physical sex of the host" ;
  schema:keywords "host" , "host." ;
  MIXS:Expected_value "sex of the symbiotic organism (host of the samples); enumeration" ;
  rdfs:range MIXS:UrobiomSexEnum ;
  a owl:FunctionalProperty .

MIXS:0000289 a owl:DatatypeProperty ;
  rdfs:label "urogenital disorder" ;
  rdfs:comment "History of urogenital disorders, can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, reproductive system disease (https://disease-ontology.org/?id=DOID:15) or urinary system disease (https://disease-ontology.org/?id=DOID:18)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000278 a owl:DatatypeProperty ;
  rdfs:label "urine/urogenital tract disorder" ;
  rdfs:comment "History of urogenital tract disorders; can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, urinary system disease (https://disease-ontology.org/?id=DOID:18)" ;
  schema:keywords "disorder" ;
  rdfs:range xsd:string .

MIXS:0000114 a owl:DatatypeProperty ;
  rdfs:label "ventilation rate" ;
  rdfs:comment "Ventilation rate of the system in the sampled premises" ;
  skos:example "750 cubic meter per minute" ;
  schema:keywords "rate" ;
  MIXS:Preferred_unit "cubic meter per minute, liters per second" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000756 a owl:DatatypeProperty ;
  rdfs:label "ventilation type" ;
  rdfs:comment "Ventilation system used in the sampled premises" ;
  skos:example "Operable windows" ;
  schema:keywords "type" ;
  MIXS:Expected_value "ventilation type name" ;
  rdfs:range xsd:string .

MIXS:0000152 a owl:DatatypeProperty ;
  rdfs:label "volatile fatty acids" ;
  rdfs:comment "Concentration of Volatile Fatty Acids in the sample" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000408 a owl:DatatypeProperty ;
  rdfs:label "vfa in formation water" ;
  rdfs:comment "Original volatile fatty acid concentration in the hydrocarbon resource" ;
  schema:keywords "water" ;
  MIXS:Preferred_unit "milligram per liter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000081 a owl:DatatypeProperty ;
  rdfs:label "viral identification software" ;
  rdfs:comment "Tool(s) used for the identification of UViG as a viral genome, software or protocol name including version number, parameters, and cutoffs used" ;
  skos:example "VirSorter; 1.0.4; Virome database, category 2" ;
  schema:keywords "identifier" , "software" ;
  MIXS:Expected_value "software name, version and relevant parameters" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000036 a owl:ObjectProperty ;
  rdfs:label "virus enrichment approach" ;
  rdfs:comment "List of approaches used to enrich the sample for viruses, if any" ;
  skos:example "filtration" , "FeCl Precipitation" , "ultracentrifugation" , "DNAse" ;
  schema:keywords "enrichment" ;
  rdfs:range MIXS:VirusEnrichApprEnum ;
  a owl:FunctionalProperty .

MIXS:0000840 a owl:DatatypeProperty ;
  rdfs:label "visual media" ;
  rdfs:comment "The building visual media" ;
  skos:example "3D scans" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000126 a owl:DatatypeProperty ;
  rdfs:label "viscosity" ;
  rdfs:comment "A measure of oil's resistance to gradual deformation by shear stress or tensile stress (e.g. 3.5 cp; 100 °C)" ;
  MIXS:Expected_value "measurement value;measurement value" ;
  MIXS:Preferred_unit "cP at degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000115 a owl:DatatypeProperty ;
  rdfs:label "volatile organic compounds" ;
  rdfs:comment "Concentration of carbon-based chemicals that easily evaporate at room temperature; can report multiple volatile organic compounds by entering numeric values preceded by name of compound" ;
  skos:example "formaldehyde;500 nanogram per liter" ;
  schema:keywords "organic" ;
  MIXS:Expected_value "volatile organic compound name;measurement value" ;
  MIXS:Preferred_unit "microgram per cubic meter, parts per million, nanogram per liter" ;
  rdfs:range xsd:string .

MIXS:0000198 a owl:DatatypeProperty ;
  rdfs:label "wall area" ;
  rdfs:comment "The total area of the sampled room's walls" ;
  schema:keywords "area" , "wall" ;
  MIXS:Preferred_unit "square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000841 a owl:ObjectProperty ;
  rdfs:label "wall construction type" ;
  rdfs:comment "The building class of the wall defined by the composition of the building elements and fire-resistance rating" ;
  skos:example "fire resistive" ;
  schema:keywords "type" , "wall" ;
  rdfs:range MIXS:WallConstTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000842 a owl:ObjectProperty ;
  rdfs:label "wall finish material" ;
  rdfs:comment "The material utilized to finish the outer most layer of the wall" ;
  skos:example "wood" ;
  schema:keywords "material" , "wall" ;
  rdfs:range MIXS:WallFinishMatEnum ;
  a owl:FunctionalProperty .

MIXS:0000221 a owl:DatatypeProperty ;
  rdfs:label "wall height" ;
  rdfs:comment "The average height of the walls in the sampled room" ;
  schema:keywords "height" , "wall" ;
  MIXS:Preferred_unit "centimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000843 a owl:ObjectProperty ;
  rdfs:label "wall location" ;
  rdfs:comment "The relative location of the wall within the room" ;
  skos:example "north" ;
  schema:keywords "location" , "wall" ;
  rdfs:range MIXS:CompassDirections8Enum ;
  a owl:FunctionalProperty .

MIXS:0000845 a owl:ObjectProperty ;
  rdfs:label "wall surface treatment" ;
  rdfs:comment "The surface treatment of interior wall" ;
  skos:example "paneling" ;
  schema:keywords "surface" , "treatment" , "wall" ;
  rdfs:range MIXS:WallSurfTreatmentEnum ;
  a owl:FunctionalProperty .

MIXS:0000846 a owl:ObjectProperty ;
  rdfs:label "wall texture" ;
  rdfs:comment "The feel, appearance, or consistency of a wall surface" ;
  skos:example "popcorn" ;
  schema:keywords "texture" , "wall" ;
  rdfs:range MIXS:CeilingWallTextureEnum ;
  a owl:FunctionalProperty .

MIXS:0000222 a owl:DatatypeProperty ;
  rdfs:label "wall thermal mass" ;
  rdfs:comment "The ability of the wall to provide inertia against temperature fluctuations. Generally this means concrete or concrete block that is either exposed or covered only with paint" ;
  schema:keywords "mass" , "wall" ;
  MIXS:Preferred_unit "joule per degree Celsius" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000844 a owl:ObjectProperty ;
  rdfs:label "wall signs of water/mold" ;
  rdfs:comment "Signs of the presence of mold or mildew on a wall" ;
  skos:example "no presence of mold visible" ;
  schema:keywords "wall" ;
  rdfs:range MIXS:MoldVisibilityEnum ;
  a owl:FunctionalProperty .

MIXS:wastewater_sludge_data a owl:ObjectProperty ;
  rdfs:label "WastewaterSludge data" ;
  rdfs:comment "Data that comply with Extension WastewaterSludge" ;
  rdfs:range MIXS:0016013 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000353 a owl:DatatypeProperty ;
  rdfs:label "wastewater type" ;
  rdfs:comment "The origin of wastewater such as human waste, rainfall, storm drains, etc" ;
  schema:keywords "type" ;
  MIXS:Expected_value "wastewater type name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000323 a owl:DatatypeProperty ;
  rdfs:label "water content method" ;
  rdfs:comment "Reference or method used in determining the water content of soil" ;
  schema:keywords "content" , "method" , "water" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000185 a owl:DatatypeProperty ;
  rdfs:label "water content" ;
  rdfs:comment "Water content measurement" ;
  schema:keywords "content" , "water" ;
  MIXS:Preferred_unit "gram per gram or cubic centimeter per cubic centimeter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000203 a owl:DatatypeProperty ;
  rdfs:label "water current" ;
  rdfs:comment "Measurement of magnitude and direction of flow within a fluid" ;
  skos:example "10 cubic meter per second" ;
  schema:keywords "water" ;
  MIXS:Preferred_unit "cubic meter per second, knots" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000454 a owl:DatatypeProperty ;
  rdfs:label "water cut" ;
  rdfs:comment "Current amount of water (%) in a produced fluid stream; or the average of the combined streams" ;
  skos:note "percent or float?" ;
  skos:example "45%" ;
  schema:keywords "water" ;
  MIXS:Preferred_unit "percent" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:water_data a owl:ObjectProperty ;
  rdfs:label "Water data" ;
  rdfs:comment "Data that comply with Extension Water" ;
  schema:keywords "water" ;
  rdfs:range MIXS:0016014 ;
  rdfs:domain MIXS:MixsCompliantData .

MIXS:0000223 a owl:DatatypeProperty ;
  rdfs:label "water feature size" ;
  rdfs:comment "The size of the water feature" ;
  schema:keywords "feature" , "size" , "water" ;
  MIXS:Preferred_unit "square meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000847 a owl:ObjectProperty ;
  rdfs:label "water feature type" ;
  rdfs:comment "The type of water feature present within the building being sampled" ;
  skos:example "stream" ;
  schema:keywords "feature" , "type" , "water" ;
  rdfs:range MIXS:WaterFeatTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0001174 a owl:DatatypeProperty ;
  rdfs:label "water delivery frequency" ;
  rdfs:comment "Number of water delivery events within a given period of time" ;
  skos:example "2 per day" ;
  schema:keywords "delivery" , "frequency" , "water" ;
  MIXS:Expected_value "rate" ;
  MIXS:Preferred_unit "per day, per week, per month" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001175 a owl:DatatypeProperty ;
  rdfs:label "water pH" ;
  rdfs:comment "pH measurement of some water at the time of sampling" ;
  skos:example "7.2" ;
  schema:keywords "ph" , "water" ;
  rdfs:range xsd:float ;
  a owl:FunctionalProperty .

MIXS:0000453 a owl:DatatypeProperty ;
  rdfs:label "water production rate" ;
  rdfs:comment "Water production rates per well (e.g. 987 m3 / day)" ;
  schema:keywords "production" , "rate" , "water" ;
  MIXS:Preferred_unit "cubic meter per day" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0001122 a owl:DatatypeProperty ;
  rdfs:label "environmental feature adjacent water source" ;
  rdfs:comment "Description of the environmental features that are adjacent to the farm water source. This field accepts terms under ecosystem (http://purl.obolibrary.org/obo/ENVO_01001110) and human construction (http://purl.obolibrary.org/obo/ENVO_00000070). Multiple terms can be separated by pipes" ;
  skos:example "feedlot [ENVO:01000627]" ;
  schema:keywords "adjacent" , "environmental" , "feature" , "source" , "water" ;
  MIXS:Expected_value "ENVO_01001110 or ENVO_00000070" ;
  rdfs:range xsd:string .

MIXS:0001176 a owl:DatatypeProperty ;
  rdfs:label "water source shared" ;
  rdfs:comment "Other users sharing access to the same water source. Multiple terms can be separated by one or more pipes" ;
  skos:example "no sharing" ;
  schema:keywords "source" , "water" ;
  MIXS:Expected_value "enumeration" ;
  rdfs:range xsd:string .

MIXS:0000590 a owl:DatatypeProperty ;
  rdfs:label "water temperature regimen" ;
  rdfs:comment "Information about treatment involving an exposure to water with varying degree of temperature, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens" ;
  skos:example "15 degree Celsius;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" , "temperature" , "water" ;
  MIXS:Preferred_unit "degree Celsius" ;
  rdfs:range xsd:string .

MIXS:0000591 a owl:DatatypeProperty ;
  rdfs:label "watering regimen" ;
  rdfs:comment "Information about treatment involving an exposure to watering frequencies, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens" ;
  skos:example "1 liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M" ;
  schema:keywords "regimen" , "water" ;
  MIXS:Preferred_unit "milliliter, liter" ;
  rdfs:range xsd:string .

MIXS:0000848 a owl:ObjectProperty ;
  rdfs:label "weekday" ;
  rdfs:comment "The day of the week when sampling occurred" ;
  skos:example "Sunday" ;
  rdfs:range MIXS:WeekdayEnum ;
  a owl:FunctionalProperty .

MIXS:0000295 a owl:DatatypeProperty ;
  rdfs:label "weight loss in last three months" ;
  rdfs:comment "Specification of weight loss in the last three months, if yes should be further specified to include amount of weight loss" ;
  skos:example "yes;5 kilogram" ;
  schema:keywords "months" , "weight" ;
  MIXS:Expected_value "weight loss specification;measurement value" ;
  MIXS:Preferred_unit "kilogram, gram" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000055 a owl:ObjectProperty ;
  rdfs:label "WGA amplification approach" ;
  rdfs:comment "Method used to amplify genomic DNA in preparation for sequencing" ;
  skos:example "mda based" ;
  rdfs:range MIXS:WgaAmpApprEnum ;
  a owl:FunctionalProperty .

MIXS:0000006 a owl:DatatypeProperty ;
  rdfs:label "WGA amplification kit" ;
  rdfs:comment "Kit used to amplify genomic DNA in preparation for sequencing" ;
  skos:example "qiagen repli-g" ;
  schema:keywords "kit" ;
  MIXS:Expected_value "kit name" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000297 a owl:DatatypeProperty ;
  rdfs:label "well identification number" ;
  rdfs:comment "A unique identifier of a well or wellbore. This is part of the Global Framework for Well Identification initiative which is compiled by the Professional Petroleum Data Management Association (PPDM) in an effort to improve well identification systems. (Supporting information: https://ppdm.org/ and http://dl.ppdm.org/dl/690)" ;
  schema:keywords "identifier" , "number" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000757 a owl:DatatypeProperty ;
  rdfs:label "wind direction" ;
  rdfs:comment "Wind direction is the direction from which a wind originates" ;
  schema:keywords "direction" , "wind" ;
  MIXS:Preferred_unit "degrees or cardinal direction" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000118 a owl:DatatypeProperty ;
  rdfs:label "wind speed" ;
  rdfs:comment "speed of wind measured at the time of sampling" ;
  schema:keywords "speed" , "wind" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000849 a owl:ObjectProperty ;
  rdfs:label "window condition" ;
  rdfs:comment "The physical condition of the window at the time of sampling" ;
  skos:example "rupture" ;
  schema:keywords "condition" , "window" ;
  rdfs:range MIXS:DamagedRupturedEnum ;
  a owl:FunctionalProperty .

MIXS:0000850 a owl:ObjectProperty ;
  rdfs:label "window covering" ;
  rdfs:comment "The type of window covering" ;
  skos:example "curtains" ;
  schema:keywords "window" ;
  rdfs:range MIXS:WindowCoverEnum ;
  a owl:FunctionalProperty .

MIXS:0000851 a owl:ObjectProperty ;
  rdfs:label "window horizontal position" ;
  rdfs:comment "The horizontal position of the window on the wall" ;
  skos:example "middle" ;
  schema:keywords "window" ;
  rdfs:range MIXS:WindowHorizPosEnum ;
  a owl:FunctionalProperty .

MIXS:0000852 a owl:ObjectProperty ;
  rdfs:label "window location" ;
  rdfs:comment "The relative location of the window within the room" ;
  skos:example "west" ;
  schema:keywords "location" , "window" ;
  rdfs:range MIXS:CompassDirections8Enum ;
  a owl:FunctionalProperty .

MIXS:0000853 a owl:ObjectProperty ;
  rdfs:label "window material" ;
  rdfs:comment "The type of material used to finish a window" ;
  skos:example "wood" ;
  schema:keywords "material" , "window" ;
  rdfs:range MIXS:WindowMatEnum ;
  a owl:FunctionalProperty .

MIXS:0000246 a owl:DatatypeProperty ;
  rdfs:label "window open frequency" ;
  rdfs:comment "The number of times windows are opened per week" ;
  schema:keywords "frequency" , "window" ;
  rdfs:range xsd:integer ;
  a owl:FunctionalProperty .

MIXS:0000224 a owl:DatatypeProperty ;
  rdfs:label "window area/size" ;
  rdfs:comment "The window's length and width" ;
  schema:keywords "window" ;
  MIXS:Expected_value "measurement value" ;
  MIXS:Preferred_unit "inch, meter" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000855 a owl:ObjectProperty ;
  rdfs:label "window status" ;
  rdfs:comment "Defines whether the windows were open or closed during environmental testing" ;
  skos:example "open" ;
  schema:keywords "status" , "window" ;
  rdfs:range MIXS:WindowStatusEnum ;
  a owl:FunctionalProperty .

MIXS:0000856 a owl:ObjectProperty ;
  rdfs:label "window type" ;
  rdfs:comment "The type of windows" ;
  skos:example "fixed window" ;
  schema:keywords "type" , "window" ;
  rdfs:range MIXS:WindowTypeEnum ;
  a owl:FunctionalProperty .

MIXS:0000857 a owl:ObjectProperty ;
  rdfs:label "window vertical position" ;
  rdfs:comment "The vertical position of the window on the wall" ;
  skos:example "middle" ;
  schema:keywords "window" ;
  rdfs:range MIXS:WindowVertPosEnum ;
  a owl:FunctionalProperty .

MIXS:0000854 a owl:ObjectProperty ;
  rdfs:label "window signs of water/mold" ;
  rdfs:comment "Signs of the presence of mold or mildew on the window" ;
  skos:example "no presence of mold visible" ;
  schema:keywords "window" ;
  rdfs:range MIXS:MoldVisibilityEnum ;
  a owl:FunctionalProperty .

MIXS:0000065 a owl:DatatypeProperty ;
  rdfs:label "16S recovered" ;
  rdfs:comment "Can a 16S gene be recovered from the submitted SAG or MAG?" ;
  skos:example "yes" ;
  schema:keywords "recover" ;
  rdfs:range xsd:boolean ;
  a owl:FunctionalProperty .

MIXS:0000066 a owl:DatatypeProperty ;
  rdfs:label "16S recovery software" ;
  rdfs:comment "Tools used for 16S rRNA gene extraction" ;
  skos:example "rambl;v2;default parameters" ;
  schema:keywords "recover" , "software" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:0000156 a owl:DatatypeProperty ;
  rdfs:label "xylene" ;
  rdfs:comment "Concentration of xylene in the sample" ;
  MIXS:Preferred_unit "milligram per liter, parts per million" ;
  rdfs:range xsd:string ;
  a owl:FunctionalProperty .

MIXS:AeroStrucEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:AeroStrucEnum.GLIDER MIXS:AeroStrucEnum.PLANE )
  ] .

MIXS:AeroStrucEnum.GLIDER a owl:NamedIndividual ;
  skos:notation "glider" ;
  a MIXS:AeroStrucEnum .

MIXS:AeroStrucEnum.PLANE a owl:NamedIndividual ;
  skos:notation "plane" ;
  a MIXS:AeroStrucEnum .

MIXS:AnimalBodyCondEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:AnimalBodyCondEnum.NORMAL MIXS:AnimalBodyCondEnum.OVER_CONDITIONED MIXS:AnimalBodyCondEnum.UNDER_CONDITIONED )
  ] .

MIXS:AnimalBodyCondEnum.NORMAL a owl:NamedIndividual ;
  skos:notation "normal" ;
  a MIXS:AnimalBodyCondEnum .

MIXS:AnimalBodyCondEnum.OVER_CONDITIONED a owl:NamedIndividual ;
  skos:notation "over conditioned" ;
  a MIXS:AnimalBodyCondEnum .

MIXS:AnimalBodyCondEnum.UNDER_CONDITIONED a owl:NamedIndividual ;
  skos:notation "under conditioned" ;
  a MIXS:AnimalBodyCondEnum .

MIXS:AnimalSexEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:AnimalSexEnum.CASTRATED_FEMALE MIXS:AnimalSexEnum.CASTRATED_MALE MIXS:AnimalSexEnum.INTACT_FEMALE MIXS:AnimalSexEnum.INTACT_MALE )
  ] .

MIXS:AnimalSexEnum.CASTRATED_FEMALE a owl:NamedIndividual ;
  skos:notation "castrated female" ;
  a MIXS:AnimalSexEnum .

MIXS:AnimalSexEnum.CASTRATED_MALE a owl:NamedIndividual ;
  skos:notation "castrated male" ;
  a MIXS:AnimalSexEnum .

MIXS:AnimalSexEnum.INTACT_FEMALE a owl:NamedIndividual ;
  skos:notation "intact female" ;
  a MIXS:AnimalSexEnum .

MIXS:AnimalSexEnum.INTACT_MALE a owl:NamedIndividual ;
  skos:notation "intact male" ;
  a MIXS:AnimalSexEnum .

MIXS:ArchStrucEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ArchStrucEnum.BUILDING MIXS:ArchStrucEnum.HOME MIXS:ArchStrucEnum.SHED )
  ] .

MIXS:ArchStrucEnum.BUILDING a owl:NamedIndividual ;
  skos:notation "building" ;
  a MIXS:ArchStrucEnum .

MIXS:ArchStrucEnum.HOME a owl:NamedIndividual ;
  skos:notation "home" ;
  a MIXS:ArchStrucEnum .

MIXS:ArchStrucEnum.SHED a owl:NamedIndividual ;
  skos:notation "shed" ;
  a MIXS:ArchStrucEnum .

MIXS:AssemblyQualEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:AssemblyQualEnum.FINISHED_GENOME MIXS:AssemblyQualEnum.GENOME_FRAGMENT_S MIXS:AssemblyQualEnum.HIGH_QUALITY_DRAFT_GENOME MIXS:AssemblyQualEnum.LOW_QUALITY_DRAFT_GENOME MIXS:AssemblyQualEnum.MEDIUM_QUALITY_DRAFT_GENOME )
  ] .

MIXS:AssemblyQualEnum.FINISHED_GENOME a owl:NamedIndividual ;
  skos:notation "Finished genome" ;
  a MIXS:AssemblyQualEnum .

MIXS:AssemblyQualEnum.GENOME_FRAGMENT_S a owl:NamedIndividual ;
  skos:notation "Genome fragment(s)" ;
  a MIXS:AssemblyQualEnum .

MIXS:AssemblyQualEnum.HIGH_QUALITY_DRAFT_GENOME a owl:NamedIndividual ;
  skos:notation "High-quality draft genome" ;
  a MIXS:AssemblyQualEnum .

MIXS:AssemblyQualEnum.LOW_QUALITY_DRAFT_GENOME a owl:NamedIndividual ;
  skos:notation "Low-quality draft genome" ;
  a MIXS:AssemblyQualEnum .

MIXS:AssemblyQualEnum.MEDIUM_QUALITY_DRAFT_GENOME a owl:NamedIndividual ;
  skos:notation "Medium-quality draft genome" ;
  a MIXS:AssemblyQualEnum .

MIXS:BinParamEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:BinParamEnum.CODON_USAGE MIXS:BinParamEnum.COMBINATION MIXS:BinParamEnum.COVERAGE MIXS:BinParamEnum.HOMOLOGY_SEARCH MIXS:BinParamEnum.KMER )
  ] .

MIXS:BinParamEnum.CODON_USAGE a owl:NamedIndividual ;
  skos:notation "codon usage" ;
  a MIXS:BinParamEnum .

MIXS:BinParamEnum.COMBINATION a owl:NamedIndividual ;
  skos:notation "combination" ;
  a MIXS:BinParamEnum .

MIXS:BinParamEnum.COVERAGE a owl:NamedIndividual ;
  skos:notation "coverage" ;
  a MIXS:BinParamEnum .

MIXS:BinParamEnum.HOMOLOGY_SEARCH a owl:NamedIndividual ;
  skos:notation "homology search" ;
  a MIXS:BinParamEnum .

MIXS:BinParamEnum.KMER a owl:NamedIndividual ;
  skos:notation "kmer" ;
  a MIXS:BinParamEnum .

MIXS:BioCulturalLabelEnum a owl:Class ;
  rdfs:comment "Options defining community expectations about the appropriate use of the sequencing data, as specified by the LocalContexts project (https://localcontexts.org/labels/biocultural-labels/)." ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:BioCulturalLabelEnum.BIOCULTURAL_CLAN_LABEL_BC_CL MIXS:BioCulturalLabelEnum.BIOCULTURAL_CONSENT_NON_VERIFIED_LABEL_BC_CNV MIXS:BioCulturalLabelEnum.BIOCULTURAL_CONSENT_VERIFIED_LABEL_BC_CV MIXS:BioCulturalLabelEnum.BIOCULTURAL_MULTIPLE_COMMUNITIES_LABEL_BC_MC MIXS:BioCulturalLabelEnum.BIOCULTURAL_NON_COMMERCIAL_LABEL_BC_NC MIXS:BioCulturalLabelEnum.BIOCULTURAL_OPEN_TO_COLLABORATION_LABEL_BC_CB MIXS:BioCulturalLabelEnum.BIOCULTURAL_OPEN_TO_COMMERCIALISATION_LABEL_BC_OC MIXS:BioCulturalLabelEnum.BIOCULTURAL_OUTREACH_LABEL_BC_O MIXS:BioCulturalLabelEnum.BIOCULTURAL_PROVENANCE_LABEL_BC_P MIXS:BioCulturalLabelEnum.BIOCULTURAL_RESEARCH_USE_LABEL_BC_R )
  ] .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_CLAN_LABEL_BC_CL a owl:NamedIndividual ;
  skos:notation "Biocultural Clan Label (BC CL)" ;
  rdfs:comment "Biocultural Clan Label (BC CL) - This Label is being used to indicate that this material is traditionally and usually not publicly available. The Label lets future users know that this data has specific conditions for use and sharing because of clan membership and/or relationships (Full text https://localcontexts.org/label/bc-clan/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_CONSENT_NON_VERIFIED_LABEL_BC_CNV a owl:NamedIndividual ;
  skos:notation "Biocultural Consent Non-Verified Label (BC CNV)" ;
  rdfs:comment "Biocultural Consent Non-Verified Label (BC CNV) - This Label is being used because there are concerns about the accuracy of the consent and/or representations made for this data. This material was not created through informed consent or community protocols for research and engagement. (Full text https://localcontexts.org/label/bc-consent-non-verified/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_CONSENT_VERIFIED_LABEL_BC_CV a owl:NamedIndividual ;
  skos:notation "Biocultural Consent Verified Label (BC CV)" ;
  rdfs:comment "Biocultural Consent Verified Label (BC CV) - This Label is being used to verify that an associated community has consent conditions in place for the use of this information, collections, data, and digital sequence information. (Full text https://localcontexts.org/label/bc-consent-verified/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_MULTIPLE_COMMUNITIES_LABEL_BC_MC a owl:NamedIndividual ;
  skos:notation "Biocultural Multiple Communities Label (BC MC)" ;
  rdfs:comment "Biocultural Multiple Communities Label (BC MC) - This Label is being used to affirm that responsibility and ownership over this information, collection, data, and digital sequence information (DSI) is spread across several distinct communities (Full text https://localcontexts.org/label/bc-multiple-communities/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_NON_COMMERCIAL_LABEL_BC_NC a owl:NamedIndividual ;
  skos:notation "Biocultural Non-Commercial Label (BC NC)" ;
  rdfs:comment "Biocultural Non-Commercial Label (BC NC) - This Label is being used to indicate that these biocultural materials and/or data have been designated as being available for non-commercial use. (Full text https://localcontexts.org/label/bc-non-commercial/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_OPEN_TO_COLLABORATION_LABEL_BC_CB a owl:NamedIndividual ;
  skos:notation "Biocultural Open to Collaboration Label (BC CB)" ;
  rdfs:comment "Biocultural Open to Collaboration Label (BC CB) - This Label is being used to make clear an associated community is open to future engagement, collaboration, and partnership around research and outreach opportunities. (Full text https://localcontexts.org/label/bc-open-to-collaboration/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_OPEN_TO_COMMERCIALISATION_LABEL_BC_OC a owl:NamedIndividual ;
  skos:notation "Biocultural Open to Commercialisation Label (BC OC)" ;
  rdfs:comment "Biocultural Open to Commercialisation Label (BC OC) - This Label is being used to indicate that an associated community is open to commercialization opportunities that might derive from any information, collections, data, and digital sequence information (DSI) to which this Label is connected. (Full text https://localcontexts.org/label/bc-open-to-commercialization/)" ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_OUTREACH_LABEL_BC_O a owl:NamedIndividual ;
  skos:notation "Biocultural Outreach Label (BC O)" ;
  rdfs:comment "Biocultural Outreach Label (BC O) The Label is letting any users know that this data can be used for educational outreach activities. - (Full text https://localcontexts.org/label/bc-outreach/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_PROVENANCE_LABEL_BC_P a owl:NamedIndividual ;
  skos:notation "Biocultural Provenance Label (BC P):" ;
  rdfs:comment "Biocultural Provenance Label (BC P) - This Label is being used to affirm an inherent interest Indigenous people have in the scientific collections and data about communities, peoples, and the biodiversity found within traditional lands, waters and territories (Full text https://localcontexts.org/label/bc-provenance/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BioCulturalLabelEnum.BIOCULTURAL_RESEARCH_USE_LABEL_BC_R a owl:NamedIndividual ;
  skos:notation "Biocultural Research Use Label (BC R)" ;
  rdfs:comment "Biocultural Research Use Label (BC R) - This Label is being used by an associated community to allow this information, collection, data, and digital sequence information (DSI) to be used for unspecified research purposes. This Label does not provide permission for commercialization activities. (Full text https://localcontexts.org/label/bc-research-use/)." ;
  a MIXS:BioCulturalLabelEnum .

MIXS:BiolStatEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:BiolStatEnum.BREEDER_S_LINE MIXS:BiolStatEnum.CLONAL_SELECTION MIXS:BiolStatEnum.HYBRID MIXS:BiolStatEnum.INBRED_LINE MIXS:BiolStatEnum.MUTANT MIXS:BiolStatEnum.NATURAL MIXS:BiolStatEnum.SEMI_NATURAL MIXS:BiolStatEnum.WILD )
  ] .

MIXS:BiolStatEnum.BREEDER_S_LINE a owl:NamedIndividual ;
  skos:notation "breeder's line" ;
  a MIXS:BiolStatEnum .

MIXS:BiolStatEnum.CLONAL_SELECTION a owl:NamedIndividual ;
  skos:notation "clonal selection" ;
  a MIXS:BiolStatEnum .

MIXS:BiolStatEnum.HYBRID a owl:NamedIndividual ;
  skos:notation "hybrid" ;
  a MIXS:BiolStatEnum .

MIXS:BiolStatEnum.INBRED_LINE a owl:NamedIndividual ;
  skos:notation "inbred line" ;
  a MIXS:BiolStatEnum .

MIXS:BiolStatEnum.MUTANT a owl:NamedIndividual ;
  skos:notation "mutant" ;
  a MIXS:BiolStatEnum .

MIXS:BiolStatEnum.NATURAL a owl:NamedIndividual ;
  skos:notation "natural" ;
  a MIXS:BiolStatEnum .

MIXS:BiolStatEnum.SEMI_NATURAL a owl:NamedIndividual ;
  skos:notation "semi-natural" ;
  a MIXS:BiolStatEnum .

MIXS:BiolStatEnum.WILD a owl:NamedIndividual ;
  skos:notation "wild" ;
  a MIXS:BiolStatEnum .

MIXS:BioticRelationshipEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:BioticRelationshipEnum.COMMENSALISM MIXS:BioticRelationshipEnum.FREE_LIVING MIXS:BioticRelationshipEnum.MUTUALISM MIXS:BioticRelationshipEnum.PARASITISM MIXS:BioticRelationshipEnum.SYMBIOTIC )
  ] .

MIXS:BioticRelationshipEnum.COMMENSALISM a owl:NamedIndividual ;
  skos:notation "commensalism" ;
  a MIXS:BioticRelationshipEnum .

MIXS:BioticRelationshipEnum.FREE_LIVING a owl:NamedIndividual ;
  skos:notation "free living" ;
  a MIXS:BioticRelationshipEnum .

MIXS:BioticRelationshipEnum.MUTUALISM a owl:NamedIndividual ;
  skos:notation "mutualism" ;
  a MIXS:BioticRelationshipEnum .

MIXS:BioticRelationshipEnum.PARASITISM a owl:NamedIndividual ;
  skos:notation "parasitism" ;
  a MIXS:BioticRelationshipEnum .

MIXS:BioticRelationshipEnum.SYMBIOTIC a owl:NamedIndividual ;
  skos:notation "symbiotic" ;
  a MIXS:BioticRelationshipEnum .

MIXS:BuildDocsEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:BuildDocsEnum.BUILDING_INFORMATION_MODEL MIXS:BuildDocsEnum.COMMISSIONING_REPORT MIXS:BuildDocsEnum.COMPLAINT_LOGS MIXS:BuildDocsEnum.CONTRACT_ADMINISTRATION MIXS:BuildDocsEnum.COST_ESTIMATE MIXS:BuildDocsEnum.JANITORIAL_SCHEDULES_OR_LOGS MIXS:BuildDocsEnum.MAINTENANCE_PLANS MIXS:BuildDocsEnum.SCHEDULE MIXS:BuildDocsEnum.SECTIONS MIXS:BuildDocsEnum.SHOP_DRAWINGS MIXS:BuildDocsEnum.SUBMITTALS MIXS:BuildDocsEnum.VENTILATION_SYSTEM MIXS:BuildDocsEnum.WINDOWS )
  ] .

MIXS:BuildDocsEnum.BUILDING_INFORMATION_MODEL a owl:NamedIndividual ;
  skos:notation "building information model" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.COMMISSIONING_REPORT a owl:NamedIndividual ;
  skos:notation "commissioning report" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.COMPLAINT_LOGS a owl:NamedIndividual ;
  skos:notation "complaint logs" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.CONTRACT_ADMINISTRATION a owl:NamedIndividual ;
  skos:notation "contract administration" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.COST_ESTIMATE a owl:NamedIndividual ;
  skos:notation "cost estimate" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.JANITORIAL_SCHEDULES_OR_LOGS a owl:NamedIndividual ;
  skos:notation "janitorial schedules or logs" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.MAINTENANCE_PLANS a owl:NamedIndividual ;
  skos:notation "maintenance plans" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.SCHEDULE a owl:NamedIndividual ;
  skos:notation "schedule" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.SECTIONS a owl:NamedIndividual ;
  skos:notation "sections" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.SHOP_DRAWINGS a owl:NamedIndividual ;
  skos:notation "shop drawings" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.SUBMITTALS a owl:NamedIndividual ;
  skos:notation "submittals" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.VENTILATION_SYSTEM a owl:NamedIndividual ;
  skos:notation "ventilation system" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildDocsEnum.WINDOWS a owl:NamedIndividual ;
  skos:notation "windows" ;
  a MIXS:BuildDocsEnum .

MIXS:BuildOccupTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:BuildOccupTypeEnum.AIRPORT MIXS:BuildOccupTypeEnum.COMMERCIAL MIXS:BuildOccupTypeEnum.HEALTH_CARE MIXS:BuildOccupTypeEnum.HIGH_RISE MIXS:BuildOccupTypeEnum.LOW_RISE MIXS:BuildOccupTypeEnum.MARKET MIXS:BuildOccupTypeEnum.OFFICE MIXS:BuildOccupTypeEnum.RESIDENCE MIXS:BuildOccupTypeEnum.RESIDENTIAL MIXS:BuildOccupTypeEnum.RESTAURANT MIXS:BuildOccupTypeEnum.SCHOOL MIXS:BuildOccupTypeEnum.SPORTS_COMPLEX MIXS:BuildOccupTypeEnum.WOOD_FRAMED )
  ] .

MIXS:BuildOccupTypeEnum.AIRPORT a owl:NamedIndividual ;
  skos:notation "airport" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.COMMERCIAL a owl:NamedIndividual ;
  skos:notation "commercial" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.HEALTH_CARE a owl:NamedIndividual ;
  skos:notation "health care" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.HIGH_RISE a owl:NamedIndividual ;
  skos:notation "high rise" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.LOW_RISE a owl:NamedIndividual ;
  skos:notation "low rise" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.MARKET a owl:NamedIndividual ;
  skos:notation "market" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.OFFICE a owl:NamedIndividual ;
  skos:notation "office" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.RESIDENCE a owl:NamedIndividual ;
  skos:notation "residence" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.RESIDENTIAL a owl:NamedIndividual ;
  skos:notation "residential" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.RESTAURANT a owl:NamedIndividual ;
  skos:notation "restaurant" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.SCHOOL a owl:NamedIndividual ;
  skos:notation "school" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.SPORTS_COMPLEX a owl:NamedIndividual ;
  skos:notation "sports complex" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildOccupTypeEnum.WOOD_FRAMED a owl:NamedIndividual ;
  skos:notation "wood framed" ;
  a MIXS:BuildOccupTypeEnum .

MIXS:BuildingSettingEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:BuildingSettingEnum.EXURBAN MIXS:BuildingSettingEnum.RURAL MIXS:BuildingSettingEnum.SUBURBAN MIXS:BuildingSettingEnum.URBAN )
  ] .

MIXS:BuildingSettingEnum.EXURBAN a owl:NamedIndividual ;
  skos:notation "exurban" ;
  a MIXS:BuildingSettingEnum .

MIXS:BuildingSettingEnum.RURAL a owl:NamedIndividual ;
  skos:notation "rural" ;
  a MIXS:BuildingSettingEnum .

MIXS:BuildingSettingEnum.SUBURBAN a owl:NamedIndividual ;
  skos:notation "suburban" ;
  a MIXS:BuildingSettingEnum .

MIXS:BuildingSettingEnum.URBAN a owl:NamedIndividual ;
  skos:notation "urban" ;
  a MIXS:BuildingSettingEnum .

MIXS:BuiltStrucSetEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:BuiltStrucSetEnum.RURAL MIXS:BuiltStrucSetEnum.URBAN )
  ] .

MIXS:BuiltStrucSetEnum.RURAL a owl:NamedIndividual ;
  skos:notation "rural" ;
  a MIXS:BuiltStrucSetEnum .

MIXS:BuiltStrucSetEnum.URBAN a owl:NamedIndividual ;
  skos:notation "urban" ;
  a MIXS:BuiltStrucSetEnum .

MIXS:CeilFinishMatEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:CeilFinishMatEnum.PVC MIXS:CeilFinishMatEnum.DRYWALL MIXS:CeilFinishMatEnum.FIBERGLASS MIXS:CeilFinishMatEnum.METAL MIXS:CeilFinishMatEnum.MINERAL_FIBRE MIXS:CeilFinishMatEnum.MINERAL_WOOL_CALCIUM_SILICATE MIXS:CeilFinishMatEnum.PLASTERBOARD MIXS:CeilFinishMatEnum.STUCCO MIXS:CeilFinishMatEnum.TILES MIXS:CeilFinishMatEnum.WOOD )
  ] .

MIXS:CeilFinishMatEnum.PVC a owl:NamedIndividual ;
  skos:notation "PVC" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.DRYWALL a owl:NamedIndividual ;
  skos:notation "drywall" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.FIBERGLASS a owl:NamedIndividual ;
  skos:notation "fiberglass" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.METAL a owl:NamedIndividual ;
  skos:notation "metal" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.MINERAL_FIBRE a owl:NamedIndividual ;
  skos:notation "mineral fibre" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.MINERAL_WOOL_CALCIUM_SILICATE a owl:NamedIndividual ;
  skos:notation "mineral wool/calcium silicate" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.PLASTERBOARD a owl:NamedIndividual ;
  skos:notation "plasterboard" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.STUCCO a owl:NamedIndividual ;
  skos:notation "stucco" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.TILES a owl:NamedIndividual ;
  skos:notation "tiles" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilFinishMatEnum.WOOD a owl:NamedIndividual ;
  skos:notation "wood" ;
  a MIXS:CeilFinishMatEnum .

MIXS:CeilStrucEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:CeilStrucEnum.CONCRETE MIXS:CeilStrucEnum.WOOD_FRAME )
  ] .

MIXS:CeilStrucEnum.CONCRETE a owl:NamedIndividual ;
  skos:notation "concrete" ;
  a MIXS:CeilStrucEnum .

MIXS:CeilStrucEnum.WOOD_FRAME a owl:NamedIndividual ;
  skos:notation "wood frame" ;
  a MIXS:CeilStrucEnum .

MIXS:CeilTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:CeilTypeEnum.BARREL_SHAPED MIXS:CeilTypeEnum.CATHEDRAL MIXS:CeilTypeEnum.COFFERED MIXS:CeilTypeEnum.CONCAVE MIXS:CeilTypeEnum.COVE MIXS:CeilTypeEnum.DROPPED MIXS:CeilTypeEnum.STRETCHED )
  ] .

MIXS:CeilTypeEnum.BARREL_SHAPED a owl:NamedIndividual ;
  skos:notation "barrel-shaped" ;
  a MIXS:CeilTypeEnum .

MIXS:CeilTypeEnum.CATHEDRAL a owl:NamedIndividual ;
  skos:notation "cathedral" ;
  a MIXS:CeilTypeEnum .

MIXS:CeilTypeEnum.COFFERED a owl:NamedIndividual ;
  skos:notation "coffered" ;
  a MIXS:CeilTypeEnum .

MIXS:CeilTypeEnum.CONCAVE a owl:NamedIndividual ;
  skos:notation "concave" ;
  a MIXS:CeilTypeEnum .

MIXS:CeilTypeEnum.COVE a owl:NamedIndividual ;
  skos:notation "cove" ;
  a MIXS:CeilTypeEnum .

MIXS:CeilTypeEnum.DROPPED a owl:NamedIndividual ;
  skos:notation "dropped" ;
  a MIXS:CeilTypeEnum .

MIXS:CeilTypeEnum.STRETCHED a owl:NamedIndividual ;
  skos:notation "stretched" ;
  a MIXS:CeilTypeEnum .

MIXS:CeilingWallTextureEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:CeilingWallTextureEnum.SANTA_FE_TEXTURE MIXS:CeilingWallTextureEnum.CROWS_FEET MIXS:CeilingWallTextureEnum.CROWS_FOOT_STOMP MIXS:CeilingWallTextureEnum.DOUBLE_SKIP MIXS:CeilingWallTextureEnum.HAWK_AND_TROWEL MIXS:CeilingWallTextureEnum.KNOCKDOWN MIXS:CeilingWallTextureEnum.ORANGE_PEEL MIXS:CeilingWallTextureEnum.POPCORN MIXS:CeilingWallTextureEnum.ROSEBUD_STOMP MIXS:CeilingWallTextureEnum.SKIP_TROWEL MIXS:CeilingWallTextureEnum.SMOOTH MIXS:CeilingWallTextureEnum.STOMP_KNOCKDOWN MIXS:CeilingWallTextureEnum.SWIRL )
  ] .

MIXS:CeilingWallTextureEnum.SANTA_FE_TEXTURE a owl:NamedIndividual ;
  skos:notation "Santa-Fe texture" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.CROWS_FEET a owl:NamedIndividual ;
  skos:notation "crows feet" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.CROWS_FOOT_STOMP a owl:NamedIndividual ;
  skos:notation "crows-foot stomp" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.DOUBLE_SKIP a owl:NamedIndividual ;
  skos:notation "double skip" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.HAWK_AND_TROWEL a owl:NamedIndividual ;
  skos:notation "hawk and trowel" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.KNOCKDOWN a owl:NamedIndividual ;
  skos:notation "knockdown" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.ORANGE_PEEL a owl:NamedIndividual ;
  skos:notation "orange peel" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.POPCORN a owl:NamedIndividual ;
  skos:notation "popcorn" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.ROSEBUD_STOMP a owl:NamedIndividual ;
  skos:notation "rosebud stomp" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.SKIP_TROWEL a owl:NamedIndividual ;
  skos:notation "skip trowel" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.SMOOTH a owl:NamedIndividual ;
  skos:notation "smooth" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.STOMP_KNOCKDOWN a owl:NamedIndividual ;
  skos:notation "stomp knockdown" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:CeilingWallTextureEnum.SWIRL a owl:NamedIndividual ;
  skos:notation "swirl" ;
  a MIXS:CeilingWallTextureEnum .

MIXS:ChronoAgeProtocolEnum a owl:Class ;
  rdfs:comment "Options for methods to determine the age at time of death of an organism or the date of sample deposition." ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ChronoAgeProtocolEnum.AGE_DEPTH_MODELLING MIXS:ChronoAgeProtocolEnum.AMINO_ACID_RACEMISATION MIXS:ChronoAgeProtocolEnum.ASSOCIATED_ABSOLUTE_DATING MIXS:ChronoAgeProtocolEnum.CONTEXTUAL_DATING MIXS:ChronoAgeProtocolEnum.ELECTRON_SPIN_RESONANCE MIXS:ChronoAgeProtocolEnum.HISTORICAL_RECORDS MIXS:ChronoAgeProtocolEnum.OPTICALLY_STIMULATED_INFRARED_LUMINESCENCE MIXS:ChronoAgeProtocolEnum.OTHER MIXS:ChronoAgeProtocolEnum.RADIOCARBON_DATING MIXS:ChronoAgeProtocolEnum.URANIUM_THORIUM )
  ] .

MIXS:ChronoAgeProtocolEnum.AGE_DEPTH_MODELLING a owl:NamedIndividual ;
  skos:notation "age-depth modelling" ;
  rdfs:comment "Age-depth models are constructed based on limited numbers of dated depths (typically in sediment cores) to estimate the calendar ages. Different models are used based on assumptions about the sequence of deposit formation at each dated depth." ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.AMINO_ACID_RACEMISATION a owl:NamedIndividual ;
  skos:notation "amino acid racemisation" ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.ASSOCIATED_ABSOLUTE_DATING a owl:NamedIndividual ;
  skos:notation "associated absolute dating" ;
  rdfs:comment "Dates inferred from the absolute dates of associated materials within the same specific context of the sample (e.g. C14 dating of a animal bone artefact in the same context of a human burial)." ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.CONTEXTUAL_DATING a owl:NamedIndividual ;
  skos:notation "contextual dating" ;
  rdfs:comment "A non-absolute date inferred from the specific context of an archaeological or palaeontological sample (e.g. stratigraphic layers, coins)." ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.ELECTRON_SPIN_RESONANCE a owl:NamedIndividual ;
  skos:notation "electron spin resonance" ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.HISTORICAL_RECORDS a owl:NamedIndividual ;
  skos:notation "historical records" ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.OPTICALLY_STIMULATED_INFRARED_LUMINESCENCE a owl:NamedIndividual ;
  skos:notation "optically stimulated infrared luminescence" ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.RADIOCARBON_DATING a owl:NamedIndividual ;
  skos:notation "radiocarbon dating" ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeProtocolEnum.URANIUM_THORIUM a owl:NamedIndividual ;
  skos:notation "uranium thorium" ;
  a MIXS:ChronoAgeProtocolEnum .

MIXS:ChronoAgeSysEnum a owl:Class ;
  rdfs:comment "Options for specifying the chonometric age reference or timescale of a date." ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ChronoAgeSysEnum.BCE MIXS:ChronoAgeSysEnum.BP MIXS:ChronoAgeSysEnum.CE MIXS:ChronoAgeSysEnum.MA MIXS:ChronoAgeSysEnum.CAL_BCE MIXS:ChronoAgeSysEnum.CAL_BP MIXS:ChronoAgeSysEnum.CAL_CE MIXS:ChronoAgeSysEnum.KA )
  ] .

MIXS:ChronoAgeSysEnum.BCE a owl:NamedIndividual ;
  skos:notation "BCE" ;
  rdfs:comment "Before Common Era (before year 0 in the Christian calendar), equivalent to BC (before Christ)." ;
  a MIXS:ChronoAgeSysEnum .

MIXS:ChronoAgeSysEnum.BP a owl:NamedIndividual ;
  skos:notation "BP" ;
  rdfs:comment "Before Present (~1950), known as 'Standard Year'." ;
  a MIXS:ChronoAgeSysEnum .

MIXS:ChronoAgeSysEnum.CE a owl:NamedIndividual ;
  skos:notation "CE" ;
  rdfs:comment "Common Era (after year 0 in the Christian calendar), equivalent to AD (anno Domini, after Christ)." ;
  a MIXS:ChronoAgeSysEnum .

MIXS:ChronoAgeSysEnum.MA a owl:NamedIndividual ;
  skos:notation "Ma" ;
  rdfs:comment "megaannum; millions of years ago." ;
  a MIXS:ChronoAgeSysEnum .

MIXS:ChronoAgeSysEnum.CAL_BCE a owl:NamedIndividual ;
  skos:notation "cal BCE" ;
  rdfs:comment "Calibrated Before Common Era (year 0 in the Christian calendar), equivalent to BC (before Christ)." ;
  a MIXS:ChronoAgeSysEnum .

MIXS:ChronoAgeSysEnum.CAL_BP a owl:NamedIndividual ;
  skos:notation "cal BP" ;
  rdfs:comment "Calibrated Before Present (~1950), known as 'Standard Year'." ;
  a MIXS:ChronoAgeSysEnum .

MIXS:ChronoAgeSysEnum.CAL_CE a owl:NamedIndividual ;
  skos:notation "cal CE" ;
  rdfs:comment "Calibrated Common Era (~1950), equivalent to AD (anno Domini, after Christ)." ;
  a MIXS:ChronoAgeSysEnum .

MIXS:ChronoAgeSysEnum.KA a owl:NamedIndividual ;
  skos:notation "ka" ;
  rdfs:comment "kiloannum; thousands of years ago." ;
  a MIXS:ChronoAgeSysEnum .

MIXS:CompassDirections8Enum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:CompassDirections8Enum.EAST MIXS:CompassDirections8Enum.NORTH MIXS:CompassDirections8Enum.NORTHEAST MIXS:CompassDirections8Enum.NORTHWEST MIXS:CompassDirections8Enum.SOUTH MIXS:CompassDirections8Enum.SOUTHEAST MIXS:CompassDirections8Enum.SOUTHWEST MIXS:CompassDirections8Enum.WEST )
  ] .

MIXS:CompassDirections8Enum.EAST a owl:NamedIndividual ;
  skos:notation "east" ;
  a MIXS:CompassDirections8Enum .

MIXS:CompassDirections8Enum.NORTH a owl:NamedIndividual ;
  skos:notation "north" ;
  a MIXS:CompassDirections8Enum .

MIXS:CompassDirections8Enum.NORTHEAST a owl:NamedIndividual ;
  skos:notation "northeast" ;
  a MIXS:CompassDirections8Enum .

MIXS:CompassDirections8Enum.NORTHWEST a owl:NamedIndividual ;
  skos:notation "northwest" ;
  a MIXS:CompassDirections8Enum .

MIXS:CompassDirections8Enum.SOUTH a owl:NamedIndividual ;
  skos:notation "south" ;
  a MIXS:CompassDirections8Enum .

MIXS:CompassDirections8Enum.SOUTHEAST a owl:NamedIndividual ;
  skos:notation "southeast" ;
  a MIXS:CompassDirections8Enum .

MIXS:CompassDirections8Enum.SOUTHWEST a owl:NamedIndividual ;
  skos:notation "southwest" ;
  a MIXS:CompassDirections8Enum .

MIXS:CompassDirections8Enum.WEST a owl:NamedIndividual ;
  skos:notation "west" ;
  a MIXS:CompassDirections8Enum .

MIXS:ComplApprEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ComplApprEnum.MARKER_GENE MIXS:ComplApprEnum.OTHER MIXS:ComplApprEnum.REFERENCE_BASED )
  ] .

MIXS:ComplApprEnum.MARKER_GENE a owl:NamedIndividual ;
  skos:notation "marker gene" ;
  a MIXS:ComplApprEnum .

MIXS:ComplApprEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:ComplApprEnum .

MIXS:ComplApprEnum.REFERENCE_BASED a owl:NamedIndividual ;
  skos:notation "reference based" ;
  a MIXS:ComplApprEnum .

MIXS:ContamScreenInputEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ContamScreenInputEnum.CONTIGS MIXS:ContamScreenInputEnum.READS )
  ] .

MIXS:ContamScreenInputEnum.CONTIGS a owl:NamedIndividual ;
  skos:notation "contigs" ;
  a MIXS:ContamScreenInputEnum .

MIXS:ContamScreenInputEnum.READS a owl:NamedIndividual ;
  skos:notation "reads" ;
  a MIXS:ContamScreenInputEnum .

MIXS:CultResultEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:CultResultEnum.ABSENT MIXS:CultResultEnum.ACTIVE MIXS:CultResultEnum.INACTIVE MIXS:CultResultEnum.NEGATIVE MIXS:CultResultEnum.NO MIXS:CultResultEnum.POSITIVE MIXS:CultResultEnum.PRESENT MIXS:CultResultEnum.YES )
  ] .

MIXS:CultResultEnum.ABSENT a owl:NamedIndividual ;
  skos:notation "absent" ;
  a MIXS:CultResultEnum .

MIXS:CultResultEnum.ACTIVE a owl:NamedIndividual ;
  skos:notation "active" ;
  a MIXS:CultResultEnum .

MIXS:CultResultEnum.INACTIVE a owl:NamedIndividual ;
  skos:notation "inactive" ;
  a MIXS:CultResultEnum .

MIXS:CultResultEnum.NEGATIVE a owl:NamedIndividual ;
  skos:notation "negative" ;
  a MIXS:CultResultEnum .

MIXS:CultResultEnum.NO a owl:NamedIndividual ;
  skos:notation "no" ;
  a MIXS:CultResultEnum .

MIXS:CultResultEnum.POSITIVE a owl:NamedIndividual ;
  skos:notation "positive" ;
  a MIXS:CultResultEnum .

MIXS:CultResultEnum.PRESENT a owl:NamedIndividual ;
  skos:notation "present" ;
  a MIXS:CultResultEnum .

MIXS:CultResultEnum.YES a owl:NamedIndividual ;
  skos:notation "yes" ;
  a MIXS:CultResultEnum .

MIXS:DamageTreatmentEnum a owl:Class ;
  rdfs:comment "Options for types of molecular damage removal during library construction of ancient DNA libraries." ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DamageTreatmentEnum.COMPLETE_REMOVAL MIXS:DamageTreatmentEnum.DAMAGE_SELECTION MIXS:DamageTreatmentEnum.NO_REMOVAL MIXS:DamageTreatmentEnum.OTHER MIXS:DamageTreatmentEnum.PARTIAL_REMOVAL )
  ] .

MIXS:DamageTreatmentEnum.COMPLETE_REMOVAL a owl:NamedIndividual ;
  skos:notation "complete-removal" ;
  rdfs:comment "Molecular damage-derived misincorporations have been entirely removed using laboratory techniques such as with complete uracil-DNA glycosylase (UDG) or USER treatment, leaving no nucleotides with damage at ends of molecules." ;
  a MIXS:DamageTreatmentEnum .

MIXS:DamageTreatmentEnum.DAMAGE_SELECTION a owl:NamedIndividual ;
  skos:notation "damage-selection" ;
  rdfs:comment "Library preparation-derived technique that retain only molecules containing damage, and have discarded those without damage." ;
  a MIXS:DamageTreatmentEnum .

MIXS:DamageTreatmentEnum.NO_REMOVAL a owl:NamedIndividual ;
  skos:notation "no-removal" ;
  rdfs:comment "Molecular damage-derived misincorporations have not been removed using laboratory techniques." ;
  a MIXS:DamageTreatmentEnum .

MIXS:DamageTreatmentEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  rdfs:comment "Other types of damage treatment that are further described in other method description terms. If damage has been removed, but whether full or partial is unknown - use this option and describe known information in `sop_experimental` and related free text descriptive terms." ;
  a MIXS:DamageTreatmentEnum .

MIXS:DamageTreatmentEnum.PARTIAL_REMOVAL a owl:NamedIndividual ;
  skos:notation "partial-removal" ;
  rdfs:comment "Molecular damage-derived misincorporations have been partially removed using laboratory techniques such as with an early stopped uracil-DNA glycosylase (UDG) or USER treatment, leaving a small number of nucleotides with damage at ends of molecules." ;
  a MIXS:DamageTreatmentEnum .

MIXS:DamagedEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DamagedEnum.DAMAGED MIXS:DamagedEnum.NEEDS_REPAIR MIXS:DamagedEnum.NEW MIXS:DamagedEnum.RUPTURE MIXS:DamagedEnum.VISIBLE_WEAR )
  ] .

MIXS:DamagedEnum.DAMAGED a owl:NamedIndividual ;
  skos:notation "damaged" ;
  a MIXS:DamagedEnum .

MIXS:DamagedEnum.NEEDS_REPAIR a owl:NamedIndividual ;
  skos:notation "needs repair" ;
  a MIXS:DamagedEnum .

MIXS:DamagedEnum.NEW a owl:NamedIndividual ;
  skos:notation "new" ;
  a MIXS:DamagedEnum .

MIXS:DamagedEnum.RUPTURE a owl:NamedIndividual ;
  skos:notation "rupture" ;
  a MIXS:DamagedEnum .

MIXS:DamagedEnum.VISIBLE_WEAR a owl:NamedIndividual ;
  skos:notation "visible wear" ;
  a MIXS:DamagedEnum .

MIXS:DamagedRupturedEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DamagedRupturedEnum.DAMAGED MIXS:DamagedRupturedEnum.NEEDS_REPAIR MIXS:DamagedRupturedEnum.NEW MIXS:DamagedRupturedEnum.RUPTURE MIXS:DamagedRupturedEnum.VISIBLE_WEAR )
  ] .

MIXS:DamagedRupturedEnum.DAMAGED a owl:NamedIndividual ;
  skos:notation "damaged" ;
  a MIXS:DamagedRupturedEnum .

MIXS:DamagedRupturedEnum.NEEDS_REPAIR a owl:NamedIndividual ;
  skos:notation "needs repair" ;
  a MIXS:DamagedRupturedEnum .

MIXS:DamagedRupturedEnum.NEW a owl:NamedIndividual ;
  skos:notation "new" ;
  a MIXS:DamagedRupturedEnum .

MIXS:DamagedRupturedEnum.RUPTURE a owl:NamedIndividual ;
  skos:notation "rupture" ;
  a MIXS:DamagedRupturedEnum .

MIXS:DamagedRupturedEnum.VISIBLE_WEAR a owl:NamedIndividual ;
  skos:notation "visible wear" ;
  a MIXS:DamagedRupturedEnum .

MIXS:DeposEnvEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DeposEnvEnum.CONTINENTAL_AEOLIAN MIXS:DeposEnvEnum.CONTINENTAL_ALLUVIAL MIXS:DeposEnvEnum.CONTINENTAL_FLUVIAL MIXS:DeposEnvEnum.CONTINENTAL_LACUSTRINE MIXS:DeposEnvEnum.MARINE_DEEP MIXS:DeposEnvEnum.MARINE_REEF MIXS:DeposEnvEnum.MARINE_SHALLOW MIXS:DeposEnvEnum.OTHER_EVAPORITE MIXS:DeposEnvEnum.OTHER_GLACIAL MIXS:DeposEnvEnum.OTHER_VOLCANIC MIXS:DeposEnvEnum.TRANSITIONAL_BEACH MIXS:DeposEnvEnum.TRANSITIONAL_DELTAIC MIXS:DeposEnvEnum.TRANSITIONAL_LAGOONAL MIXS:DeposEnvEnum.TRANSITIONAL_LAKE MIXS:DeposEnvEnum.TRANSITIONAL_TIDAL MIXS:DeposEnvEnum.OTHER )
  ] .

MIXS:DeposEnvEnum.CONTINENTAL_AEOLIAN a owl:NamedIndividual ;
  skos:notation "Continental - Aeolian" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.CONTINENTAL_ALLUVIAL a owl:NamedIndividual ;
  skos:notation "Continental - Alluvial" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.CONTINENTAL_FLUVIAL a owl:NamedIndividual ;
  skos:notation "Continental - Fluvial" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.CONTINENTAL_LACUSTRINE a owl:NamedIndividual ;
  skos:notation "Continental - Lacustrine" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.MARINE_DEEP a owl:NamedIndividual ;
  skos:notation "Marine - Deep" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.MARINE_REEF a owl:NamedIndividual ;
  skos:notation "Marine - Reef" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.MARINE_SHALLOW a owl:NamedIndividual ;
  skos:notation "Marine - Shallow" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.OTHER_EVAPORITE a owl:NamedIndividual ;
  skos:notation "Other - Evaporite" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.OTHER_GLACIAL a owl:NamedIndividual ;
  skos:notation "Other - Glacial" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.OTHER_VOLCANIC a owl:NamedIndividual ;
  skos:notation "Other - Volcanic" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.TRANSITIONAL_BEACH a owl:NamedIndividual ;
  skos:notation "Transitional - Beach" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.TRANSITIONAL_DELTAIC a owl:NamedIndividual ;
  skos:notation "Transitional - Deltaic" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.TRANSITIONAL_LAGOONAL a owl:NamedIndividual ;
  skos:notation "Transitional - Lagoonal" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.TRANSITIONAL_LAKE a owl:NamedIndividual ;
  skos:notation "Transitional - Lake" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.TRANSITIONAL_TIDAL a owl:NamedIndividual ;
  skos:notation "Transitional - Tidal" ;
  a MIXS:DeposEnvEnum .

MIXS:DeposEnvEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:DeposEnvEnum .

MIXS:DominantHandEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DominantHandEnum.AMBIDEXTROUS MIXS:DominantHandEnum.LEFT MIXS:DominantHandEnum.RIGHT )
  ] .

MIXS:DominantHandEnum.AMBIDEXTROUS a owl:NamedIndividual ;
  skos:notation "ambidextrous" ;
  a MIXS:DominantHandEnum .

MIXS:DominantHandEnum.LEFT a owl:NamedIndividual ;
  skos:notation "left" ;
  a MIXS:DominantHandEnum .

MIXS:DominantHandEnum.RIGHT a owl:NamedIndividual ;
  skos:notation "right" ;
  a MIXS:DominantHandEnum .

MIXS:DoorCompTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DoorCompTypeEnum.METAL_COVERED MIXS:DoorCompTypeEnum.REVOLVING MIXS:DoorCompTypeEnum.SLIDING MIXS:DoorCompTypeEnum.TELESCOPIC )
  ] .

MIXS:DoorCompTypeEnum.METAL_COVERED a owl:NamedIndividual ;
  skos:notation "metal covered" ;
  a MIXS:DoorCompTypeEnum .

MIXS:DoorCompTypeEnum.REVOLVING a owl:NamedIndividual ;
  skos:notation "revolving" ;
  a MIXS:DoorCompTypeEnum .

MIXS:DoorCompTypeEnum.SLIDING a owl:NamedIndividual ;
  skos:notation "sliding" ;
  a MIXS:DoorCompTypeEnum .

MIXS:DoorCompTypeEnum.TELESCOPIC a owl:NamedIndividual ;
  skos:notation "telescopic" ;
  a MIXS:DoorCompTypeEnum .

MIXS:DoorDirectEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DoorDirectEnum.INWARD MIXS:DoorDirectEnum.OUTWARD MIXS:DoorDirectEnum.SIDEWAYS )
  ] .

MIXS:DoorDirectEnum.INWARD a owl:NamedIndividual ;
  skos:notation "inward" ;
  a MIXS:DoorDirectEnum .

MIXS:DoorDirectEnum.OUTWARD a owl:NamedIndividual ;
  skos:notation "outward" ;
  a MIXS:DoorDirectEnum .

MIXS:DoorDirectEnum.SIDEWAYS a owl:NamedIndividual ;
  skos:notation "sideways" ;
  a MIXS:DoorDirectEnum .

MIXS:DoorMatEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DoorMatEnum.ALUMINUM MIXS:DoorMatEnum.CELLULAR_PVC MIXS:DoorMatEnum.ENGINEERED_PLASTIC MIXS:DoorMatEnum.FIBERBOARD MIXS:DoorMatEnum.FIBERGLASS MIXS:DoorMatEnum.METAL MIXS:DoorMatEnum.THERMOPLASTIC_ALLOY MIXS:DoorMatEnum.VINYL MIXS:DoorMatEnum.WOOD MIXS:DoorMatEnum.WOOD_PLASTIC_COMPOSITE )
  ] .

MIXS:DoorMatEnum.ALUMINUM a owl:NamedIndividual ;
  skos:notation "aluminum" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.CELLULAR_PVC a owl:NamedIndividual ;
  skos:notation "cellular PVC" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.ENGINEERED_PLASTIC a owl:NamedIndividual ;
  skos:notation "engineered plastic" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.FIBERBOARD a owl:NamedIndividual ;
  skos:notation "fiberboard" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.FIBERGLASS a owl:NamedIndividual ;
  skos:notation "fiberglass" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.METAL a owl:NamedIndividual ;
  skos:notation "metal" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.THERMOPLASTIC_ALLOY a owl:NamedIndividual ;
  skos:notation "thermoplastic alloy" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.VINYL a owl:NamedIndividual ;
  skos:notation "vinyl" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.WOOD a owl:NamedIndividual ;
  skos:notation "wood" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMatEnum.WOOD_PLASTIC_COMPOSITE a owl:NamedIndividual ;
  skos:notation "wood/plastic composite" ;
  a MIXS:DoorMatEnum .

MIXS:DoorMoveEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DoorMoveEnum.COLLAPSIBLE MIXS:DoorMoveEnum.FOLDING MIXS:DoorMoveEnum.REVOLVING MIXS:DoorMoveEnum.ROLLING_SHUTTER MIXS:DoorMoveEnum.SLIDING MIXS:DoorMoveEnum.SWINGING )
  ] .

MIXS:DoorMoveEnum.COLLAPSIBLE a owl:NamedIndividual ;
  skos:notation "collapsible" ;
  a MIXS:DoorMoveEnum .

MIXS:DoorMoveEnum.FOLDING a owl:NamedIndividual ;
  skos:notation "folding" ;
  a MIXS:DoorMoveEnum .

MIXS:DoorMoveEnum.REVOLVING a owl:NamedIndividual ;
  skos:notation "revolving" ;
  a MIXS:DoorMoveEnum .

MIXS:DoorMoveEnum.ROLLING_SHUTTER a owl:NamedIndividual ;
  skos:notation "rolling shutter" ;
  a MIXS:DoorMoveEnum .

MIXS:DoorMoveEnum.SLIDING a owl:NamedIndividual ;
  skos:notation "sliding" ;
  a MIXS:DoorMoveEnum .

MIXS:DoorMoveEnum.SWINGING a owl:NamedIndividual ;
  skos:notation "swinging" ;
  a MIXS:DoorMoveEnum .

MIXS:DoorTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DoorTypeEnum.COMPOSITE MIXS:DoorTypeEnum.METAL MIXS:DoorTypeEnum.WOODEN )
  ] .

MIXS:DoorTypeEnum.COMPOSITE a owl:NamedIndividual ;
  skos:notation "composite" ;
  a MIXS:DoorTypeEnum .

MIXS:DoorTypeEnum.METAL a owl:NamedIndividual ;
  skos:notation "metal" ;
  a MIXS:DoorTypeEnum .

MIXS:DoorTypeEnum.WOODEN a owl:NamedIndividual ;
  skos:notation "wooden" ;
  a MIXS:DoorTypeEnum .

MIXS:DoorTypeMetalEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DoorTypeMetalEnum.COLLAPSIBLE MIXS:DoorTypeMetalEnum.CORRUGATED_STEEL MIXS:DoorTypeMetalEnum.HOLLOW MIXS:DoorTypeMetalEnum.ROLLING_SHUTTERS MIXS:DoorTypeMetalEnum.STEEL_PLATE )
  ] .

MIXS:DoorTypeMetalEnum.COLLAPSIBLE a owl:NamedIndividual ;
  skos:notation "collapsible" ;
  a MIXS:DoorTypeMetalEnum .

MIXS:DoorTypeMetalEnum.CORRUGATED_STEEL a owl:NamedIndividual ;
  skos:notation "corrugated steel" ;
  a MIXS:DoorTypeMetalEnum .

MIXS:DoorTypeMetalEnum.HOLLOW a owl:NamedIndividual ;
  skos:notation "hollow" ;
  a MIXS:DoorTypeMetalEnum .

MIXS:DoorTypeMetalEnum.ROLLING_SHUTTERS a owl:NamedIndividual ;
  skos:notation "rolling shutters" ;
  a MIXS:DoorTypeMetalEnum .

MIXS:DoorTypeMetalEnum.STEEL_PLATE a owl:NamedIndividual ;
  skos:notation "steel plate" ;
  a MIXS:DoorTypeMetalEnum .

MIXS:DrainageClassEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DrainageClassEnum.EXCESSIVELY_DRAINED MIXS:DrainageClassEnum.MODERATELY_WELL MIXS:DrainageClassEnum.POORLY MIXS:DrainageClassEnum.SOMEWHAT_POORLY MIXS:DrainageClassEnum.VERY_POORLY MIXS:DrainageClassEnum.WELL )
  ] .

MIXS:DrainageClassEnum.EXCESSIVELY_DRAINED a owl:NamedIndividual ;
  skos:notation "excessively drained" ;
  a MIXS:DrainageClassEnum .

MIXS:DrainageClassEnum.MODERATELY_WELL a owl:NamedIndividual ;
  skos:notation "moderately well" ;
  a MIXS:DrainageClassEnum .

MIXS:DrainageClassEnum.POORLY a owl:NamedIndividual ;
  skos:notation "poorly" ;
  a MIXS:DrainageClassEnum .

MIXS:DrainageClassEnum.SOMEWHAT_POORLY a owl:NamedIndividual ;
  skos:notation "somewhat poorly" ;
  a MIXS:DrainageClassEnum .

MIXS:DrainageClassEnum.VERY_POORLY a owl:NamedIndividual ;
  skos:notation "very poorly" ;
  a MIXS:DrainageClassEnum .

MIXS:DrainageClassEnum.WELL a owl:NamedIndividual ;
  skos:notation "well" ;
  a MIXS:DrainageClassEnum .

MIXS:DrawingsEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:DrawingsEnum.AS_BUILT MIXS:DrawingsEnum.BID MIXS:DrawingsEnum.BUILDING_NAVIGATION_MAP MIXS:DrawingsEnum.CONSTRUCTION MIXS:DrawingsEnum.DESIGN MIXS:DrawingsEnum.DIAGRAM MIXS:DrawingsEnum.OPERATION MIXS:DrawingsEnum.SKETCH )
  ] .

MIXS:DrawingsEnum.AS_BUILT a owl:NamedIndividual ;
  skos:notation "as built" ;
  a MIXS:DrawingsEnum .

MIXS:DrawingsEnum.BID a owl:NamedIndividual ;
  skos:notation "bid" ;
  a MIXS:DrawingsEnum .

MIXS:DrawingsEnum.BUILDING_NAVIGATION_MAP a owl:NamedIndividual ;
  skos:notation "building navigation map" ;
  a MIXS:DrawingsEnum .

MIXS:DrawingsEnum.CONSTRUCTION a owl:NamedIndividual ;
  skos:notation "construction" ;
  a MIXS:DrawingsEnum .

MIXS:DrawingsEnum.DESIGN a owl:NamedIndividual ;
  skos:notation "design" ;
  a MIXS:DrawingsEnum .

MIXS:DrawingsEnum.DIAGRAM a owl:NamedIndividual ;
  skos:notation "diagram" ;
  a MIXS:DrawingsEnum .

MIXS:DrawingsEnum.OPERATION a owl:NamedIndividual ;
  skos:notation "operation" ;
  a MIXS:DrawingsEnum .

MIXS:DrawingsEnum.SKETCH a owl:NamedIndividual ;
  skos:notation "sketch" ;
  a MIXS:DrawingsEnum .

MIXS:ExtrWeatherEventEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ExtrWeatherEventEnum.DROUGHT MIXS:ExtrWeatherEventEnum.DUST_STORM MIXS:ExtrWeatherEventEnum.EXTREME_COLD MIXS:ExtrWeatherEventEnum.EXTREME_HEAT MIXS:ExtrWeatherEventEnum.FLOOD MIXS:ExtrWeatherEventEnum.FROST MIXS:ExtrWeatherEventEnum.HAIL MIXS:ExtrWeatherEventEnum.HIGH_PRECIPITATION MIXS:ExtrWeatherEventEnum.HIGH_WINDS )
  ] .

MIXS:ExtrWeatherEventEnum.DROUGHT a owl:NamedIndividual ;
  skos:notation "drought" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:ExtrWeatherEventEnum.DUST_STORM a owl:NamedIndividual ;
  skos:notation "dust storm" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:ExtrWeatherEventEnum.EXTREME_COLD a owl:NamedIndividual ;
  skos:notation "extreme cold" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:ExtrWeatherEventEnum.EXTREME_HEAT a owl:NamedIndividual ;
  skos:notation "extreme heat" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:ExtrWeatherEventEnum.FLOOD a owl:NamedIndividual ;
  skos:notation "flood" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:ExtrWeatherEventEnum.FROST a owl:NamedIndividual ;
  skos:notation "frost" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:ExtrWeatherEventEnum.HAIL a owl:NamedIndividual ;
  skos:notation "hail" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:ExtrWeatherEventEnum.HIGH_PRECIPITATION a owl:NamedIndividual ;
  skos:notation "high precipitation" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:ExtrWeatherEventEnum.HIGH_WINDS a owl:NamedIndividual ;
  skos:notation "high winds" ;
  a MIXS:ExtrWeatherEventEnum .

MIXS:FacilityTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FacilityTypeEnum.AMBIENT_STORAGE MIXS:FacilityTypeEnum.CATERER_CATERING_POINT MIXS:FacilityTypeEnum.DISTRIBUTION MIXS:FacilityTypeEnum.FROZEN_STORAGE MIXS:FacilityTypeEnum.IMPORTER_BROKER MIXS:FacilityTypeEnum.INTERSTATE_CONVEYANCE MIXS:FacilityTypeEnum.LABELER_RELABELER MIXS:FacilityTypeEnum.MANUFACTURING_PROCESSING MIXS:FacilityTypeEnum.PACKAGING MIXS:FacilityTypeEnum.REFRIGERATED_STORAGE MIXS:FacilityTypeEnum.STORAGE )
  ] .

MIXS:FacilityTypeEnum.AMBIENT_STORAGE a owl:NamedIndividual ;
  skos:notation "ambient storage" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.CATERER_CATERING_POINT a owl:NamedIndividual ;
  skos:notation "caterer-catering point" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.DISTRIBUTION a owl:NamedIndividual ;
  skos:notation "distribution" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.FROZEN_STORAGE a owl:NamedIndividual ;
  skos:notation "frozen storage" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.IMPORTER_BROKER a owl:NamedIndividual ;
  skos:notation "importer-broker" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.INTERSTATE_CONVEYANCE a owl:NamedIndividual ;
  skos:notation "interstate conveyance" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.LABELER_RELABELER a owl:NamedIndividual ;
  skos:notation "labeler-relabeler" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.MANUFACTURING_PROCESSING a owl:NamedIndividual ;
  skos:notation "manufacturing-processing" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.PACKAGING a owl:NamedIndividual ;
  skos:notation "packaging" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.REFRIGERATED_STORAGE a owl:NamedIndividual ;
  skos:notation "refrigerated storage" ;
  a MIXS:FacilityTypeEnum .

MIXS:FacilityTypeEnum.STORAGE a owl:NamedIndividual ;
  skos:notation "storage" ;
  a MIXS:FacilityTypeEnum .

MIXS:FaoClassEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FaoClassEnum.ACRISOLS MIXS:FaoClassEnum.ALISOLS MIXS:FaoClassEnum.ANDOSOLS MIXS:FaoClassEnum.ANTHROSOLS MIXS:FaoClassEnum.ARENOSOLS MIXS:FaoClassEnum.CALCISOLS MIXS:FaoClassEnum.CAMBISOLS MIXS:FaoClassEnum.CHERNOZEMS MIXS:FaoClassEnum.CRYOSOLS MIXS:FaoClassEnum.DURISOLS MIXS:FaoClassEnum.FERRALSOLS MIXS:FaoClassEnum.FLUVISOLS MIXS:FaoClassEnum.GLEYSOLS MIXS:FaoClassEnum.GREYZEMS MIXS:FaoClassEnum.GYPSISOLS MIXS:FaoClassEnum.HISTOSOLS MIXS:FaoClassEnum.KASTANOZEMS MIXS:FaoClassEnum.LEPTOSOLS MIXS:FaoClassEnum.LITHOSOLS MIXS:FaoClassEnum.LIXISOLS MIXS:FaoClassEnum.LUVISOLS MIXS:FaoClassEnum.NITOSOLS MIXS:FaoClassEnum.PHAEOZEMS MIXS:FaoClassEnum.PLANOSOLS MIXS:FaoClassEnum.PLINTHOSOLS MIXS:FaoClassEnum.PODZOLS MIXS:FaoClassEnum.PODZOLUVISOLS MIXS:FaoClassEnum.RANKERS MIXS:FaoClassEnum.REGOSOLS MIXS:FaoClassEnum.RENDZINAS MIXS:FaoClassEnum.SOLONCHAKS MIXS:FaoClassEnum.SOLONETZ MIXS:FaoClassEnum.STAGNOSOLS MIXS:FaoClassEnum.TECHNOSOLS MIXS:FaoClassEnum.UMBRISOLS MIXS:FaoClassEnum.VERTISOLS MIXS:FaoClassEnum.YERMOSOLS )
  ] .

MIXS:FaoClassEnum.ACRISOLS a owl:NamedIndividual ;
  skos:notation "Acrisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.ALISOLS a owl:NamedIndividual ;
  skos:notation "Alisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.ANDOSOLS a owl:NamedIndividual ;
  skos:notation "Andosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.ANTHROSOLS a owl:NamedIndividual ;
  skos:notation "Anthrosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.ARENOSOLS a owl:NamedIndividual ;
  skos:notation "Arenosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.CALCISOLS a owl:NamedIndividual ;
  skos:notation "Calcisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.CAMBISOLS a owl:NamedIndividual ;
  skos:notation "Cambisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.CHERNOZEMS a owl:NamedIndividual ;
  skos:notation "Chernozems" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.CRYOSOLS a owl:NamedIndividual ;
  skos:notation "Cryosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.DURISOLS a owl:NamedIndividual ;
  skos:notation "Durisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.FERRALSOLS a owl:NamedIndividual ;
  skos:notation "Ferralsols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.FLUVISOLS a owl:NamedIndividual ;
  skos:notation "Fluvisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.GLEYSOLS a owl:NamedIndividual ;
  skos:notation "Gleysols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.GREYZEMS a owl:NamedIndividual ;
  skos:notation "Greyzems" ;
  owl:deprecated "true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.GYPSISOLS a owl:NamedIndividual ;
  skos:notation "Gypsisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.HISTOSOLS a owl:NamedIndividual ;
  skos:notation "Histosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.KASTANOZEMS a owl:NamedIndividual ;
  skos:notation "Kastanozems" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.LEPTOSOLS a owl:NamedIndividual ;
  skos:notation "Leptosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.LITHOSOLS a owl:NamedIndividual ;
  skos:notation "Lithosols" ;
  owl:deprecated "true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.LIXISOLS a owl:NamedIndividual ;
  skos:notation "Lixisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.LUVISOLS a owl:NamedIndividual ;
  skos:notation "Luvisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.NITOSOLS a owl:NamedIndividual ;
  skos:notation "Nitosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.PHAEOZEMS a owl:NamedIndividual ;
  skos:notation "Phaeozems" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.PLANOSOLS a owl:NamedIndividual ;
  skos:notation "Planosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.PLINTHOSOLS a owl:NamedIndividual ;
  skos:notation "Plinthosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.PODZOLS a owl:NamedIndividual ;
  skos:notation "Podzols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.PODZOLUVISOLS a owl:NamedIndividual ;
  skos:notation "Podzoluvisols" ;
  owl:deprecated "true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.RANKERS a owl:NamedIndividual ;
  skos:notation "Rankers" ;
  owl:deprecated "true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.REGOSOLS a owl:NamedIndividual ;
  skos:notation "Regosols" ;
  owl:deprecated "true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.RENDZINAS a owl:NamedIndividual ;
  skos:notation "Rendzinas" ;
  owl:deprecated "true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.SOLONCHAKS a owl:NamedIndividual ;
  skos:notation "Solonchaks" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.SOLONETZ a owl:NamedIndividual ;
  skos:notation "Solonetz" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.STAGNOSOLS a owl:NamedIndividual ;
  skos:notation "Stagnosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.TECHNOSOLS a owl:NamedIndividual ;
  skos:notation "Technosols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.UMBRISOLS a owl:NamedIndividual ;
  skos:notation "Umbrisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.VERTISOLS a owl:NamedIndividual ;
  skos:notation "Vertisols" ;
  a MIXS:FaoClassEnum .

MIXS:FaoClassEnum.YERMOSOLS a owl:NamedIndividual ;
  skos:notation "Yermosols" ;
  owl:deprecated "true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696" ;
  a MIXS:FaoClassEnum .

MIXS:FarmWaterSourceEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FarmWaterSourceEnum.BRACKISH MIXS:FarmWaterSourceEnum.CANAL MIXS:FarmWaterSourceEnum.COLLECTED_RAINWATER MIXS:FarmWaterSourceEnum.DITCH MIXS:FarmWaterSourceEnum.ESTUARY MIXS:FarmWaterSourceEnum.FRESHWATER MIXS:FarmWaterSourceEnum.LAKE MIXS:FarmWaterSourceEnum.MANMADE MIXS:FarmWaterSourceEnum.MELT_POND MIXS:FarmWaterSourceEnum.MUNICIPAL MIXS:FarmWaterSourceEnum.NATURAL MIXS:FarmWaterSourceEnum.POND MIXS:FarmWaterSourceEnum.RESERVIOR MIXS:FarmWaterSourceEnum.RIVER MIXS:FarmWaterSourceEnum.SALINE MIXS:FarmWaterSourceEnum.STORAGE_TANK MIXS:FarmWaterSourceEnum.STREAM MIXS:FarmWaterSourceEnum.WELL )
  ] .

MIXS:FarmWaterSourceEnum.BRACKISH a owl:NamedIndividual ;
  skos:notation "brackish" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.CANAL a owl:NamedIndividual ;
  skos:notation "canal" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.COLLECTED_RAINWATER a owl:NamedIndividual ;
  skos:notation "collected rainwater" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.DITCH a owl:NamedIndividual ;
  skos:notation "ditch" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.ESTUARY a owl:NamedIndividual ;
  skos:notation "estuary" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.FRESHWATER a owl:NamedIndividual ;
  skos:notation "freshwater" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.LAKE a owl:NamedIndividual ;
  skos:notation "lake" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.MANMADE a owl:NamedIndividual ;
  skos:notation "manmade" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.MELT_POND a owl:NamedIndividual ;
  skos:notation "melt pond" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.MUNICIPAL a owl:NamedIndividual ;
  skos:notation "municipal" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.NATURAL a owl:NamedIndividual ;
  skos:notation "natural" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.POND a owl:NamedIndividual ;
  skos:notation "pond" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.RESERVIOR a owl:NamedIndividual ;
  skos:notation "reservior" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.RIVER a owl:NamedIndividual ;
  skos:notation "river" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.SALINE a owl:NamedIndividual ;
  skos:notation "saline" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.STORAGE_TANK a owl:NamedIndividual ;
  skos:notation "storage tank" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.STREAM a owl:NamedIndividual ;
  skos:notation "stream" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FarmWaterSourceEnum.WELL a owl:NamedIndividual ;
  skos:notation "well" ;
  a MIXS:FarmWaterSourceEnum .

MIXS:FilterTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FilterTypeEnum.HEPA MIXS:FilterTypeEnum.CHEMICAL_AIR_FILTER MIXS:FilterTypeEnum.ELECTROSTATIC MIXS:FilterTypeEnum.GAS_PHASE_OR_ULTRAVIOLET_AIR_TREATMENTS MIXS:FilterTypeEnum.LOW_MERV_PLEATED_MEDIA MIXS:FilterTypeEnum.PARTICULATE_AIR_FILTER )
  ] .

MIXS:FilterTypeEnum.HEPA a owl:NamedIndividual ;
  skos:notation "HEPA" ;
  a MIXS:FilterTypeEnum .

MIXS:FilterTypeEnum.CHEMICAL_AIR_FILTER a owl:NamedIndividual ;
  skos:notation "chemical air filter" ;
  a MIXS:FilterTypeEnum .

MIXS:FilterTypeEnum.ELECTROSTATIC a owl:NamedIndividual ;
  skos:notation "electrostatic" ;
  a MIXS:FilterTypeEnum .

MIXS:FilterTypeEnum.GAS_PHASE_OR_ULTRAVIOLET_AIR_TREATMENTS a owl:NamedIndividual ;
  skos:notation "gas-phase or ultraviolet air treatments" ;
  a MIXS:FilterTypeEnum .

MIXS:FilterTypeEnum.LOW_MERV_PLEATED_MEDIA a owl:NamedIndividual ;
  skos:notation "low-MERV pleated media" ;
  a MIXS:FilterTypeEnum .

MIXS:FilterTypeEnum.PARTICULATE_AIR_FILTER a owl:NamedIndividual ;
  skos:notation "particulate air filter" ;
  a MIXS:FilterTypeEnum .

MIXS:FireplaceTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FireplaceTypeEnum.GAS_BURNING MIXS:FireplaceTypeEnum.WOOD_BURNING )
  ] .

MIXS:FireplaceTypeEnum.GAS_BURNING a owl:NamedIndividual ;
  skos:notation "gas burning" ;
  a MIXS:FireplaceTypeEnum .

MIXS:FireplaceTypeEnum.WOOD_BURNING a owl:NamedIndividual ;
  skos:notation "wood burning" ;
  a MIXS:FireplaceTypeEnum .

MIXS:FloorStrucEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FloorStrucEnum.BALCONY MIXS:FloorStrucEnum.CONCRETE MIXS:FloorStrucEnum.FLOATING_FLOOR MIXS:FloorStrucEnum.GLASS_FLOOR MIXS:FloorStrucEnum.RAISED_FLOOR MIXS:FloorStrucEnum.SPRUNG_FLOOR MIXS:FloorStrucEnum.WOOD_FRAMED )
  ] .

MIXS:FloorStrucEnum.BALCONY a owl:NamedIndividual ;
  skos:notation "balcony" ;
  a MIXS:FloorStrucEnum .

MIXS:FloorStrucEnum.CONCRETE a owl:NamedIndividual ;
  skos:notation "concrete" ;
  a MIXS:FloorStrucEnum .

MIXS:FloorStrucEnum.FLOATING_FLOOR a owl:NamedIndividual ;
  skos:notation "floating floor" ;
  a MIXS:FloorStrucEnum .

MIXS:FloorStrucEnum.GLASS_FLOOR a owl:NamedIndividual ;
  skos:notation "glass floor" ;
  a MIXS:FloorStrucEnum .

MIXS:FloorStrucEnum.RAISED_FLOOR a owl:NamedIndividual ;
  skos:notation "raised floor" ;
  a MIXS:FloorStrucEnum .

MIXS:FloorStrucEnum.SPRUNG_FLOOR a owl:NamedIndividual ;
  skos:notation "sprung floor" ;
  a MIXS:FloorStrucEnum .

MIXS:FloorStrucEnum.WOOD_FRAMED a owl:NamedIndividual ;
  skos:notation "wood-framed" ;
  a MIXS:FloorStrucEnum .

MIXS:FloorWaterMoldEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FloorWaterMoldEnum.BULGING_WALLS MIXS:FloorWaterMoldEnum.CEILING_DISCOLORATION MIXS:FloorWaterMoldEnum.CONDENSATION MIXS:FloorWaterMoldEnum.FLOOR_DISCOLORATION MIXS:FloorWaterMoldEnum.MOLD_ODOR MIXS:FloorWaterMoldEnum.PEELING_PAINT_OR_WALLPAPER MIXS:FloorWaterMoldEnum.WALL_DISCOLORATION MIXS:FloorWaterMoldEnum.WATER_STAINS MIXS:FloorWaterMoldEnum.WET_FLOOR )
  ] .

MIXS:FloorWaterMoldEnum.BULGING_WALLS a owl:NamedIndividual ;
  skos:notation "bulging walls" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FloorWaterMoldEnum.CEILING_DISCOLORATION a owl:NamedIndividual ;
  skos:notation "ceiling discoloration" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FloorWaterMoldEnum.CONDENSATION a owl:NamedIndividual ;
  skos:notation "condensation" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FloorWaterMoldEnum.FLOOR_DISCOLORATION a owl:NamedIndividual ;
  skos:notation "floor discoloration" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FloorWaterMoldEnum.MOLD_ODOR a owl:NamedIndividual ;
  skos:notation "mold odor" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FloorWaterMoldEnum.PEELING_PAINT_OR_WALLPAPER a owl:NamedIndividual ;
  skos:notation "peeling paint or wallpaper" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FloorWaterMoldEnum.WALL_DISCOLORATION a owl:NamedIndividual ;
  skos:notation "wall discoloration" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FloorWaterMoldEnum.WATER_STAINS a owl:NamedIndividual ;
  skos:notation "water stains" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FloorWaterMoldEnum.WET_FLOOR a owl:NamedIndividual ;
  skos:notation "wet floor" ;
  a MIXS:FloorWaterMoldEnum .

MIXS:FoodCleanProcEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FoodCleanProcEnum.DRUM_AND_DRAIN MIXS:FoodCleanProcEnum.MANUAL_SPINNER MIXS:FoodCleanProcEnum.RINSED_WITH_SANITIZER_SOLUTION MIXS:FoodCleanProcEnum.RINSED_WITH_WATER MIXS:FoodCleanProcEnum.SCRUBBED_WITH_BRUSH MIXS:FoodCleanProcEnum.SCRUBBED_WITH_HAND MIXS:FoodCleanProcEnum.SOAKING )
  ] .

MIXS:FoodCleanProcEnum.DRUM_AND_DRAIN a owl:NamedIndividual ;
  skos:notation "drum and drain" ;
  a MIXS:FoodCleanProcEnum .

MIXS:FoodCleanProcEnum.MANUAL_SPINNER a owl:NamedIndividual ;
  skos:notation "manual spinner" ;
  a MIXS:FoodCleanProcEnum .

MIXS:FoodCleanProcEnum.RINSED_WITH_SANITIZER_SOLUTION a owl:NamedIndividual ;
  skos:notation "rinsed with sanitizer solution" ;
  a MIXS:FoodCleanProcEnum .

MIXS:FoodCleanProcEnum.RINSED_WITH_WATER a owl:NamedIndividual ;
  skos:notation "rinsed with water" ;
  a MIXS:FoodCleanProcEnum .

MIXS:FoodCleanProcEnum.SCRUBBED_WITH_BRUSH a owl:NamedIndividual ;
  skos:notation "scrubbed with brush" ;
  a MIXS:FoodCleanProcEnum .

MIXS:FoodCleanProcEnum.SCRUBBED_WITH_HAND a owl:NamedIndividual ;
  skos:notation "scrubbed with hand" ;
  a MIXS:FoodCleanProcEnum .

MIXS:FoodCleanProcEnum.SOAKING a owl:NamedIndividual ;
  skos:notation "soaking" ;
  a MIXS:FoodCleanProcEnum .

MIXS:FoodTraceListEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FoodTraceListEnum.CHEESES_OTHER_THAN_HARD_CHEESES MIXS:FoodTraceListEnum.CRUSTACEANS MIXS:FoodTraceListEnum.CUCUMBERS MIXS:FoodTraceListEnum.FINFISH_INCLUDING_SMOKED_FINFISH MIXS:FoodTraceListEnum.FRUITS_AND_VEGETABLES_FRESH_CUT MIXS:FoodTraceListEnum.HERBS_FRESH MIXS:FoodTraceListEnum.LEAFY_GREENS_INCLUDING_FRESH_CUT_LEAFY_GREENS MIXS:FoodTraceListEnum.MELONS MIXS:FoodTraceListEnum.MOLLUSKS_BIVALVES MIXS:FoodTraceListEnum.NUT_BUTTER MIXS:FoodTraceListEnum.PEPPERS MIXS:FoodTraceListEnum.READY_TO_EAT_DELI_SALADS MIXS:FoodTraceListEnum.SHELL_EGGS MIXS:FoodTraceListEnum.SPROUTS MIXS:FoodTraceListEnum.TOMATOES MIXS:FoodTraceListEnum.TROPICAL_TREE_FRUITS )
  ] .

MIXS:FoodTraceListEnum.CHEESES_OTHER_THAN_HARD_CHEESES a owl:NamedIndividual ;
  skos:notation "cheeses-other than hard cheeses" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.CRUSTACEANS a owl:NamedIndividual ;
  skos:notation "crustaceans" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.CUCUMBERS a owl:NamedIndividual ;
  skos:notation "cucumbers" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.FINFISH_INCLUDING_SMOKED_FINFISH a owl:NamedIndividual ;
  skos:notation "finfish-including smoked finfish" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.FRUITS_AND_VEGETABLES_FRESH_CUT a owl:NamedIndividual ;
  skos:notation "fruits and vegetables-fresh cut" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.HERBS_FRESH a owl:NamedIndividual ;
  skos:notation "herbs-fresh" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.LEAFY_GREENS_INCLUDING_FRESH_CUT_LEAFY_GREENS a owl:NamedIndividual ;
  skos:notation "leafy greens-including fresh cut leafy greens" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.MELONS a owl:NamedIndividual ;
  skos:notation "melons" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.MOLLUSKS_BIVALVES a owl:NamedIndividual ;
  skos:notation "mollusks-bivalves" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.NUT_BUTTER a owl:NamedIndividual ;
  skos:notation "nut butter" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.PEPPERS a owl:NamedIndividual ;
  skos:notation "peppers" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.READY_TO_EAT_DELI_SALADS a owl:NamedIndividual ;
  skos:notation "ready to eat deli salads" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.SHELL_EGGS a owl:NamedIndividual ;
  skos:notation "shell eggs" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.SPROUTS a owl:NamedIndividual ;
  skos:notation "sprouts" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.TOMATOES a owl:NamedIndividual ;
  skos:notation "tomatoes" ;
  a MIXS:FoodTraceListEnum .

MIXS:FoodTraceListEnum.TROPICAL_TREE_FRUITS a owl:NamedIndividual ;
  skos:notation "tropical tree fruits" ;
  a MIXS:FoodTraceListEnum .

MIXS:FreqCleanEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FreqCleanEnum.ANNUALLY MIXS:FreqCleanEnum.DAILY MIXS:FreqCleanEnum.MONTHLY MIXS:FreqCleanEnum.QUARTERLY MIXS:FreqCleanEnum.WEEKLY MIXS:FreqCleanEnum.OTHER )
  ] .

MIXS:FreqCleanEnum.ANNUALLY a owl:NamedIndividual ;
  skos:notation "Annually" ;
  a MIXS:FreqCleanEnum .

MIXS:FreqCleanEnum.DAILY a owl:NamedIndividual ;
  skos:notation "Daily" ;
  a MIXS:FreqCleanEnum .

MIXS:FreqCleanEnum.MONTHLY a owl:NamedIndividual ;
  skos:notation "Monthly" ;
  a MIXS:FreqCleanEnum .

MIXS:FreqCleanEnum.QUARTERLY a owl:NamedIndividual ;
  skos:notation "Quarterly" ;
  a MIXS:FreqCleanEnum .

MIXS:FreqCleanEnum.WEEKLY a owl:NamedIndividual ;
  skos:notation "Weekly" ;
  a MIXS:FreqCleanEnum .

MIXS:FreqCleanEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:FreqCleanEnum .

MIXS:FurnitureEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:FurnitureEnum.CABINET MIXS:FurnitureEnum.CHAIR MIXS:FurnitureEnum.DESKS )
  ] .

MIXS:FurnitureEnum.CABINET a owl:NamedIndividual ;
  skos:notation "cabinet" ;
  a MIXS:FurnitureEnum .

MIXS:FurnitureEnum.CHAIR a owl:NamedIndividual ;
  skos:notation "chair" ;
  a MIXS:FurnitureEnum .

MIXS:FurnitureEnum.DESKS a owl:NamedIndividual ;
  skos:notation "desks" ;
  a MIXS:FurnitureEnum .

MIXS:GenderRestroomEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:GenderRestroomEnum.ALL_GENDER MIXS:GenderRestroomEnum.FEMALE MIXS:GenderRestroomEnum.GENDER_NEUTRAL MIXS:GenderRestroomEnum.MALE MIXS:GenderRestroomEnum.MALE_AND_FEMALE MIXS:GenderRestroomEnum.UNISEX )
  ] .

MIXS:GenderRestroomEnum.ALL_GENDER a owl:NamedIndividual ;
  skos:notation "all gender" ;
  a MIXS:GenderRestroomEnum .

MIXS:GenderRestroomEnum.FEMALE a owl:NamedIndividual ;
  skos:notation "female" ;
  a MIXS:GenderRestroomEnum .

MIXS:GenderRestroomEnum.GENDER_NEUTRAL a owl:NamedIndividual ;
  skos:notation "gender neutral" ;
  a MIXS:GenderRestroomEnum .

MIXS:GenderRestroomEnum.MALE a owl:NamedIndividual ;
  skos:notation "male" ;
  a MIXS:GenderRestroomEnum .

MIXS:GenderRestroomEnum.MALE_AND_FEMALE a owl:NamedIndividual ;
  skos:notation "male and female" ;
  a MIXS:GenderRestroomEnum .

MIXS:GenderRestroomEnum.UNISEX a owl:NamedIndividual ;
  skos:notation "unisex" ;
  a MIXS:GenderRestroomEnum .

MIXS:GeolAgeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:GeolAgeEnum.ARCHEAN MIXS:GeolAgeEnum.CAMBRIAN MIXS:GeolAgeEnum.CARBONIFEROUS MIXS:GeolAgeEnum.CENOZOIC MIXS:GeolAgeEnum.CRETACEOUS MIXS:GeolAgeEnum.DEVONIAN MIXS:GeolAgeEnum.JURASSIC MIXS:GeolAgeEnum.MESOZOIC MIXS:GeolAgeEnum.NEOGENE MIXS:GeolAgeEnum.ORDOVICIAN MIXS:GeolAgeEnum.PALEOGENE MIXS:GeolAgeEnum.PALEOZOIC MIXS:GeolAgeEnum.PERMIAN MIXS:GeolAgeEnum.PRECAMBRIAN MIXS:GeolAgeEnum.PROTEROZOIC MIXS:GeolAgeEnum.SILURIAN MIXS:GeolAgeEnum.TRIASSIC MIXS:GeolAgeEnum.OTHER )
  ] .

MIXS:GeolAgeEnum.ARCHEAN a owl:NamedIndividual ;
  skos:notation "Archean" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.CAMBRIAN a owl:NamedIndividual ;
  skos:notation "Cambrian" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.CARBONIFEROUS a owl:NamedIndividual ;
  skos:notation "Carboniferous" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.CENOZOIC a owl:NamedIndividual ;
  skos:notation "Cenozoic" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.CRETACEOUS a owl:NamedIndividual ;
  skos:notation "Cretaceous" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.DEVONIAN a owl:NamedIndividual ;
  skos:notation "Devonian" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.JURASSIC a owl:NamedIndividual ;
  skos:notation "Jurassic" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.MESOZOIC a owl:NamedIndividual ;
  skos:notation "Mesozoic" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.NEOGENE a owl:NamedIndividual ;
  skos:notation "Neogene" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.ORDOVICIAN a owl:NamedIndividual ;
  skos:notation "Ordovician" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.PALEOGENE a owl:NamedIndividual ;
  skos:notation "Paleogene" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.PALEOZOIC a owl:NamedIndividual ;
  skos:notation "Paleozoic" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.PERMIAN a owl:NamedIndividual ;
  skos:notation "Permian" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.PRECAMBRIAN a owl:NamedIndividual ;
  skos:notation "Precambrian" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.PROTEROZOIC a owl:NamedIndividual ;
  skos:notation "Proterozoic" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.SILURIAN a owl:NamedIndividual ;
  skos:notation "Silurian" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.TRIASSIC a owl:NamedIndividual ;
  skos:notation "Triassic" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolAgeEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:GeolAgeEnum .

MIXS:GeolEpochEnum a owl:Class ;
  rdfs:comment "Chronometric epochs defined by the International Chronostratigraphic Chart (v2024-12) of the International Commission on Stratigraphy (https://stratigraphy.org/chart/)." ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:GeolEpochEnum.CAMBRIAN_EPOCH_2 MIXS:GeolEpochEnum.CISURALIAN MIXS:GeolEpochEnum.EARLY_CRETACEOUS MIXS:GeolEpochEnum.EARLY_DEVONIAN MIXS:GeolEpochEnum.EARLY_JURASSIC MIXS:GeolEpochEnum.EARLY_MISSISSIPPIAN MIXS:GeolEpochEnum.EARLY_ORDOVICIAN MIXS:GeolEpochEnum.EARLY_PENNSYLVANIAN MIXS:GeolEpochEnum.EARLY_TRIASSIC MIXS:GeolEpochEnum.EOCENE MIXS:GeolEpochEnum.FURONGIAN MIXS:GeolEpochEnum.GUADALUPIAN MIXS:GeolEpochEnum.HOLOCENE MIXS:GeolEpochEnum.LATE_CRETACEOUS MIXS:GeolEpochEnum.LATE_DEVONIAN MIXS:GeolEpochEnum.LATE_JURASSIC MIXS:GeolEpochEnum.LATE_MISSISSIPPIAN MIXS:GeolEpochEnum.LATE_ORDOVICIAN MIXS:GeolEpochEnum.LATE_PENNSYLVANIAN MIXS:GeolEpochEnum.LATE_TRIASSIC MIXS:GeolEpochEnum.LLANDOVERY MIXS:GeolEpochEnum.LOPINGIAN MIXS:GeolEpochEnum.LUDLOW MIXS:GeolEpochEnum.MIAOLINGIAN MIXS:GeolEpochEnum.MIDDLE_DEVONIAN MIXS:GeolEpochEnum.MIDDLE_JURASSIC MIXS:GeolEpochEnum.MIDDLE_MISSISSIPPIAN MIXS:GeolEpochEnum.MIDDLE_ORDOVICIAN MIXS:GeolEpochEnum.MIDDLE_PENNSYLVANIAN MIXS:GeolEpochEnum.MIDDLE_TRIASSIC MIXS:GeolEpochEnum.MIOCENE MIXS:GeolEpochEnum.OLIGOCENE MIXS:GeolEpochEnum.PALEOCENE MIXS:GeolEpochEnum.PLEISTOCENE MIXS:GeolEpochEnum.PLIOCENE MIXS:GeolEpochEnum.PRIDOLI MIXS:GeolEpochEnum.TERRENEUVIAN MIXS:GeolEpochEnum.WENLOCK )
  ] .

MIXS:GeolEpochEnum.CAMBRIAN_EPOCH_2 a owl:NamedIndividual ;
  skos:notation "Cambrian Epoch 2" ;
  rdfs:comment "A time period from 521.0 to 506.5 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.CISURALIAN a owl:NamedIndividual ;
  skos:notation "Cisuralian" ;
  rdfs:comment "A time period from 298.9 to 274.4 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.EARLY_CRETACEOUS a owl:NamedIndividual ;
  skos:notation "Early Cretaceous" ;
  rdfs:comment "A time period from 143.1 to 100.5 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.EARLY_DEVONIAN a owl:NamedIndividual ;
  skos:notation "Early Devonian" ;
  rdfs:comment "A time period from 419.62 to 393.47 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.EARLY_JURASSIC a owl:NamedIndividual ;
  skos:notation "Early Jurassic" ;
  rdfs:comment "A time period from 201.4 to 174.7 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.EARLY_MISSISSIPPIAN a owl:NamedIndividual ;
  skos:notation "Early Mississippian" ;
  rdfs:comment "A time period from 358.86 to 346.7 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.EARLY_ORDOVICIAN a owl:NamedIndividual ;
  skos:notation "Early Ordovician" ;
  rdfs:comment "A time period from 486.85 to 471.3 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.EARLY_PENNSYLVANIAN a owl:NamedIndividual ;
  skos:notation "Early Pennsylvanian" ;
  rdfs:comment "A time period from 323.4 to 315.2 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.EARLY_TRIASSIC a owl:NamedIndividual ;
  skos:notation "Early Triassic" ;
  rdfs:comment "A time period from 251.902 to 246.7 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.EOCENE a owl:NamedIndividual ;
  skos:notation "Eocene" ;
  rdfs:comment "A time period from 56.00 to 33.9 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.FURONGIAN a owl:NamedIndividual ;
  skos:notation "Furongian" ;
  rdfs:comment "A time period from 497.0 to 486.85 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.GUADALUPIAN a owl:NamedIndividual ;
  skos:notation "Guadalupian" ;
  rdfs:comment "A time period from 274.4 to 259.51 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.HOLOCENE a owl:NamedIndividual ;
  skos:notation "Holocene" ;
  rdfs:comment "A time period from 0.0117 million years ago to the present." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LATE_CRETACEOUS a owl:NamedIndividual ;
  skos:notation "Late Cretaceous" ;
  rdfs:comment "A time period from 100.5 to 66.00 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LATE_DEVONIAN a owl:NamedIndividual ;
  skos:notation "Late Devonian" ;
  rdfs:comment "A time period from 382.31 to 358.86 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LATE_JURASSIC a owl:NamedIndividual ;
  skos:notation "Late Jurassic" ;
  rdfs:comment "A time period from 161.5 to 143.1 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LATE_MISSISSIPPIAN a owl:NamedIndividual ;
  skos:notation "Late Mississippian" ;
  rdfs:comment "A time period from 330.3 to 323.4 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LATE_ORDOVICIAN a owl:NamedIndividual ;
  skos:notation "Late Ordovician" ;
  rdfs:comment "A time period from 458.2 to 443.1 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LATE_PENNSYLVANIAN a owl:NamedIndividual ;
  skos:notation "Late Pennsylvanian" ;
  rdfs:comment "A time period from 307.0 to 298.9 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LATE_TRIASSIC a owl:NamedIndividual ;
  skos:notation "Late Triassic" ;
  rdfs:comment "A time period from 237 to 201.4 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LLANDOVERY a owl:NamedIndividual ;
  skos:notation "Llandovery" ;
  rdfs:comment "A time period from 443.1 to 432.9 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LOPINGIAN a owl:NamedIndividual ;
  skos:notation "Lopingian" ;
  rdfs:comment "A time period from 259.51 to 251.902 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.LUDLOW a owl:NamedIndividual ;
  skos:notation "Ludlow" ;
  rdfs:comment "A time period from 426.7 to 422.7 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.MIAOLINGIAN a owl:NamedIndividual ;
  skos:notation "Miaolingian" ;
  rdfs:comment "A time period from 506.5 to 497.0 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.MIDDLE_DEVONIAN a owl:NamedIndividual ;
  skos:notation "Middle Devonian" ;
  rdfs:comment "A time period from 393.47 to 382.31 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.MIDDLE_JURASSIC a owl:NamedIndividual ;
  skos:notation "Middle Jurassic" ;
  rdfs:comment "A time period from 174.7 to 161.5 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.MIDDLE_MISSISSIPPIAN a owl:NamedIndividual ;
  skos:notation "Middle Mississippian" ;
  rdfs:comment "A time period from 346.7 to 330.3 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.MIDDLE_ORDOVICIAN a owl:NamedIndividual ;
  skos:notation "Middle Ordovician" ;
  rdfs:comment "A time period from 471.3 to 458.2 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.MIDDLE_PENNSYLVANIAN a owl:NamedIndividual ;
  skos:notation "Middle Pennsylvanian" ;
  rdfs:comment "A time period from 315.2 to 307.0 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.MIDDLE_TRIASSIC a owl:NamedIndividual ;
  skos:notation "Middle Triassic" ;
  rdfs:comment "A time period from 246.7 to 237 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.MIOCENE a owl:NamedIndividual ;
  skos:notation "Miocene" ;
  rdfs:comment "A time period from 23.04 to 5.333 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.OLIGOCENE a owl:NamedIndividual ;
  skos:notation "Oligocene" ;
  rdfs:comment "A time period from 33.9 to 23.04 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.PALEOCENE a owl:NamedIndividual ;
  skos:notation "Paleocene" ;
  rdfs:comment "A time period from 66.00 to 56.00 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.PLEISTOCENE a owl:NamedIndividual ;
  skos:notation "Pleistocene" ;
  rdfs:comment "A time period from 2.58 to 0.0117 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.PLIOCENE a owl:NamedIndividual ;
  skos:notation "Pliocene" ;
  rdfs:comment "A time period from 5.333 to 2.58 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.PRIDOLI a owl:NamedIndividual ;
  skos:notation "Pridoli" ;
  rdfs:comment "A time period from 422.7 to 419.62 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.TERRENEUVIAN a owl:NamedIndividual ;
  skos:notation "Terreneuvian" ;
  rdfs:comment "A time period from 538.8 to 521.0 million years ago" ;
  a MIXS:GeolEpochEnum .

MIXS:GeolEpochEnum.WENLOCK a owl:NamedIndividual ;
  skos:notation "Wenlock" ;
  rdfs:comment "A time period from 432.9 to 426.7 million years ago." ;
  a MIXS:GeolEpochEnum .

MIXS:GrowthHabitEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:GrowthHabitEnum.ERECT MIXS:GrowthHabitEnum.PROSTRATE MIXS:GrowthHabitEnum.SEMI_ERECT MIXS:GrowthHabitEnum.SPREADING )
  ] .

MIXS:GrowthHabitEnum.ERECT a owl:NamedIndividual ;
  skos:notation "erect" ;
  a MIXS:GrowthHabitEnum .

MIXS:GrowthHabitEnum.PROSTRATE a owl:NamedIndividual ;
  skos:notation "prostrate" ;
  a MIXS:GrowthHabitEnum .

MIXS:GrowthHabitEnum.SEMI_ERECT a owl:NamedIndividual ;
  skos:notation "semi-erect" ;
  a MIXS:GrowthHabitEnum .

MIXS:GrowthHabitEnum.SPREADING a owl:NamedIndividual ;
  skos:notation "spreading" ;
  a MIXS:GrowthHabitEnum .

MIXS:HandidnessEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HandidnessEnum.AMBIDEXTERITY MIXS:HandidnessEnum.LEFT_HANDEDNESS MIXS:HandidnessEnum.MIXED_HANDEDNESS MIXS:HandidnessEnum.RIGHT_HANDEDNESS )
  ] .

MIXS:HandidnessEnum.AMBIDEXTERITY a owl:NamedIndividual ;
  skos:notation "ambidexterity" ;
  a MIXS:HandidnessEnum .

MIXS:HandidnessEnum.LEFT_HANDEDNESS a owl:NamedIndividual ;
  skos:notation "left handedness" ;
  a MIXS:HandidnessEnum .

MIXS:HandidnessEnum.MIXED_HANDEDNESS a owl:NamedIndividual ;
  skos:notation "mixed-handedness" ;
  a MIXS:HandidnessEnum .

MIXS:HandidnessEnum.RIGHT_HANDEDNESS a owl:NamedIndividual ;
  skos:notation "right handedness" ;
  a MIXS:HandidnessEnum .

MIXS:HcProducedEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HcProducedEnum.BITUMEN MIXS:HcProducedEnum.COALBED_METHANE MIXS:HcProducedEnum.GAS MIXS:HcProducedEnum.GAS_CONDENSATE MIXS:HcProducedEnum.OIL MIXS:HcProducedEnum.OTHER )
  ] .

MIXS:HcProducedEnum.BITUMEN a owl:NamedIndividual ;
  skos:notation "Bitumen" ;
  a MIXS:HcProducedEnum .

MIXS:HcProducedEnum.COALBED_METHANE a owl:NamedIndividual ;
  skos:notation "Coalbed Methane" ;
  a MIXS:HcProducedEnum .

MIXS:HcProducedEnum.GAS a owl:NamedIndividual ;
  skos:notation "Gas" ;
  a MIXS:HcProducedEnum .

MIXS:HcProducedEnum.GAS_CONDENSATE a owl:NamedIndividual ;
  skos:notation "Gas-Condensate" ;
  a MIXS:HcProducedEnum .

MIXS:HcProducedEnum.OIL a owl:NamedIndividual ;
  skos:notation "Oil" ;
  a MIXS:HcProducedEnum .

MIXS:HcProducedEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:HcProducedEnum .

MIXS:HcrEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HcrEnum.COALBED MIXS:HcrEnum.GAS_RESERVOIR MIXS:HcrEnum.OIL_RESERVOIR MIXS:HcrEnum.OIL_SAND MIXS:HcrEnum.SHALE MIXS:HcrEnum.TIGHT_GAS_RESERVOIR MIXS:HcrEnum.TIGHT_OIL_RESERVOIR MIXS:HcrEnum.OTHER )
  ] .

MIXS:HcrEnum.COALBED a owl:NamedIndividual ;
  skos:notation "Coalbed" ;
  a MIXS:HcrEnum .

MIXS:HcrEnum.GAS_RESERVOIR a owl:NamedIndividual ;
  skos:notation "Gas Reservoir" ;
  a MIXS:HcrEnum .

MIXS:HcrEnum.OIL_RESERVOIR a owl:NamedIndividual ;
  skos:notation "Oil Reservoir" ;
  a MIXS:HcrEnum .

MIXS:HcrEnum.OIL_SAND a owl:NamedIndividual ;
  skos:notation "Oil Sand" ;
  a MIXS:HcrEnum .

MIXS:HcrEnum.SHALE a owl:NamedIndividual ;
  skos:notation "Shale" ;
  a MIXS:HcrEnum .

MIXS:HcrEnum.TIGHT_GAS_RESERVOIR a owl:NamedIndividual ;
  skos:notation "Tight Gas Reservoir" ;
  a MIXS:HcrEnum .

MIXS:HcrEnum.TIGHT_OIL_RESERVOIR a owl:NamedIndividual ;
  skos:notation "Tight Oil Reservoir" ;
  a MIXS:HcrEnum .

MIXS:HcrEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:HcrEnum .

MIXS:HeatCoolTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HeatCoolTypeEnum.FORCED_AIR_SYSTEM MIXS:HeatCoolTypeEnum.HEAT_PUMP MIXS:HeatCoolTypeEnum.RADIANT_SYSTEM MIXS:HeatCoolTypeEnum.STEAM_FORCED_HEAT MIXS:HeatCoolTypeEnum.WOOD_STOVE )
  ] .

MIXS:HeatCoolTypeEnum.FORCED_AIR_SYSTEM a owl:NamedIndividual ;
  skos:notation "forced air system" ;
  a MIXS:HeatCoolTypeEnum .

MIXS:HeatCoolTypeEnum.HEAT_PUMP a owl:NamedIndividual ;
  skos:notation "heat pump" ;
  a MIXS:HeatCoolTypeEnum .

MIXS:HeatCoolTypeEnum.RADIANT_SYSTEM a owl:NamedIndividual ;
  skos:notation "radiant system" ;
  a MIXS:HeatCoolTypeEnum .

MIXS:HeatCoolTypeEnum.STEAM_FORCED_HEAT a owl:NamedIndividual ;
  skos:notation "steam forced heat" ;
  a MIXS:HeatCoolTypeEnum .

MIXS:HeatCoolTypeEnum.WOOD_STOVE a owl:NamedIndividual ;
  skos:notation "wood stove" ;
  a MIXS:HeatCoolTypeEnum .

MIXS:HeatSysDelivMethEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HeatSysDelivMethEnum.CONDUCTIVE MIXS:HeatSysDelivMethEnum.RADIANT )
  ] .

MIXS:HeatSysDelivMethEnum.CONDUCTIVE a owl:NamedIndividual ;
  skos:notation "conductive" ;
  a MIXS:HeatSysDelivMethEnum .

MIXS:HeatSysDelivMethEnum.RADIANT a owl:NamedIndividual ;
  skos:notation "radiant" ;
  a MIXS:HeatSysDelivMethEnum .

MIXS:HostCellularLocEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HostCellularLocEnum.EXTRACELLULAR MIXS:HostCellularLocEnum.INTRACELLULAR MIXS:HostCellularLocEnum.NOT_DETERMINED )
  ] .

MIXS:HostCellularLocEnum.EXTRACELLULAR a owl:NamedIndividual ;
  skos:notation "extracellular" ;
  a MIXS:HostCellularLocEnum .

MIXS:HostCellularLocEnum.INTRACELLULAR a owl:NamedIndividual ;
  skos:notation "intracellular" ;
  a MIXS:HostCellularLocEnum .

MIXS:HostCellularLocEnum.NOT_DETERMINED a owl:NamedIndividual ;
  skos:notation "not determined" ;
  a MIXS:HostCellularLocEnum .

MIXS:HostDependenceEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HostDependenceEnum.FACULTATIVE MIXS:HostDependenceEnum.OBLIGATE )
  ] .

MIXS:HostDependenceEnum.FACULTATIVE a owl:NamedIndividual ;
  skos:notation "facultative" ;
  a MIXS:HostDependenceEnum .

MIXS:HostDependenceEnum.OBLIGATE a owl:NamedIndividual ;
  skos:notation "obligate" ;
  a MIXS:HostDependenceEnum .

MIXS:HostPredApprEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HostPredApprEnum.CRISPR_SPACER_MATCH MIXS:HostPredApprEnum.CO_OCCURRENCE MIXS:HostPredApprEnum.COMBINATION MIXS:HostPredApprEnum.HOST_SEQUENCE_SIMILARITY MIXS:HostPredApprEnum.KMER_SIMILARITY MIXS:HostPredApprEnum.OTHER MIXS:HostPredApprEnum.PROVIRUS )
  ] .

MIXS:HostPredApprEnum.CRISPR_SPACER_MATCH a owl:NamedIndividual ;
  skos:notation "CRISPR spacer match" ;
  a MIXS:HostPredApprEnum .

MIXS:HostPredApprEnum.CO_OCCURRENCE a owl:NamedIndividual ;
  skos:notation "co-occurrence" ;
  a MIXS:HostPredApprEnum .

MIXS:HostPredApprEnum.COMBINATION a owl:NamedIndividual ;
  skos:notation "combination" ;
  a MIXS:HostPredApprEnum .

MIXS:HostPredApprEnum.HOST_SEQUENCE_SIMILARITY a owl:NamedIndividual ;
  skos:notation "host sequence similarity" ;
  a MIXS:HostPredApprEnum .

MIXS:HostPredApprEnum.KMER_SIMILARITY a owl:NamedIndividual ;
  skos:notation "kmer similarity" ;
  a MIXS:HostPredApprEnum .

MIXS:HostPredApprEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:HostPredApprEnum .

MIXS:HostPredApprEnum.PROVIRUS a owl:NamedIndividual ;
  skos:notation "provirus" ;
  a MIXS:HostPredApprEnum .

MIXS:HostSpecificityEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:HostSpecificityEnum.FAMILY_SPECIFIC MIXS:HostSpecificityEnum.GENERALIST MIXS:HostSpecificityEnum.GENUS_SPECIFIC MIXS:HostSpecificityEnum.SPECIES_SPECIFIC )
  ] .

MIXS:HostSpecificityEnum.FAMILY_SPECIFIC a owl:NamedIndividual ;
  skos:notation "family-specific" ;
  a MIXS:HostSpecificityEnum .

MIXS:HostSpecificityEnum.GENERALIST a owl:NamedIndividual ;
  skos:notation "generalist" ;
  a MIXS:HostSpecificityEnum .

MIXS:HostSpecificityEnum.GENUS_SPECIFIC a owl:NamedIndividual ;
  skos:notation "genus-specific" ;
  a MIXS:HostSpecificityEnum .

MIXS:HostSpecificityEnum.SPECIES_SPECIFIC a owl:NamedIndividual ;
  skos:notation "species-specific" ;
  a MIXS:HostSpecificityEnum .

MIXS:IndoorSpaceEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:IndoorSpaceEnum.BATHROOM MIXS:IndoorSpaceEnum.BEDROOM MIXS:IndoorSpaceEnum.ELEVATOR MIXS:IndoorSpaceEnum.FOYER MIXS:IndoorSpaceEnum.HALLWAY MIXS:IndoorSpaceEnum.KITCHEN MIXS:IndoorSpaceEnum.LOCKER_ROOM MIXS:IndoorSpaceEnum.OFFICE )
  ] .

MIXS:IndoorSpaceEnum.BATHROOM a owl:NamedIndividual ;
  skos:notation "bathroom" ;
  a MIXS:IndoorSpaceEnum .

MIXS:IndoorSpaceEnum.BEDROOM a owl:NamedIndividual ;
  skos:notation "bedroom" ;
  a MIXS:IndoorSpaceEnum .

MIXS:IndoorSpaceEnum.ELEVATOR a owl:NamedIndividual ;
  skos:notation "elevator" ;
  a MIXS:IndoorSpaceEnum .

MIXS:IndoorSpaceEnum.FOYER a owl:NamedIndividual ;
  skos:notation "foyer" ;
  a MIXS:IndoorSpaceEnum .

MIXS:IndoorSpaceEnum.HALLWAY a owl:NamedIndividual ;
  skos:notation "hallway" ;
  a MIXS:IndoorSpaceEnum .

MIXS:IndoorSpaceEnum.KITCHEN a owl:NamedIndividual ;
  skos:notation "kitchen" ;
  a MIXS:IndoorSpaceEnum .

MIXS:IndoorSpaceEnum.LOCKER_ROOM a owl:NamedIndividual ;
  skos:notation "locker room" ;
  a MIXS:IndoorSpaceEnum .

MIXS:IndoorSpaceEnum.OFFICE a owl:NamedIndividual ;
  skos:notation "office" ;
  a MIXS:IndoorSpaceEnum .

MIXS:IndoorSurfEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:IndoorSurfEnum.CABINET MIXS:IndoorSurfEnum.CEILING MIXS:IndoorSurfEnum.COUNTER_TOP MIXS:IndoorSurfEnum.DOOR MIXS:IndoorSurfEnum.SHELVING MIXS:IndoorSurfEnum.VENT_COVER MIXS:IndoorSurfEnum.WALL MIXS:IndoorSurfEnum.WINDOW )
  ] .

MIXS:IndoorSurfEnum.CABINET a owl:NamedIndividual ;
  skos:notation "cabinet" ;
  a MIXS:IndoorSurfEnum .

MIXS:IndoorSurfEnum.CEILING a owl:NamedIndividual ;
  skos:notation "ceiling" ;
  a MIXS:IndoorSurfEnum .

MIXS:IndoorSurfEnum.COUNTER_TOP a owl:NamedIndividual ;
  skos:notation "counter top" ;
  a MIXS:IndoorSurfEnum .

MIXS:IndoorSurfEnum.DOOR a owl:NamedIndividual ;
  skos:notation "door" ;
  a MIXS:IndoorSurfEnum .

MIXS:IndoorSurfEnum.SHELVING a owl:NamedIndividual ;
  skos:notation "shelving" ;
  a MIXS:IndoorSurfEnum .

MIXS:IndoorSurfEnum.VENT_COVER a owl:NamedIndividual ;
  skos:notation "vent cover" ;
  a MIXS:IndoorSurfEnum .

MIXS:IndoorSurfEnum.WALL a owl:NamedIndividual ;
  skos:notation "wall" ;
  a MIXS:IndoorSurfEnum .

MIXS:IndoorSurfEnum.WINDOW a owl:NamedIndividual ;
  skos:notation "window" ;
  a MIXS:IndoorSurfEnum .

MIXS:InsdcMissingValueEnum a owl:Class ;
  rdfs:comment "Permissible values recommended by INSDC for reporting missing metadata values." ;
  skos:note "The International Nucleotide Database Collaboration (INSDC) have a standardised missing/null value reporting language to be used where a value of an expected format for sample metadata reporting can not be provided." , "The controlled vocabulary takes into account different type of constraints. Submitters are strongly encouraged to always provide true values. However, if missing/null value reporting is required, submitters are asked to use a term with the finest granularity for their situation. See the table below for accepted missing value reporting terms." , "Please use the above standardised missing value vocabulary only if a true value of an expected format for a mandatory field is missing. If a true value is missing for a recommended or an optional field, then these fields should not be used for reporting at all. When reporting a missing mandatory field, the eight granular 'reporting level' terms need to be preceded with the term \"missing:\" to declare both the absence of a true value as well as the reason." ;
  skos:example "geographic location (country and/or sea): missing: data agreement-established pre-2023" , "collection date: missing: control sample" , "geographic location (country and/or sea): missing: human-identifiable" ;
  rdfs:seeAlso <https://www.insdc.org/technical-specifications/missing-value-reporting/> ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:InsdcMissingValueEnum.MISSING MIXS:InsdcMissingValueEnum.MISSING_CONTROL_SAMPLE MIXS:InsdcMissingValueEnum.MISSING_DATA_AGREEMENT_ESTABLISHED_PRE_2023 MIXS:InsdcMissingValueEnum.MISSING_ENDANGERED_SPECIES MIXS:InsdcMissingValueEnum.MISSING_HUMAN_IDENTIFIABLE MIXS:InsdcMissingValueEnum.MISSING_LAB_STOCK MIXS:InsdcMissingValueEnum.MISSING_SAMPLE_GROUP MIXS:InsdcMissingValueEnum.MISSING_SYNTHETIC_CONSTRUCT MIXS:InsdcMissingValueEnum.MISSING_THIRD_PARTY_DATA MIXS:InsdcMissingValueEnum.NOT_APPLICABLE MIXS:InsdcMissingValueEnum.NOT_COLLECTED MIXS:InsdcMissingValueEnum.NOT_PROVIDED MIXS:InsdcMissingValueEnum.RESTRICTED_ACCESS )
  ] .

MIXS:InsdcMissingValueEnum.MISSING a owl:NamedIndividual ;
  skos:notation "missing" ;
  skos:altLabel "no data" , "not available" , "unavailable" , "unknown" , "unspecified" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.MISSING_CONTROL_SAMPLE a owl:NamedIndividual ;
  skos:notation "missing: control sample" ;
  rdfs:comment "Information is not applicable as the sample represents a negative control sample collected in a lab." ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.MISSING_DATA_AGREEMENT_ESTABLISHED_PRE_2023 a owl:NamedIndividual ;
  skos:notation "missing: data agreement established pre-2023" ;
  rdfs:comment """Data agreements were established before the 2023 INSDC standard and metadata can not be provided. A value may be given at a later stage.
""" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.MISSING_ENDANGERED_SPECIES a owl:NamedIndividual ;
  skos:notation "missing: endangered species" ;
  rdfs:comment "Information can not be reported as the target organism is endangered e.g. on the IUCN red-list." ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.MISSING_HUMAN_IDENTIFIABLE a owl:NamedIndividual ;
  skos:notation "missing: human-identifiable" ;
  rdfs:comment "Information can not be reported as the metadata would make the sample human-identifiable." ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.MISSING_LAB_STOCK a owl:NamedIndividual ;
  skos:notation "missing: lab stock" ;
  rdfs:comment """Information was not collected as the sample represents a cultured cell line or model organism under long-term lab control.
""" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.MISSING_SAMPLE_GROUP a owl:NamedIndividual ;
  skos:notation "missing: sample group" ;
  rdfs:comment """Information is not applicable as the sample represents a group of samples that do not have a single origin. E.g. for co-assembly or transcriptome assembly.
""" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.MISSING_SYNTHETIC_CONSTRUCT a owl:NamedIndividual ;
  skos:notation "missing: synthetic construct" ;
  rdfs:comment "Information does not exist as the sample represents an ab-initio synthetic construct." ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.MISSING_THIRD_PARTY_DATA a owl:NamedIndividual ;
  skos:notation "missing: third party data" ;
  rdfs:comment """Information does not exist as the metadata was not collected or reported in records predating the 2023 agreement. For use in Third PArty data submissions.
""" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.NOT_APPLICABLE a owl:NamedIndividual ;
  skos:notation "not applicable" ;
  rdfs:comment """Information is inappropriate to report, can indicate that the standard itself fails to model or represent the information appropriately
""" ;
  skos:altLabel "n/a" , "na" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.NOT_COLLECTED a owl:NamedIndividual ;
  skos:notation "not collected" ;
  rdfs:comment "Information of an expected format was not given because it has not been collected" ;
  skos:altLabel "not determined" , "not recorded" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.NOT_PROVIDED a owl:NamedIndividual ;
  skos:notation "not provided" ;
  rdfs:comment "Information of an expected format was not given, a value may be given at the later stage" ;
  skos:altLabel "not reported" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:InsdcMissingValueEnum.RESTRICTED_ACCESS a owl:NamedIndividual ;
  skos:notation "restricted access" ;
  rdfs:comment "Information exists but can not be released openly because of privacy concerns" ;
  skos:altLabel "restricted" ;
  a MIXS:InsdcMissingValueEnum .

MIXS:IsotopeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:IsotopeEnum.13_C MIXS:IsotopeEnum.15_N MIXS:IsotopeEnum.18_O MIXS:IsotopeEnum.2_H )
  ] .

MIXS:IsotopeEnum.13_C a owl:NamedIndividual ;
  skos:notation "13C" ;
  rdfs:comment "Carbon with 13C isotope" ;
  a MIXS:IsotopeEnum .

MIXS:IsotopeEnum.15_N a owl:NamedIndividual ;
  skos:notation "15N" ;
  rdfs:comment "Nitrogen with 15N isotope" ;
  a MIXS:IsotopeEnum .

MIXS:IsotopeEnum.18_O a owl:NamedIndividual ;
  skos:notation "18O" ;
  rdfs:comment "Oxygen with 18O isotope" ;
  a MIXS:IsotopeEnum .

MIXS:IsotopeEnum.2_H a owl:NamedIndividual ;
  skos:notation "2H" ;
  rdfs:comment "Hydrogen with 2H isotope" ;
  a MIXS:IsotopeEnum .

MIXS:IsotopologApproachEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:IsotopologApproachEnum.MULTIPLE MIXS:IsotopologApproachEnum.SINGLE )
  ] .

MIXS:IsotopologApproachEnum.MULTIPLE a owl:NamedIndividual ;
  skos:notation "multiple" ;
  a MIXS:IsotopologApproachEnum .

MIXS:IsotopologApproachEnum.SINGLE a owl:NamedIndividual ;
  skos:notation "single" ;
  a MIXS:IsotopologApproachEnum .

MIXS:IsotopologLabelEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:IsotopologLabelEnum.ISOTOPICALLY_LABELED MIXS:IsotopologLabelEnum.NATURAL_ABUNDANCE )
  ] .

MIXS:IsotopologLabelEnum.ISOTOPICALLY_LABELED a owl:NamedIndividual ;
  skos:notation "isotopically labeled" ;
  a MIXS:IsotopologLabelEnum .

MIXS:IsotopologLabelEnum.NATURAL_ABUNDANCE a owl:NamedIndividual ;
  skos:notation "natural abundance" ;
  a MIXS:IsotopologLabelEnum .

MIXS:LibLayoutEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:LibLayoutEnum.OTHER MIXS:LibLayoutEnum.PAIRED MIXS:LibLayoutEnum.SINGLE MIXS:LibLayoutEnum.VECTOR )
  ] .

MIXS:LibLayoutEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:LibLayoutEnum .

MIXS:LibLayoutEnum.PAIRED a owl:NamedIndividual ;
  skos:notation "paired" ;
  a MIXS:LibLayoutEnum .

MIXS:LibLayoutEnum.SINGLE a owl:NamedIndividual ;
  skos:notation "single" ;
  a MIXS:LibLayoutEnum .

MIXS:LibLayoutEnum.VECTOR a owl:NamedIndividual ;
  skos:notation "vector" ;
  a MIXS:LibLayoutEnum .

MIXS:LibStrandEnum a owl:Class ;
  rdfs:comment "Options for the strandedness of the input 'template' DNA molecules used for DNA library construction." ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:LibStrandEnum.DOUBLE MIXS:LibStrandEnum.SINGLE )
  ] .

MIXS:LibStrandEnum.DOUBLE a owl:NamedIndividual ;
  skos:notation "double" ;
  rdfs:comment "Library constructed from double-stranded DNA molecules." ;
  a MIXS:LibStrandEnum .

MIXS:LibStrandEnum.SINGLE a owl:NamedIndividual ;
  skos:notation "single" ;
  rdfs:comment "Library constructed from single-stranded DNA molecules." ;
  a MIXS:LibStrandEnum .

MIXS:LibTypeEnum a owl:Class ;
  rdfs:comment "Options for types of DNA that have been targeted for DNA library construction." ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:LibTypeEnum.AMPLICON MIXS:LibTypeEnum.ENRICHED MIXS:LibTypeEnum.SHOTGUN )
  ] .

MIXS:LibTypeEnum.AMPLICON a owl:NamedIndividual ;
  skos:notation "amplicon" ;
  rdfs:comment "A library that has been enriched for a single specific region of a genome (e.g. a specific gene) through targeted amplification." ;
  a MIXS:LibTypeEnum .

MIXS:LibTypeEnum.ENRICHED a owl:NamedIndividual ;
  skos:notation "enriched" ;
  rdfs:comment "A library that has been enriched for DNA from typically large portions to the entirety of a genome, through array or in-solution 'capture' with genome array baits/probes." ;
  a MIXS:LibTypeEnum .

MIXS:LibTypeEnum.SHOTGUN a owl:NamedIndividual ;
  skos:notation "shotgun" ;
  rdfs:comment "An unselected library that has undergone no type of targeted amplification/enrichment for a particular genomic region or genome, i.e., random sequencing of any nucleic acid molecule contained in a genomic library." ;
  a MIXS:LibTypeEnum .

MIXS:LightTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:LightTypeEnum.DESK_LAMP MIXS:LightTypeEnum.ELECTRIC_LIGHT MIXS:LightTypeEnum.FLUORESCENT_LIGHTS MIXS:LightTypeEnum.NATURAL_LIGHT MIXS:LightTypeEnum.NONE )
  ] .

MIXS:LightTypeEnum.DESK_LAMP a owl:NamedIndividual ;
  skos:notation "desk lamp" ;
  a MIXS:LightTypeEnum .

MIXS:LightTypeEnum.ELECTRIC_LIGHT a owl:NamedIndividual ;
  skos:notation "electric light" ;
  a MIXS:LightTypeEnum .

MIXS:LightTypeEnum.FLUORESCENT_LIGHTS a owl:NamedIndividual ;
  skos:notation "fluorescent lights" ;
  a MIXS:LightTypeEnum .

MIXS:LightTypeEnum.NATURAL_LIGHT a owl:NamedIndividual ;
  skos:notation "natural light" ;
  a MIXS:LightTypeEnum .

MIXS:LightTypeEnum.NONE a owl:NamedIndividual ;
  skos:notation "none" ;
  a MIXS:LightTypeEnum .

MIXS:LithologyEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:LithologyEnum.BASEMENT MIXS:LithologyEnum.CHALK MIXS:LithologyEnum.CHERT MIXS:LithologyEnum.COAL MIXS:LithologyEnum.CONGLOMERATE MIXS:LithologyEnum.DIATOMITE MIXS:LithologyEnum.DOLOMITE MIXS:LithologyEnum.LIMESTONE MIXS:LithologyEnum.SANDSTONE MIXS:LithologyEnum.SHALE MIXS:LithologyEnum.SILTSTONE MIXS:LithologyEnum.VOLCANIC MIXS:LithologyEnum.OTHER )
  ] .

MIXS:LithologyEnum.BASEMENT a owl:NamedIndividual ;
  skos:notation "Basement" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.CHALK a owl:NamedIndividual ;
  skos:notation "Chalk" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.CHERT a owl:NamedIndividual ;
  skos:notation "Chert" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.COAL a owl:NamedIndividual ;
  skos:notation "Coal" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.CONGLOMERATE a owl:NamedIndividual ;
  skos:notation "Conglomerate" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.DIATOMITE a owl:NamedIndividual ;
  skos:notation "Diatomite" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.DOLOMITE a owl:NamedIndividual ;
  skos:notation "Dolomite" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.LIMESTONE a owl:NamedIndividual ;
  skos:notation "Limestone" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.SANDSTONE a owl:NamedIndividual ;
  skos:notation "Sandstone" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.SHALE a owl:NamedIndividual ;
  skos:notation "Shale" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.SILTSTONE a owl:NamedIndividual ;
  skos:notation "Siltstone" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.VOLCANIC a owl:NamedIndividual ;
  skos:notation "Volcanic" ;
  a MIXS:LithologyEnum .

MIXS:LithologyEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:LithologyEnum .

MIXS:MagCovSoftwareEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:MagCovSoftwareEnum.BBMAP MIXS:MagCovSoftwareEnum.BOWTIE MIXS:MagCovSoftwareEnum.BWA MIXS:MagCovSoftwareEnum.OTHER )
  ] .

MIXS:MagCovSoftwareEnum.BBMAP a owl:NamedIndividual ;
  skos:notation "bbmap" ;
  a MIXS:MagCovSoftwareEnum .

MIXS:MagCovSoftwareEnum.BOWTIE a owl:NamedIndividual ;
  skos:notation "bowtie" ;
  a MIXS:MagCovSoftwareEnum .

MIXS:MagCovSoftwareEnum.BWA a owl:NamedIndividual ;
  skos:notation "bwa" ;
  a MIXS:MagCovSoftwareEnum .

MIXS:MagCovSoftwareEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:MagCovSoftwareEnum .

MIXS:MechStrucEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:MechStrucEnum.BOAT MIXS:MechStrucEnum.BUS MIXS:MechStrucEnum.CAR MIXS:MechStrucEnum.CARRIAGE MIXS:MechStrucEnum.COACH MIXS:MechStrucEnum.ELEVATOR MIXS:MechStrucEnum.ESCALATOR MIXS:MechStrucEnum.SUBWAY MIXS:MechStrucEnum.TRAIN )
  ] .

MIXS:MechStrucEnum.BOAT a owl:NamedIndividual ;
  skos:notation "boat" ;
  a MIXS:MechStrucEnum .

MIXS:MechStrucEnum.BUS a owl:NamedIndividual ;
  skos:notation "bus" ;
  a MIXS:MechStrucEnum .

MIXS:MechStrucEnum.CAR a owl:NamedIndividual ;
  skos:notation "car" ;
  a MIXS:MechStrucEnum .

MIXS:MechStrucEnum.CARRIAGE a owl:NamedIndividual ;
  skos:notation "carriage" ;
  a MIXS:MechStrucEnum .

MIXS:MechStrucEnum.COACH a owl:NamedIndividual ;
  skos:notation "coach" ;
  a MIXS:MechStrucEnum .

MIXS:MechStrucEnum.ELEVATOR a owl:NamedIndividual ;
  skos:notation "elevator" ;
  a MIXS:MechStrucEnum .

MIXS:MechStrucEnum.ESCALATOR a owl:NamedIndividual ;
  skos:notation "escalator" ;
  a MIXS:MechStrucEnum .

MIXS:MechStrucEnum.SUBWAY a owl:NamedIndividual ;
  skos:notation "subway" ;
  a MIXS:MechStrucEnum .

MIXS:MechStrucEnum.TRAIN a owl:NamedIndividual ;
  skos:notation "train" ;
  a MIXS:MechStrucEnum .

MIXS:ModeTransmissionEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ModeTransmissionEnum.HORIZONTAL_CASTRATOR MIXS:ModeTransmissionEnum.HORIZONTAL_DIRECTLY_TRANSMITTED MIXS:ModeTransmissionEnum.HORIZONTAL_MICROPREDATOR MIXS:ModeTransmissionEnum.HORIZONTAL_PARASITOID MIXS:ModeTransmissionEnum.HORIZONTAL_TROPHICALLY_TRANSMITTED MIXS:ModeTransmissionEnum.HORIZONTAL_VECTOR_TRANSMITTED MIXS:ModeTransmissionEnum.VERTICAL )
  ] .

MIXS:ModeTransmissionEnum.HORIZONTAL_CASTRATOR a owl:NamedIndividual ;
  skos:notation "horizontal:castrator" ;
  a MIXS:ModeTransmissionEnum .

MIXS:ModeTransmissionEnum.HORIZONTAL_DIRECTLY_TRANSMITTED a owl:NamedIndividual ;
  skos:notation "horizontal:directly transmitted" ;
  a MIXS:ModeTransmissionEnum .

MIXS:ModeTransmissionEnum.HORIZONTAL_MICROPREDATOR a owl:NamedIndividual ;
  skos:notation "horizontal:micropredator" ;
  a MIXS:ModeTransmissionEnum .

MIXS:ModeTransmissionEnum.HORIZONTAL_PARASITOID a owl:NamedIndividual ;
  skos:notation "horizontal:parasitoid" ;
  a MIXS:ModeTransmissionEnum .

MIXS:ModeTransmissionEnum.HORIZONTAL_TROPHICALLY_TRANSMITTED a owl:NamedIndividual ;
  skos:notation "horizontal:trophically transmitted" ;
  a MIXS:ModeTransmissionEnum .

MIXS:ModeTransmissionEnum.HORIZONTAL_VECTOR_TRANSMITTED a owl:NamedIndividual ;
  skos:notation "horizontal:vector transmitted" ;
  a MIXS:ModeTransmissionEnum .

MIXS:ModeTransmissionEnum.VERTICAL a owl:NamedIndividual ;
  skos:notation "vertical" ;
  a MIXS:ModeTransmissionEnum .

MIXS:MoldVisibilityEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:MoldVisibilityEnum.NO_PRESENCE_OF_MOLD_VISIBLE MIXS:MoldVisibilityEnum.PRESENCE_OF_MOLD_VISIBLE )
  ] .

MIXS:MoldVisibilityEnum.NO_PRESENCE_OF_MOLD_VISIBLE a owl:NamedIndividual ;
  skos:notation "no presence of mold visible" ;
  a MIXS:MoldVisibilityEnum .

MIXS:MoldVisibilityEnum.PRESENCE_OF_MOLD_VISIBLE a owl:NamedIndividual ;
  skos:notation "presence of mold visible" ;
  a MIXS:MoldVisibilityEnum .

MIXS:NegContTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:NegContTypeEnum.DNA_FREE_PCR_MIX MIXS:NegContTypeEnum.DISTILLED_WATER MIXS:NegContTypeEnum.EMPTY_COLLECTION_DEVICE MIXS:NegContTypeEnum.EMPTY_COLLECTION_TUBE MIXS:NegContTypeEnum.PHOSPHATE_BUFFER MIXS:NegContTypeEnum.STERILE_SWAB MIXS:NegContTypeEnum.STERILE_SYRINGE )
  ] .

MIXS:NegContTypeEnum.DNA_FREE_PCR_MIX a owl:NamedIndividual ;
  skos:notation "DNA-free PCR mix" ;
  a MIXS:NegContTypeEnum .

MIXS:NegContTypeEnum.DISTILLED_WATER a owl:NamedIndividual ;
  skos:notation "distilled water" ;
  a MIXS:NegContTypeEnum .

MIXS:NegContTypeEnum.EMPTY_COLLECTION_DEVICE a owl:NamedIndividual ;
  skos:notation "empty collection device" ;
  a MIXS:NegContTypeEnum .

MIXS:NegContTypeEnum.EMPTY_COLLECTION_TUBE a owl:NamedIndividual ;
  skos:notation "empty collection tube" ;
  a MIXS:NegContTypeEnum .

MIXS:NegContTypeEnum.PHOSPHATE_BUFFER a owl:NamedIndividual ;
  skos:notation "phosphate buffer" ;
  a MIXS:NegContTypeEnum .

MIXS:NegContTypeEnum.STERILE_SWAB a owl:NamedIndividual ;
  skos:notation "sterile swab" ;
  a MIXS:NegContTypeEnum .

MIXS:NegContTypeEnum.STERILE_SYRINGE a owl:NamedIndividual ;
  skos:notation "sterile syringe" ;
  a MIXS:NegContTypeEnum .

MIXS:OccupDocumentEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:OccupDocumentEnum.AUTOMATED_COUNT MIXS:OccupDocumentEnum.ESTIMATE MIXS:OccupDocumentEnum.MANUAL_COUNT MIXS:OccupDocumentEnum.VIDEOS )
  ] .

MIXS:OccupDocumentEnum.AUTOMATED_COUNT a owl:NamedIndividual ;
  skos:notation "automated count" ;
  a MIXS:OccupDocumentEnum .

MIXS:OccupDocumentEnum.ESTIMATE a owl:NamedIndividual ;
  skos:notation "estimate" ;
  a MIXS:OccupDocumentEnum .

MIXS:OccupDocumentEnum.MANUAL_COUNT a owl:NamedIndividual ;
  skos:notation "manual count" ;
  a MIXS:OccupDocumentEnum .

MIXS:OccupDocumentEnum.VIDEOS a owl:NamedIndividual ;
  skos:notation "videos" ;
  a MIXS:OccupDocumentEnum .

MIXS:OxyStatSampEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:OxyStatSampEnum.AEROBIC MIXS:OxyStatSampEnum.ANAEROBIC MIXS:OxyStatSampEnum.OTHER )
  ] .

MIXS:OxyStatSampEnum.AEROBIC a owl:NamedIndividual ;
  skos:notation "aerobic" ;
  a MIXS:OxyStatSampEnum .

MIXS:OxyStatSampEnum.ANAEROBIC a owl:NamedIndividual ;
  skos:notation "anaerobic" ;
  a MIXS:OxyStatSampEnum .

MIXS:OxyStatSampEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:OxyStatSampEnum .

MIXS:PlantReprodCropEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:PlantReprodCropEnum.PLANT_CUTTING MIXS:PlantReprodCropEnum.PREGERMINATED_SEED MIXS:PlantReprodCropEnum.RATOON MIXS:PlantReprodCropEnum.SEED MIXS:PlantReprodCropEnum.SEEDLING MIXS:PlantReprodCropEnum.WHOLE_MATURE_PLANT )
  ] .

MIXS:PlantReprodCropEnum.PLANT_CUTTING a owl:NamedIndividual ;
  skos:notation "plant cutting" ;
  a MIXS:PlantReprodCropEnum .

MIXS:PlantReprodCropEnum.PREGERMINATED_SEED a owl:NamedIndividual ;
  skos:notation "pregerminated seed" ;
  a MIXS:PlantReprodCropEnum .

MIXS:PlantReprodCropEnum.RATOON a owl:NamedIndividual ;
  skos:notation "ratoon" ;
  a MIXS:PlantReprodCropEnum .

MIXS:PlantReprodCropEnum.SEED a owl:NamedIndividual ;
  skos:notation "seed" ;
  a MIXS:PlantReprodCropEnum .

MIXS:PlantReprodCropEnum.SEEDLING a owl:NamedIndividual ;
  skos:notation "seedling" ;
  a MIXS:PlantReprodCropEnum .

MIXS:PlantReprodCropEnum.WHOLE_MATURE_PLANT a owl:NamedIndividual ;
  skos:notation "whole mature plant" ;
  a MIXS:PlantReprodCropEnum .

MIXS:PlantSexEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:PlantSexEnum.ANDRODIOECIOUS MIXS:PlantSexEnum.ANDROECIOUS MIXS:PlantSexEnum.ANDROGYNOMONOECIOUS MIXS:PlantSexEnum.ANDROGYNOUS MIXS:PlantSexEnum.ANDROMONOECIOUS MIXS:PlantSexEnum.BISEXUAL MIXS:PlantSexEnum.DICHOGAMOUS MIXS:PlantSexEnum.DICLINOUS MIXS:PlantSexEnum.DIOECIOUS MIXS:PlantSexEnum.GYNODIOECIOUS MIXS:PlantSexEnum.GYNOECIOUS MIXS:PlantSexEnum.GYNOMONOECIOUS MIXS:PlantSexEnum.HERMAPHRODITIC MIXS:PlantSexEnum.IMPERFECT MIXS:PlantSexEnum.MONOCLINOUS MIXS:PlantSexEnum.MONOECIOUS MIXS:PlantSexEnum.PERFECT MIXS:PlantSexEnum.POLYGAMODIOECIOUS MIXS:PlantSexEnum.POLYGAMOMONOECIOUS MIXS:PlantSexEnum.POLYGAMOUS MIXS:PlantSexEnum.PROTANDROUS MIXS:PlantSexEnum.PROTOGYNOUS MIXS:PlantSexEnum.SUBANDROECIOUS MIXS:PlantSexEnum.SUBDIOECIOUS MIXS:PlantSexEnum.SUBGYNOECIOUS MIXS:PlantSexEnum.SYNOECIOUS MIXS:PlantSexEnum.TRIMONOECIOUS MIXS:PlantSexEnum.TRIOECIOUS MIXS:PlantSexEnum.UNISEXUAL )
  ] .

MIXS:PlantSexEnum.ANDRODIOECIOUS a owl:NamedIndividual ;
  skos:notation "Androdioecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.ANDROECIOUS a owl:NamedIndividual ;
  skos:notation "Androecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.ANDROGYNOMONOECIOUS a owl:NamedIndividual ;
  skos:notation "Androgynomonoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.ANDROGYNOUS a owl:NamedIndividual ;
  skos:notation "Androgynous" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.ANDROMONOECIOUS a owl:NamedIndividual ;
  skos:notation "Andromonoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.BISEXUAL a owl:NamedIndividual ;
  skos:notation "Bisexual" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.DICHOGAMOUS a owl:NamedIndividual ;
  skos:notation "Dichogamous" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.DICLINOUS a owl:NamedIndividual ;
  skos:notation "Diclinous" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.DIOECIOUS a owl:NamedIndividual ;
  skos:notation "Dioecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.GYNODIOECIOUS a owl:NamedIndividual ;
  skos:notation "Gynodioecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.GYNOECIOUS a owl:NamedIndividual ;
  skos:notation "Gynoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.GYNOMONOECIOUS a owl:NamedIndividual ;
  skos:notation "Gynomonoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.HERMAPHRODITIC a owl:NamedIndividual ;
  skos:notation "Hermaphroditic" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.IMPERFECT a owl:NamedIndividual ;
  skos:notation "Imperfect" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.MONOCLINOUS a owl:NamedIndividual ;
  skos:notation "Monoclinous" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.MONOECIOUS a owl:NamedIndividual ;
  skos:notation "Monoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.PERFECT a owl:NamedIndividual ;
  skos:notation "Perfect" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.POLYGAMODIOECIOUS a owl:NamedIndividual ;
  skos:notation "Polygamodioecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.POLYGAMOMONOECIOUS a owl:NamedIndividual ;
  skos:notation "Polygamomonoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.POLYGAMOUS a owl:NamedIndividual ;
  skos:notation "Polygamous" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.PROTANDROUS a owl:NamedIndividual ;
  skos:notation "Protandrous" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.PROTOGYNOUS a owl:NamedIndividual ;
  skos:notation "Protogynous" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.SUBANDROECIOUS a owl:NamedIndividual ;
  skos:notation "Subandroecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.SUBDIOECIOUS a owl:NamedIndividual ;
  skos:notation "Subdioecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.SUBGYNOECIOUS a owl:NamedIndividual ;
  skos:notation "Subgynoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.SYNOECIOUS a owl:NamedIndividual ;
  skos:notation "Synoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.TRIMONOECIOUS a owl:NamedIndividual ;
  skos:notation "Trimonoecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.TRIOECIOUS a owl:NamedIndividual ;
  skos:notation "Trioecious" ;
  a MIXS:PlantSexEnum .

MIXS:PlantSexEnum.UNISEXUAL a owl:NamedIndividual ;
  skos:notation "Unisexual" ;
  a MIXS:PlantSexEnum .

MIXS:PredGenomeStrucEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:PredGenomeStrucEnum.NON_SEGMENTED MIXS:PredGenomeStrucEnum.SEGMENTED MIXS:PredGenomeStrucEnum.UNDETERMINED )
  ] .

MIXS:PredGenomeStrucEnum.NON_SEGMENTED a owl:NamedIndividual ;
  skos:notation "non-segmented" ;
  a MIXS:PredGenomeStrucEnum .

MIXS:PredGenomeStrucEnum.SEGMENTED a owl:NamedIndividual ;
  skos:notation "segmented" ;
  a MIXS:PredGenomeStrucEnum .

MIXS:PredGenomeStrucEnum.UNDETERMINED a owl:NamedIndividual ;
  skos:notation "undetermined" ;
  a MIXS:PredGenomeStrucEnum .

MIXS:ProfilePositionEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ProfilePositionEnum.BACKSLOPE MIXS:ProfilePositionEnum.FOOTSLOPE MIXS:ProfilePositionEnum.SHOULDER MIXS:ProfilePositionEnum.SUMMIT MIXS:ProfilePositionEnum.TOESLOPE )
  ] .

MIXS:ProfilePositionEnum.BACKSLOPE a owl:NamedIndividual ;
  skos:notation "backslope" ;
  a MIXS:ProfilePositionEnum .

MIXS:ProfilePositionEnum.FOOTSLOPE a owl:NamedIndividual ;
  skos:notation "footslope" ;
  a MIXS:ProfilePositionEnum .

MIXS:ProfilePositionEnum.SHOULDER a owl:NamedIndividual ;
  skos:notation "shoulder" ;
  a MIXS:ProfilePositionEnum .

MIXS:ProfilePositionEnum.SUMMIT a owl:NamedIndividual ;
  skos:notation "summit" ;
  a MIXS:ProfilePositionEnum .

MIXS:ProfilePositionEnum.TOESLOPE a owl:NamedIndividual ;
  skos:notation "toeslope" ;
  a MIXS:ProfilePositionEnum .

MIXS:QuadPosEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:QuadPosEnum.EAST_SIDE MIXS:QuadPosEnum.NORTH_SIDE MIXS:QuadPosEnum.SOUTH_SIDE MIXS:QuadPosEnum.WEST_SIDE )
  ] .

MIXS:QuadPosEnum.EAST_SIDE a owl:NamedIndividual ;
  skos:notation "East side" ;
  a MIXS:QuadPosEnum .

MIXS:QuadPosEnum.NORTH_SIDE a owl:NamedIndividual ;
  skos:notation "North side" ;
  a MIXS:QuadPosEnum .

MIXS:QuadPosEnum.SOUTH_SIDE a owl:NamedIndividual ;
  skos:notation "South side" ;
  a MIXS:QuadPosEnum .

MIXS:QuadPosEnum.WEST_SIDE a owl:NamedIndividual ;
  skos:notation "West side" ;
  a MIXS:QuadPosEnum .

MIXS:RelSampLocEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:RelSampLocEnum.CENTER_OF_CAR MIXS:RelSampLocEnum.EDGE_OF_CAR MIXS:RelSampLocEnum.UNDER_A_SEAT )
  ] .

MIXS:RelSampLocEnum.CENTER_OF_CAR a owl:NamedIndividual ;
  skos:notation "center of car" ;
  a MIXS:RelSampLocEnum .

MIXS:RelSampLocEnum.EDGE_OF_CAR a owl:NamedIndividual ;
  skos:notation "edge of car" ;
  a MIXS:RelSampLocEnum .

MIXS:RelSampLocEnum.UNDER_A_SEAT a owl:NamedIndividual ;
  skos:notation "under a seat" ;
  a MIXS:RelSampLocEnum .

MIXS:RelToOxygenEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:RelToOxygenEnum.AEROBE MIXS:RelToOxygenEnum.ANAEROBE MIXS:RelToOxygenEnum.FACULTATIVE MIXS:RelToOxygenEnum.MICROAEROPHILIC MIXS:RelToOxygenEnum.MICROANAEROBE MIXS:RelToOxygenEnum.OBLIGATE_AEROBE MIXS:RelToOxygenEnum.OBLIGATE_ANAEROBE )
  ] .

MIXS:RelToOxygenEnum.AEROBE a owl:NamedIndividual ;
  skos:notation "aerobe" ;
  a MIXS:RelToOxygenEnum .

MIXS:RelToOxygenEnum.ANAEROBE a owl:NamedIndividual ;
  skos:notation "anaerobe" ;
  a MIXS:RelToOxygenEnum .

MIXS:RelToOxygenEnum.FACULTATIVE a owl:NamedIndividual ;
  skos:notation "facultative" ;
  a MIXS:RelToOxygenEnum .

MIXS:RelToOxygenEnum.MICROAEROPHILIC a owl:NamedIndividual ;
  skos:notation "microaerophilic" ;
  a MIXS:RelToOxygenEnum .

MIXS:RelToOxygenEnum.MICROANAEROBE a owl:NamedIndividual ;
  skos:notation "microanaerobe" ;
  a MIXS:RelToOxygenEnum .

MIXS:RelToOxygenEnum.OBLIGATE_AEROBE a owl:NamedIndividual ;
  skos:notation "obligate aerobe" ;
  a MIXS:RelToOxygenEnum .

MIXS:RelToOxygenEnum.OBLIGATE_ANAEROBE a owl:NamedIndividual ;
  skos:notation "obligate anaerobe" ;
  a MIXS:RelToOxygenEnum .

MIXS:RoomCondtEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:RoomCondtEnum.DAMAGED MIXS:RoomCondtEnum.NEEDS_REPAIR MIXS:RoomCondtEnum.NEW MIXS:RoomCondtEnum.RUPTURE MIXS:RoomCondtEnum.VISIBLE_SIGNS_OF_MOLD_MILDEW MIXS:RoomCondtEnum.VISIBLE_WEAR )
  ] .

MIXS:RoomCondtEnum.DAMAGED a owl:NamedIndividual ;
  skos:notation "damaged" ;
  a MIXS:RoomCondtEnum .

MIXS:RoomCondtEnum.NEEDS_REPAIR a owl:NamedIndividual ;
  skos:notation "needs repair" ;
  a MIXS:RoomCondtEnum .

MIXS:RoomCondtEnum.NEW a owl:NamedIndividual ;
  skos:notation "new" ;
  a MIXS:RoomCondtEnum .

MIXS:RoomCondtEnum.RUPTURE a owl:NamedIndividual ;
  skos:notation "rupture" ;
  a MIXS:RoomCondtEnum .

MIXS:RoomCondtEnum.VISIBLE_SIGNS_OF_MOLD_MILDEW a owl:NamedIndividual ;
  skos:notation "visible signs of mold/mildew" ;
  a MIXS:RoomCondtEnum .

MIXS:RoomCondtEnum.VISIBLE_WEAR a owl:NamedIndividual ;
  skos:notation "visible wear" ;
  a MIXS:RoomCondtEnum .

MIXS:RoomConnectedEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:RoomConnectedEnum.ATTIC MIXS:RoomConnectedEnum.BATHROOM MIXS:RoomConnectedEnum.CLOSET MIXS:RoomConnectedEnum.CONFERENCE_ROOM MIXS:RoomConnectedEnum.ELEVATOR MIXS:RoomConnectedEnum.EXAMINING_ROOM MIXS:RoomConnectedEnum.HALLWAY MIXS:RoomConnectedEnum.KITCHEN MIXS:RoomConnectedEnum.MAIL_ROOM MIXS:RoomConnectedEnum.OFFICE MIXS:RoomConnectedEnum.STAIRWELL )
  ] .

MIXS:RoomConnectedEnum.ATTIC a owl:NamedIndividual ;
  skos:notation "attic" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.BATHROOM a owl:NamedIndividual ;
  skos:notation "bathroom" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.CLOSET a owl:NamedIndividual ;
  skos:notation "closet" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.CONFERENCE_ROOM a owl:NamedIndividual ;
  skos:notation "conference room" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.ELEVATOR a owl:NamedIndividual ;
  skos:notation "elevator" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.EXAMINING_ROOM a owl:NamedIndividual ;
  skos:notation "examining room" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.HALLWAY a owl:NamedIndividual ;
  skos:notation "hallway" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.KITCHEN a owl:NamedIndividual ;
  skos:notation "kitchen" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.MAIL_ROOM a owl:NamedIndividual ;
  skos:notation "mail room" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.OFFICE a owl:NamedIndividual ;
  skos:notation "office" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomConnectedEnum.STAIRWELL a owl:NamedIndividual ;
  skos:notation "stairwell" ;
  a MIXS:RoomConnectedEnum .

MIXS:RoomLocEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:RoomLocEnum.CORNER_ROOM MIXS:RoomLocEnum.EXTERIOR_WALL MIXS:RoomLocEnum.INTERIOR_ROOM )
  ] .

MIXS:RoomLocEnum.CORNER_ROOM a owl:NamedIndividual ;
  skos:notation "corner room" ;
  a MIXS:RoomLocEnum .

MIXS:RoomLocEnum.EXTERIOR_WALL a owl:NamedIndividual ;
  skos:notation "exterior wall" ;
  a MIXS:RoomLocEnum .

MIXS:RoomLocEnum.INTERIOR_ROOM a owl:NamedIndividual ;
  skos:notation "interior room" ;
  a MIXS:RoomLocEnum .

MIXS:RoomSampPosEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:RoomSampPosEnum.CENTER MIXS:RoomSampPosEnum.EAST_CORNER MIXS:RoomSampPosEnum.NORTH_CORNER MIXS:RoomSampPosEnum.NORTHEAST_CORNER MIXS:RoomSampPosEnum.NORTHWEST_CORNER MIXS:RoomSampPosEnum.SOUTH_CORNER MIXS:RoomSampPosEnum.SOUTHEAST_CORNER MIXS:RoomSampPosEnum.SOUTHWEST_CORNER MIXS:RoomSampPosEnum.WEST_CORNER )
  ] .

MIXS:RoomSampPosEnum.CENTER a owl:NamedIndividual ;
  skos:notation "center" ;
  a MIXS:RoomSampPosEnum .

MIXS:RoomSampPosEnum.EAST_CORNER a owl:NamedIndividual ;
  skos:notation "east corner" ;
  a MIXS:RoomSampPosEnum .

MIXS:RoomSampPosEnum.NORTH_CORNER a owl:NamedIndividual ;
  skos:notation "north corner" ;
  a MIXS:RoomSampPosEnum .

MIXS:RoomSampPosEnum.NORTHEAST_CORNER a owl:NamedIndividual ;
  skos:notation "northeast corner" ;
  a MIXS:RoomSampPosEnum .

MIXS:RoomSampPosEnum.NORTHWEST_CORNER a owl:NamedIndividual ;
  skos:notation "northwest corner" ;
  a MIXS:RoomSampPosEnum .

MIXS:RoomSampPosEnum.SOUTH_CORNER a owl:NamedIndividual ;
  skos:notation "south corner" ;
  a MIXS:RoomSampPosEnum .

MIXS:RoomSampPosEnum.SOUTHEAST_CORNER a owl:NamedIndividual ;
  skos:notation "southeast corner" ;
  a MIXS:RoomSampPosEnum .

MIXS:RoomSampPosEnum.SOUTHWEST_CORNER a owl:NamedIndividual ;
  skos:notation "southwest corner" ;
  a MIXS:RoomSampPosEnum .

MIXS:RoomSampPosEnum.WEST_CORNER a owl:NamedIndividual ;
  skos:notation "west corner" ;
  a MIXS:RoomSampPosEnum .

MIXS:RouteTransmissionEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:RouteTransmissionEnum.ENVIRONMENTAL_FAECAL_ORAL MIXS:RouteTransmissionEnum.TRANSPLACENTAL MIXS:RouteTransmissionEnum.VECTOR_BORNE_VECTOR_PENETRATION )
  ] .

MIXS:RouteTransmissionEnum.ENVIRONMENTAL_FAECAL_ORAL a owl:NamedIndividual ;
  skos:notation "environmental:faecal-oral" ;
  a MIXS:RouteTransmissionEnum .

MIXS:RouteTransmissionEnum.TRANSPLACENTAL a owl:NamedIndividual ;
  skos:notation "transplacental" ;
  a MIXS:RouteTransmissionEnum .

MIXS:RouteTransmissionEnum.VECTOR_BORNE_VECTOR_PENETRATION a owl:NamedIndividual ;
  skos:notation "vector-borne:vector penetration" ;
  a MIXS:RouteTransmissionEnum .

MIXS:SampCaptStatusEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampCaptStatusEnum.ACTIVE_SURVEILLANCE_IN_RESPONSE_TO_AN_OUTBREAK MIXS:SampCaptStatusEnum.ACTIVE_SURVEILLANCE_NOT_INITIATED_BY_AN_OUTBREAK MIXS:SampCaptStatusEnum.FARM_SAMPLE MIXS:SampCaptStatusEnum.MARKET_SAMPLE MIXS:SampCaptStatusEnum.OTHER )
  ] .

MIXS:SampCaptStatusEnum.ACTIVE_SURVEILLANCE_IN_RESPONSE_TO_AN_OUTBREAK a owl:NamedIndividual ;
  skos:notation "active surveillance in response to an outbreak" ;
  a MIXS:SampCaptStatusEnum .

MIXS:SampCaptStatusEnum.ACTIVE_SURVEILLANCE_NOT_INITIATED_BY_AN_OUTBREAK a owl:NamedIndividual ;
  skos:notation "active surveillance not initiated by an outbreak" ;
  a MIXS:SampCaptStatusEnum .

MIXS:SampCaptStatusEnum.FARM_SAMPLE a owl:NamedIndividual ;
  skos:notation "farm sample" ;
  a MIXS:SampCaptStatusEnum .

MIXS:SampCaptStatusEnum.MARKET_SAMPLE a owl:NamedIndividual ;
  skos:notation "market sample" ;
  a MIXS:SampCaptStatusEnum .

MIXS:SampCaptStatusEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:SampCaptStatusEnum .

MIXS:SampCategoryEnum a owl:Class ;
  rdfs:comment "Controlled vocabulary defining the category of a sample based on its experiental role." ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampCategoryEnum.OTHER MIXS:SampCategoryEnum.PCR_STANDARD MIXS:SampCategoryEnum.NEGATIVE_CONTROL MIXS:SampCategoryEnum.POSITIVE_CONTROL MIXS:SampCategoryEnum.SAMPLE )
  ] .

MIXS:SampCategoryEnum.OTHER a owl:NamedIndividual ;
  skos:notation "Other" ;
  rdfs:comment "Other types of samples not represented in the controlled vocabulary." ;
  a MIXS:SampCategoryEnum .

MIXS:SampCategoryEnum.PCR_STANDARD a owl:NamedIndividual ;
  skos:notation "PCR standard" ;
  rdfs:comment "Standard consisting of known quantities of target nucleic acid used to generate calibration curves and enable quantification of target molecules." ;
  a MIXS:SampCategoryEnum .

MIXS:SampCategoryEnum.NEGATIVE_CONTROL a owl:NamedIndividual ;
  skos:notation "negative control" ;
  rdfs:comment "Negative control used to detect contamination, such as field negatives, extraction negatives, or PCR negatives (No-template control; NTC)." ;
  a MIXS:SampCategoryEnum .

MIXS:SampCategoryEnum.POSITIVE_CONTROL a owl:NamedIndividual ;
  skos:notation "positive control" ;
  rdfs:comment "Positive control used to verify successful amplification or detection, such as extraction positives or PCR positives." ;
  a MIXS:SampCategoryEnum .

MIXS:SampCategoryEnum.SAMPLE a owl:NamedIndividual ;
  skos:notation "sample" ;
  rdfs:comment "Biological or environmental sample, including biological and technical replicates." ;
  a MIXS:SampCategoryEnum .

MIXS:SampCollectPointEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampCollectPointEnum.DRILLING_RIG MIXS:SampCollectPointEnum.OTHER MIXS:SampCollectPointEnum.SEPARATOR MIXS:SampCollectPointEnum.STORAGE_TANK MIXS:SampCollectPointEnum.TEST_WELL MIXS:SampCollectPointEnum.WELL MIXS:SampCollectPointEnum.WELLHEAD )
  ] .

MIXS:SampCollectPointEnum.DRILLING_RIG a owl:NamedIndividual ;
  skos:notation "drilling rig" ;
  a MIXS:SampCollectPointEnum .

MIXS:SampCollectPointEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:SampCollectPointEnum .

MIXS:SampCollectPointEnum.SEPARATOR a owl:NamedIndividual ;
  skos:notation "separator" ;
  a MIXS:SampCollectPointEnum .

MIXS:SampCollectPointEnum.STORAGE_TANK a owl:NamedIndividual ;
  skos:notation "storage tank" ;
  a MIXS:SampCollectPointEnum .

MIXS:SampCollectPointEnum.TEST_WELL a owl:NamedIndividual ;
  skos:notation "test well" ;
  a MIXS:SampCollectPointEnum .

MIXS:SampCollectPointEnum.WELL a owl:NamedIndividual ;
  skos:notation "well" ;
  a MIXS:SampCollectPointEnum .

MIXS:SampCollectPointEnum.WELLHEAD a owl:NamedIndividual ;
  skos:notation "wellhead" ;
  a MIXS:SampCollectPointEnum .

MIXS:SampDisStageEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampDisStageEnum.DISSEMINATION MIXS:SampDisStageEnum.GROWTH_AND_REPRODUCTION MIXS:SampDisStageEnum.INFECTION MIXS:SampDisStageEnum.INOCULATION MIXS:SampDisStageEnum.OTHER MIXS:SampDisStageEnum.PENETRATION )
  ] .

MIXS:SampDisStageEnum.DISSEMINATION a owl:NamedIndividual ;
  skos:notation "dissemination" ;
  a MIXS:SampDisStageEnum .

MIXS:SampDisStageEnum.GROWTH_AND_REPRODUCTION a owl:NamedIndividual ;
  skos:notation "growth and reproduction" ;
  a MIXS:SampDisStageEnum .

MIXS:SampDisStageEnum.INFECTION a owl:NamedIndividual ;
  skos:notation "infection" ;
  a MIXS:SampDisStageEnum .

MIXS:SampDisStageEnum.INOCULATION a owl:NamedIndividual ;
  skos:notation "inoculation" ;
  a MIXS:SampDisStageEnum .

MIXS:SampDisStageEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:SampDisStageEnum .

MIXS:SampDisStageEnum.PENETRATION a owl:NamedIndividual ;
  skos:notation "penetration" ;
  a MIXS:SampDisStageEnum .

MIXS:SampLocConditionEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampLocConditionEnum.DAMAGED MIXS:SampLocConditionEnum.NEW MIXS:SampLocConditionEnum.RUPTURE MIXS:SampLocConditionEnum.VISIBLE_SIGNS_OF_MOLD_MILDEW MIXS:SampLocConditionEnum.VISIBLE_WEARINESS_REPAIR )
  ] .

MIXS:SampLocConditionEnum.DAMAGED a owl:NamedIndividual ;
  skos:notation "damaged" ;
  a MIXS:SampLocConditionEnum .

MIXS:SampLocConditionEnum.NEW a owl:NamedIndividual ;
  skos:notation "new" ;
  a MIXS:SampLocConditionEnum .

MIXS:SampLocConditionEnum.RUPTURE a owl:NamedIndividual ;
  skos:notation "rupture" ;
  a MIXS:SampLocConditionEnum .

MIXS:SampLocConditionEnum.VISIBLE_SIGNS_OF_MOLD_MILDEW a owl:NamedIndividual ;
  skos:notation "visible signs of mold-mildew" ;
  a MIXS:SampLocConditionEnum .

MIXS:SampLocConditionEnum.VISIBLE_WEARINESS_REPAIR a owl:NamedIndividual ;
  skos:notation "visible weariness repair" ;
  a MIXS:SampLocConditionEnum .

MIXS:SampSubtypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampSubtypeEnum.BIOFILM MIXS:SampSubtypeEnum.NOT_APPLICABLE MIXS:SampSubtypeEnum.OIL_PHASE MIXS:SampSubtypeEnum.OTHER MIXS:SampSubtypeEnum.WATER_PHASE )
  ] .

MIXS:SampSubtypeEnum.BIOFILM a owl:NamedIndividual ;
  skos:notation "biofilm" ;
  a MIXS:SampSubtypeEnum .

MIXS:SampSubtypeEnum.NOT_APPLICABLE a owl:NamedIndividual ;
  skos:notation "not applicable" ;
  a MIXS:SampSubtypeEnum .

MIXS:SampSubtypeEnum.OIL_PHASE a owl:NamedIndividual ;
  skos:notation "oil phase" ;
  a MIXS:SampSubtypeEnum .

MIXS:SampSubtypeEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:SampSubtypeEnum .

MIXS:SampSubtypeEnum.WATER_PHASE a owl:NamedIndividual ;
  skos:notation "water phase" ;
  a MIXS:SampSubtypeEnum .

MIXS:SampSurfMoistureEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampSurfMoistureEnum.INTERMITTENT_MOISTURE MIXS:SampSurfMoistureEnum.NOT_PRESENT MIXS:SampSurfMoistureEnum.SUBMERGED )
  ] .

MIXS:SampSurfMoistureEnum.INTERMITTENT_MOISTURE a owl:NamedIndividual ;
  skos:notation "intermittent moisture" ;
  a MIXS:SampSurfMoistureEnum .

MIXS:SampSurfMoistureEnum.NOT_PRESENT a owl:NamedIndividual ;
  skos:notation "not present" ;
  a MIXS:SampSurfMoistureEnum .

MIXS:SampSurfMoistureEnum.SUBMERGED a owl:NamedIndividual ;
  skos:notation "submerged" ;
  a MIXS:SampSurfMoistureEnum .

MIXS:SampTransportContEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampTransportContEnum.BOTTLE MIXS:SampTransportContEnum.COOLER MIXS:SampTransportContEnum.GLASS_VIAL MIXS:SampTransportContEnum.PLASTIC_VIAL MIXS:SampTransportContEnum.VENDOR_SUPPLIED_CONTAINER )
  ] .

MIXS:SampTransportContEnum.BOTTLE a owl:NamedIndividual ;
  skos:notation "bottle" ;
  a MIXS:SampTransportContEnum .

MIXS:SampTransportContEnum.COOLER a owl:NamedIndividual ;
  skos:notation "cooler" ;
  a MIXS:SampTransportContEnum .

MIXS:SampTransportContEnum.GLASS_VIAL a owl:NamedIndividual ;
  skos:notation "glass vial" ;
  a MIXS:SampTransportContEnum .

MIXS:SampTransportContEnum.PLASTIC_VIAL a owl:NamedIndividual ;
  skos:notation "plastic vial" ;
  a MIXS:SampTransportContEnum .

MIXS:SampTransportContEnum.VENDOR_SUPPLIED_CONTAINER a owl:NamedIndividual ;
  skos:notation "vendor supplied container" ;
  a MIXS:SampTransportContEnum .

MIXS:SampWeatherEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SampWeatherEnum.CLEAR_SKY MIXS:SampWeatherEnum.CLOUDY MIXS:SampWeatherEnum.FOGGY MIXS:SampWeatherEnum.HAIL MIXS:SampWeatherEnum.RAIN MIXS:SampWeatherEnum.SLEET MIXS:SampWeatherEnum.SNOW MIXS:SampWeatherEnum.SUNNY MIXS:SampWeatherEnum.WINDY )
  ] .

MIXS:SampWeatherEnum.CLEAR_SKY a owl:NamedIndividual ;
  skos:notation "clear sky" ;
  a MIXS:SampWeatherEnum .

MIXS:SampWeatherEnum.CLOUDY a owl:NamedIndividual ;
  skos:notation "cloudy" ;
  a MIXS:SampWeatherEnum .

MIXS:SampWeatherEnum.FOGGY a owl:NamedIndividual ;
  skos:notation "foggy" ;
  a MIXS:SampWeatherEnum .

MIXS:SampWeatherEnum.HAIL a owl:NamedIndividual ;
  skos:notation "hail" ;
  a MIXS:SampWeatherEnum .

MIXS:SampWeatherEnum.RAIN a owl:NamedIndividual ;
  skos:notation "rain" ;
  a MIXS:SampWeatherEnum .

MIXS:SampWeatherEnum.SLEET a owl:NamedIndividual ;
  skos:notation "sleet" ;
  a MIXS:SampWeatherEnum .

MIXS:SampWeatherEnum.SNOW a owl:NamedIndividual ;
  skos:notation "snow" ;
  a MIXS:SampWeatherEnum .

MIXS:SampWeatherEnum.SUNNY a owl:NamedIndividual ;
  skos:notation "sunny" ;
  a MIXS:SampWeatherEnum .

MIXS:SampWeatherEnum.WINDY a owl:NamedIndividual ;
  skos:notation "windy" ;
  a MIXS:SampWeatherEnum .

MIXS:ScLysisApproachEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ScLysisApproachEnum.CHEMICAL MIXS:ScLysisApproachEnum.COMBINATION MIXS:ScLysisApproachEnum.ENZYMATIC MIXS:ScLysisApproachEnum.PHYSICAL )
  ] .

MIXS:ScLysisApproachEnum.CHEMICAL a owl:NamedIndividual ;
  skos:notation "chemical" ;
  a MIXS:ScLysisApproachEnum .

MIXS:ScLysisApproachEnum.COMBINATION a owl:NamedIndividual ;
  skos:notation "combination" ;
  a MIXS:ScLysisApproachEnum .

MIXS:ScLysisApproachEnum.ENZYMATIC a owl:NamedIndividual ;
  skos:notation "enzymatic" ;
  a MIXS:ScLysisApproachEnum .

MIXS:ScLysisApproachEnum.PHYSICAL a owl:NamedIndividual ;
  skos:notation "physical" ;
  a MIXS:ScLysisApproachEnum .

MIXS:SeasonEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( NCIT:C94733 NCIT:C94731 NCIT:C94732 NCIT:C94730 )
  ] .

NCIT:C94733 a owl:NamedIndividual ;
  skos:notation "autumn [NCIT:C94733]" ;
  a MIXS:SeasonEnum .

NCIT:C94731 a owl:NamedIndividual ;
  skos:notation "spring [NCIT:C94731]" ;
  a MIXS:SeasonEnum .

NCIT:C94732 a owl:NamedIndividual ;
  skos:notation "summer [NCIT:C94732]" ;
  a MIXS:SeasonEnum .

NCIT:C94730 a owl:NamedIndividual ;
  skos:notation "winter [NCIT:C94730]" ;
  a MIXS:SeasonEnum .

MIXS:SeasonUseEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SeasonUseEnum.FALL MIXS:SeasonUseEnum.SPRING MIXS:SeasonUseEnum.SUMMER MIXS:SeasonUseEnum.WINTER )
  ] .

MIXS:SeasonUseEnum.FALL a owl:NamedIndividual ;
  skos:notation "Fall" ;
  a MIXS:SeasonUseEnum .

MIXS:SeasonUseEnum.SPRING a owl:NamedIndividual ;
  skos:notation "Spring" ;
  a MIXS:SeasonUseEnum .

MIXS:SeasonUseEnum.SUMMER a owl:NamedIndividual ;
  skos:notation "Summer" ;
  a MIXS:SeasonUseEnum .

MIXS:SeasonUseEnum.WINTER a owl:NamedIndividual ;
  skos:notation "Winter" ;
  a MIXS:SeasonUseEnum .

MIXS:SedimentTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SedimentTypeEnum.BIOGENOUS MIXS:SedimentTypeEnum.COSMOGENOUS MIXS:SedimentTypeEnum.HYDROGENOUS MIXS:SedimentTypeEnum.LITHOGENOUS )
  ] .

MIXS:SedimentTypeEnum.BIOGENOUS a owl:NamedIndividual ;
  skos:notation "biogenous" ;
  a MIXS:SedimentTypeEnum .

MIXS:SedimentTypeEnum.COSMOGENOUS a owl:NamedIndividual ;
  skos:notation "cosmogenous" ;
  a MIXS:SedimentTypeEnum .

MIXS:SedimentTypeEnum.HYDROGENOUS a owl:NamedIndividual ;
  skos:notation "hydrogenous" ;
  a MIXS:SedimentTypeEnum .

MIXS:SedimentTypeEnum.LITHOGENOUS a owl:NamedIndividual ;
  skos:notation "lithogenous" ;
  a MIXS:SedimentTypeEnum .

MIXS:SeqQualityCheckEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SeqQualityCheckEnum.MANUALLY_EDITED MIXS:SeqQualityCheckEnum.NONE )
  ] .

MIXS:SeqQualityCheckEnum.MANUALLY_EDITED a owl:NamedIndividual ;
  skos:notation "manually edited" ;
  a MIXS:SeqQualityCheckEnum .

MIXS:SeqQualityCheckEnum.NONE a owl:NamedIndividual ;
  skos:notation "none" ;
  a MIXS:SeqQualityCheckEnum .

MIXS:ShadingDeviceLocEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ShadingDeviceLocEnum.EXTERIOR MIXS:ShadingDeviceLocEnum.INTERIOR )
  ] .

MIXS:ShadingDeviceLocEnum.EXTERIOR a owl:NamedIndividual ;
  skos:notation "exterior" ;
  a MIXS:ShadingDeviceLocEnum .

MIXS:ShadingDeviceLocEnum.INTERIOR a owl:NamedIndividual ;
  skos:notation "interior" ;
  a MIXS:ShadingDeviceLocEnum .

MIXS:ShadingDeviceTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:ShadingDeviceTypeEnum.BAHAMA_SHUTTERS MIXS:ShadingDeviceTypeEnum.EXTERIOR_ROLL_BLIND MIXS:ShadingDeviceTypeEnum.GAMBREL_AWNING MIXS:ShadingDeviceTypeEnum.HOOD_AWNING MIXS:ShadingDeviceTypeEnum.PORCHROLLER_AWNING MIXS:ShadingDeviceTypeEnum.SARASOTA_SHUTTERS MIXS:ShadingDeviceTypeEnum.SLATTED_ALUMINUM MIXS:ShadingDeviceTypeEnum.SOLID_ALUMINUM_AWNING MIXS:ShadingDeviceTypeEnum.SUN_SCREEN MIXS:ShadingDeviceTypeEnum.TREE MIXS:ShadingDeviceTypeEnum.TRELLIS MIXS:ShadingDeviceTypeEnum.VENETIAN_AWNING )
  ] .

MIXS:ShadingDeviceTypeEnum.BAHAMA_SHUTTERS a owl:NamedIndividual ;
  skos:notation "bahama shutters" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.EXTERIOR_ROLL_BLIND a owl:NamedIndividual ;
  skos:notation "exterior roll blind" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.GAMBREL_AWNING a owl:NamedIndividual ;
  skos:notation "gambrel awning" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.HOOD_AWNING a owl:NamedIndividual ;
  skos:notation "hood awning" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.PORCHROLLER_AWNING a owl:NamedIndividual ;
  skos:notation "porchroller awning" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.SARASOTA_SHUTTERS a owl:NamedIndividual ;
  skos:notation "sarasota shutters" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.SLATTED_ALUMINUM a owl:NamedIndividual ;
  skos:notation "slatted aluminum" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.SOLID_ALUMINUM_AWNING a owl:NamedIndividual ;
  skos:notation "solid aluminum awning" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.SUN_SCREEN a owl:NamedIndividual ;
  skos:notation "sun screen" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.TREE a owl:NamedIndividual ;
  skos:notation "tree" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.TRELLIS a owl:NamedIndividual ;
  skos:notation "trellis" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:ShadingDeviceTypeEnum.VENETIAN_AWNING a owl:NamedIndividual ;
  skos:notation "venetian awning" ;
  a MIXS:ShadingDeviceTypeEnum .

MIXS:SoilHorizonEnum a owl:Class ;
  rdfs:seeAlso <https://www.nrcs.usda.gov/resources/education-and-teaching-materials/a-soil-profile> , <https://www.ffa.org/ag-101/ag-101-soil-horizons/> , <https://soil.evs.buffalo.edu/index.php/Soil_Horizons> , <https://en.wikipedia.org/wiki/Soil_horizon> , <https://en.wikipedia.org/wiki/Permafrost> ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SoilHorizonEnum.A_HORIZON MIXS:SoilHorizonEnum.B_HORIZON MIXS:SoilHorizonEnum.C_HORIZON MIXS:SoilHorizonEnum.E_HORIZON <http://purl.obolibrary.org/obo/ENVO_03600018> MIXS:SoilHorizonEnum.PERMAFROST MIXS:SoilHorizonEnum.R_LAYER )
  ] .

MIXS:SoilHorizonEnum.A_HORIZON a owl:NamedIndividual ;
  skos:notation "A horizon" ;
  rdfs:comment "The surface horizon, also called topsoil. It has a defined soil structure, and is mostly made up of humus (decayed organic matter)." ;
  a MIXS:SoilHorizonEnum .

MIXS:SoilHorizonEnum.B_HORIZON a owl:NamedIndividual ;
  skos:notation "B horizon" ;
  rdfs:comment "Also known as the subsoil. It is greatly composed of material illuviated (washed in from) layers above it. It is typically denser than the A horizon and has a clayey texture." ;
  a MIXS:SoilHorizonEnum .

MIXS:SoilHorizonEnum.C_HORIZON a owl:NamedIndividual ;
  skos:notation "C horizon" ;
  rdfs:comment "Also known as the substratum is unconsolidated material deepest in the pit and closest to the bedrock." ;
  a MIXS:SoilHorizonEnum .

MIXS:SoilHorizonEnum.E_HORIZON a owl:NamedIndividual ;
  skos:notation "E horizon" ;
  rdfs:comment "Used to refer to subsurface horizons that have undergone a significant loss of minerals, also known as Eluviation (or leaching)." ;
  a MIXS:SoilHorizonEnum .

<http://purl.obolibrary.org/obo/ENVO_03600018> a owl:NamedIndividual ;
  skos:notation "O horizon" ;
  rdfs:comment "The organic horizon. Typically at the top of the soil structure and is made up of mostly organic matter." ;
  a MIXS:SoilHorizonEnum .

MIXS:SoilHorizonEnum.PERMAFROST a owl:NamedIndividual ;
  skos:notation "Permafrost" ;
  rdfs:comment "Soil that continuously remains below 0 °C (32 °F) for two years or more." ;
  a MIXS:SoilHorizonEnum .

MIXS:SoilHorizonEnum.R_LAYER a owl:NamedIndividual ;
  skos:notation "R layer" ;
  rdfs:comment "Hard bedrock, which is usually the lowest layer. It is characterized by tightly bound and unbreakable materials." ;
  skos:altLabel "R horizon" ;
  a MIXS:SoilHorizonEnum .

MIXS:SoilTextureClassEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SoilTextureClassEnum.CLAY MIXS:SoilTextureClassEnum.CLAY_LOAM MIXS:SoilTextureClassEnum.LOAM MIXS:SoilTextureClassEnum.LOAMY_SAND MIXS:SoilTextureClassEnum.SAND MIXS:SoilTextureClassEnum.SANDY_CLAY MIXS:SoilTextureClassEnum.SANDY_CLAY_LOAM MIXS:SoilTextureClassEnum.SANDY_LOAM MIXS:SoilTextureClassEnum.SILT MIXS:SoilTextureClassEnum.SILT_LOAM MIXS:SoilTextureClassEnum.SILTY_CLAY MIXS:SoilTextureClassEnum.SILTY_CLAY_LOAM )
  ] .

MIXS:SoilTextureClassEnum.CLAY a owl:NamedIndividual ;
  skos:notation "clay" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.CLAY_LOAM a owl:NamedIndividual ;
  skos:notation "clay loam" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.LOAM a owl:NamedIndividual ;
  skos:notation "loam" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.LOAMY_SAND a owl:NamedIndividual ;
  skos:notation "loamy sand" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.SAND a owl:NamedIndividual ;
  skos:notation "sand" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.SANDY_CLAY a owl:NamedIndividual ;
  skos:notation "sandy clay" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.SANDY_CLAY_LOAM a owl:NamedIndividual ;
  skos:notation "sandy clay loam" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.SANDY_LOAM a owl:NamedIndividual ;
  skos:notation "sandy loam" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.SILT a owl:NamedIndividual ;
  skos:notation "silt" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.SILT_LOAM a owl:NamedIndividual ;
  skos:notation "silt loam" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.SILTY_CLAY a owl:NamedIndividual ;
  skos:notation "silty clay" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SoilTextureClassEnum.SILTY_CLAY_LOAM a owl:NamedIndividual ;
  skos:notation "silty clay loam" ;
  a MIXS:SoilTextureClassEnum .

MIXS:SortTechEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SortTechEnum.FLOW_CYTOMETRIC_CELL_SORTING MIXS:SortTechEnum.LAZER_TWEEZING MIXS:SortTechEnum.MICROFLUIDICS MIXS:SortTechEnum.MICROMANIPULATION MIXS:SortTechEnum.OPTICAL_MANIPULATION MIXS:SortTechEnum.OTHER )
  ] .

MIXS:SortTechEnum.FLOW_CYTOMETRIC_CELL_SORTING a owl:NamedIndividual ;
  skos:notation "flow cytometric cell sorting" ;
  a MIXS:SortTechEnum .

MIXS:SortTechEnum.LAZER_TWEEZING a owl:NamedIndividual ;
  skos:notation "lazer-tweezing" ;
  a MIXS:SortTechEnum .

MIXS:SortTechEnum.MICROFLUIDICS a owl:NamedIndividual ;
  skos:notation "microfluidics" ;
  a MIXS:SortTechEnum .

MIXS:SortTechEnum.MICROMANIPULATION a owl:NamedIndividual ;
  skos:notation "micromanipulation" ;
  a MIXS:SortTechEnum .

MIXS:SortTechEnum.OPTICAL_MANIPULATION a owl:NamedIndividual ;
  skos:notation "optical manipulation" ;
  a MIXS:SortTechEnum .

MIXS:SortTechEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:SortTechEnum .

MIXS:SpaceTypStateEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SpaceTypStateEnum.TYPICALLY_OCCUPIED MIXS:SpaceTypStateEnum.TYPICALLY_UNOCCUPIED )
  ] .

MIXS:SpaceTypStateEnum.TYPICALLY_OCCUPIED a owl:NamedIndividual ;
  skos:notation "typically occupied" ;
  a MIXS:SpaceTypStateEnum .

MIXS:SpaceTypStateEnum.TYPICALLY_UNOCCUPIED a owl:NamedIndividual ;
  skos:notation "typically unoccupied" ;
  a MIXS:SpaceTypStateEnum .

MIXS:SpecificEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SpecificEnum.AS_BUILT MIXS:SpecificEnum.BID MIXS:SpecificEnum.CONSTRUCTION MIXS:SpecificEnum.DESIGN MIXS:SpecificEnum.OPERATION MIXS:SpecificEnum.PHOTOS )
  ] .

MIXS:SpecificEnum.AS_BUILT a owl:NamedIndividual ;
  skos:notation "as built" ;
  a MIXS:SpecificEnum .

MIXS:SpecificEnum.BID a owl:NamedIndividual ;
  skos:notation "bid" ;
  a MIXS:SpecificEnum .

MIXS:SpecificEnum.CONSTRUCTION a owl:NamedIndividual ;
  skos:notation "construction" ;
  a MIXS:SpecificEnum .

MIXS:SpecificEnum.DESIGN a owl:NamedIndividual ;
  skos:notation "design" ;
  a MIXS:SpecificEnum .

MIXS:SpecificEnum.OPERATION a owl:NamedIndividual ;
  skos:notation "operation" ;
  a MIXS:SpecificEnum .

MIXS:SpecificEnum.PHOTOS a owl:NamedIndividual ;
  skos:notation "photos" ;
  a MIXS:SpecificEnum .

MIXS:SrDepEnvEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SrDepEnvEnum.FLUVIOLDELTAIC MIXS:SrDepEnvEnum.FLUVIOMARINE MIXS:SrDepEnvEnum.LACUSTINE MIXS:SrDepEnvEnum.MARINE MIXS:SrDepEnvEnum.OTHER )
  ] .

MIXS:SrDepEnvEnum.FLUVIOLDELTAIC a owl:NamedIndividual ;
  skos:notation "Fluvioldeltaic" ;
  a MIXS:SrDepEnvEnum .

MIXS:SrDepEnvEnum.FLUVIOMARINE a owl:NamedIndividual ;
  skos:notation "Fluviomarine" ;
  a MIXS:SrDepEnvEnum .

MIXS:SrDepEnvEnum.LACUSTINE a owl:NamedIndividual ;
  skos:notation "Lacustine" ;
  a MIXS:SrDepEnvEnum .

MIXS:SrDepEnvEnum.MARINE a owl:NamedIndividual ;
  skos:notation "Marine" ;
  a MIXS:SrDepEnvEnum .

MIXS:SrDepEnvEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:SrDepEnvEnum .

MIXS:SrKerogTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SrKerogTypeEnum.TYPE_I MIXS:SrKerogTypeEnum.TYPE_II MIXS:SrKerogTypeEnum.TYPE_III MIXS:SrKerogTypeEnum.TYPE_IV MIXS:SrKerogTypeEnum.OTHER )
  ] .

MIXS:SrKerogTypeEnum.TYPE_I a owl:NamedIndividual ;
  skos:notation "Type I" ;
  a MIXS:SrKerogTypeEnum .

MIXS:SrKerogTypeEnum.TYPE_II a owl:NamedIndividual ;
  skos:notation "Type II" ;
  a MIXS:SrKerogTypeEnum .

MIXS:SrKerogTypeEnum.TYPE_III a owl:NamedIndividual ;
  skos:notation "Type III" ;
  a MIXS:SrKerogTypeEnum .

MIXS:SrKerogTypeEnum.TYPE_IV a owl:NamedIndividual ;
  skos:notation "Type IV" ;
  a MIXS:SrKerogTypeEnum .

MIXS:SrKerogTypeEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:SrKerogTypeEnum .

MIXS:SrLithologyEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SrLithologyEnum.BIOSILICIEOUS MIXS:SrLithologyEnum.CARBONATE MIXS:SrLithologyEnum.CLASTIC MIXS:SrLithologyEnum.COAL MIXS:SrLithologyEnum.OTHER )
  ] .

MIXS:SrLithologyEnum.BIOSILICIEOUS a owl:NamedIndividual ;
  skos:notation "Biosilicieous" ;
  a MIXS:SrLithologyEnum .

MIXS:SrLithologyEnum.CARBONATE a owl:NamedIndividual ;
  skos:notation "Carbonate" ;
  a MIXS:SrLithologyEnum .

MIXS:SrLithologyEnum.CLASTIC a owl:NamedIndividual ;
  skos:notation "Clastic" ;
  a MIXS:SrLithologyEnum .

MIXS:SrLithologyEnum.COAL a owl:NamedIndividual ;
  skos:notation "Coal" ;
  a MIXS:SrLithologyEnum .

MIXS:SrLithologyEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:SrLithologyEnum .

MIXS:SubstructureTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SubstructureTypeEnum.BASEMENT MIXS:SubstructureTypeEnum.CRAWLSPACE MIXS:SubstructureTypeEnum.SLAB_ON_GRADE )
  ] .

MIXS:SubstructureTypeEnum.BASEMENT a owl:NamedIndividual ;
  skos:notation "basement" ;
  a MIXS:SubstructureTypeEnum .

MIXS:SubstructureTypeEnum.CRAWLSPACE a owl:NamedIndividual ;
  skos:notation "crawlspace" ;
  a MIXS:SubstructureTypeEnum .

MIXS:SubstructureTypeEnum.SLAB_ON_GRADE a owl:NamedIndividual ;
  skos:notation "slab on grade" ;
  a MIXS:SubstructureTypeEnum .

MIXS:SurfAirContEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SurfAirContEnum.BIOCIDES MIXS:SurfAirContEnum.BIOLOGICAL_CONTAMINANTS MIXS:SurfAirContEnum.DUST MIXS:SurfAirContEnum.NUTRIENTS MIXS:SurfAirContEnum.ORGANIC_MATTER MIXS:SurfAirContEnum.PARTICULATE_MATTER MIXS:SurfAirContEnum.RADON MIXS:SurfAirContEnum.VOLATILE_ORGANIC_COMPOUNDS )
  ] .

MIXS:SurfAirContEnum.BIOCIDES a owl:NamedIndividual ;
  skos:notation "biocides" ;
  a MIXS:SurfAirContEnum .

MIXS:SurfAirContEnum.BIOLOGICAL_CONTAMINANTS a owl:NamedIndividual ;
  skos:notation "biological contaminants" ;
  a MIXS:SurfAirContEnum .

MIXS:SurfAirContEnum.DUST a owl:NamedIndividual ;
  skos:notation "dust" ;
  a MIXS:SurfAirContEnum .

MIXS:SurfAirContEnum.NUTRIENTS a owl:NamedIndividual ;
  skos:notation "nutrients" ;
  a MIXS:SurfAirContEnum .

MIXS:SurfAirContEnum.ORGANIC_MATTER a owl:NamedIndividual ;
  skos:notation "organic matter" ;
  a MIXS:SurfAirContEnum .

MIXS:SurfAirContEnum.PARTICULATE_MATTER a owl:NamedIndividual ;
  skos:notation "particulate matter" ;
  a MIXS:SurfAirContEnum .

MIXS:SurfAirContEnum.RADON a owl:NamedIndividual ;
  skos:notation "radon" ;
  a MIXS:SurfAirContEnum .

MIXS:SurfAirContEnum.VOLATILE_ORGANIC_COMPOUNDS a owl:NamedIndividual ;
  skos:notation "volatile organic compounds" ;
  a MIXS:SurfAirContEnum .

MIXS:SurfMaterialEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SurfMaterialEnum.ADOBE MIXS:SurfMaterialEnum.CARPET MIXS:SurfMaterialEnum.CINDER_BLOCKS MIXS:SurfMaterialEnum.CONCRETE MIXS:SurfMaterialEnum.GLASS MIXS:SurfMaterialEnum.HAY_BALES MIXS:SurfMaterialEnum.METAL MIXS:SurfMaterialEnum.PAINT MIXS:SurfMaterialEnum.PLASTIC MIXS:SurfMaterialEnum.STAINLESS_STEEL MIXS:SurfMaterialEnum.STONE MIXS:SurfMaterialEnum.STUCCO MIXS:SurfMaterialEnum.TILE MIXS:SurfMaterialEnum.VINYL MIXS:SurfMaterialEnum.WOOD )
  ] .

MIXS:SurfMaterialEnum.ADOBE a owl:NamedIndividual ;
  skos:notation "adobe" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.CARPET a owl:NamedIndividual ;
  skos:notation "carpet" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.CINDER_BLOCKS a owl:NamedIndividual ;
  skos:notation "cinder blocks" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.CONCRETE a owl:NamedIndividual ;
  skos:notation "concrete" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.GLASS a owl:NamedIndividual ;
  skos:notation "glass" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.HAY_BALES a owl:NamedIndividual ;
  skos:notation "hay bales" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.METAL a owl:NamedIndividual ;
  skos:notation "metal" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.PAINT a owl:NamedIndividual ;
  skos:notation "paint" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.PLASTIC a owl:NamedIndividual ;
  skos:notation "plastic" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.STAINLESS_STEEL a owl:NamedIndividual ;
  skos:notation "stainless steel" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.STONE a owl:NamedIndividual ;
  skos:notation "stone" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.STUCCO a owl:NamedIndividual ;
  skos:notation "stucco" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.TILE a owl:NamedIndividual ;
  skos:notation "tile" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.VINYL a owl:NamedIndividual ;
  skos:notation "vinyl" ;
  a MIXS:SurfMaterialEnum .

MIXS:SurfMaterialEnum.WOOD a owl:NamedIndividual ;
  skos:notation "wood" ;
  a MIXS:SurfMaterialEnum .

MIXS:SymLifeCycleTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SymLifeCycleTypeEnum.COMPLEX_LIFE_CYCLE MIXS:SymLifeCycleTypeEnum.SIMPLE_LIFE_CYCLE )
  ] .

MIXS:SymLifeCycleTypeEnum.COMPLEX_LIFE_CYCLE a owl:NamedIndividual ;
  skos:notation "complex life cycle" ;
  a MIXS:SymLifeCycleTypeEnum .

MIXS:SymLifeCycleTypeEnum.SIMPLE_LIFE_CYCLE a owl:NamedIndividual ;
  skos:notation "simple life cycle" ;
  a MIXS:SymLifeCycleTypeEnum .

MIXS:SymbiontHostRoleEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:SymbiontHostRoleEnum.ACCIDENTAL MIXS:SymbiontHostRoleEnum.DEAD_END MIXS:SymbiontHostRoleEnum.DEFINITIVE MIXS:SymbiontHostRoleEnum.INTERMEDIATE MIXS:SymbiontHostRoleEnum.PARATENIC MIXS:SymbiontHostRoleEnum.RESERVOIR MIXS:SymbiontHostRoleEnum.SINGLE_HOST )
  ] .

MIXS:SymbiontHostRoleEnum.ACCIDENTAL a owl:NamedIndividual ;
  skos:notation "accidental" ;
  a MIXS:SymbiontHostRoleEnum .

MIXS:SymbiontHostRoleEnum.DEAD_END a owl:NamedIndividual ;
  skos:notation "dead-end" ;
  a MIXS:SymbiontHostRoleEnum .

MIXS:SymbiontHostRoleEnum.DEFINITIVE a owl:NamedIndividual ;
  skos:notation "definitive" ;
  a MIXS:SymbiontHostRoleEnum .

MIXS:SymbiontHostRoleEnum.INTERMEDIATE a owl:NamedIndividual ;
  skos:notation "intermediate" ;
  a MIXS:SymbiontHostRoleEnum .

MIXS:SymbiontHostRoleEnum.PARATENIC a owl:NamedIndividual ;
  skos:notation "paratenic" ;
  a MIXS:SymbiontHostRoleEnum .

MIXS:SymbiontHostRoleEnum.RESERVOIR a owl:NamedIndividual ;
  skos:notation "reservoir" ;
  a MIXS:SymbiontHostRoleEnum .

MIXS:SymbiontHostRoleEnum.SINGLE_HOST a owl:NamedIndividual ;
  skos:notation "single host" ;
  a MIXS:SymbiontHostRoleEnum .

MIXS:TaxIdentEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:TaxIdentEnum.16_S_R_RNA_GENE MIXS:TaxIdentEnum.MULTI_MARKER_APPROACH MIXS:TaxIdentEnum.OTHER )
  ] .

MIXS:TaxIdentEnum.16_S_R_RNA_GENE a owl:NamedIndividual ;
  skos:notation "16S rRNA gene" ;
  a MIXS:TaxIdentEnum .

MIXS:TaxIdentEnum.MULTI_MARKER_APPROACH a owl:NamedIndividual ;
  skos:notation "multi-marker approach" ;
  a MIXS:TaxIdentEnum .

MIXS:TaxIdentEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:TaxIdentEnum .

MIXS:TidalStageEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:TidalStageEnum.EBB_TIDE MIXS:TidalStageEnum.FLOOD_TIDE MIXS:TidalStageEnum.HIGH_TIDE MIXS:TidalStageEnum.LOW_TIDE )
  ] .

MIXS:TidalStageEnum.EBB_TIDE a owl:NamedIndividual ;
  skos:notation "ebb tide" ;
  a MIXS:TidalStageEnum .

MIXS:TidalStageEnum.FLOOD_TIDE a owl:NamedIndividual ;
  skos:notation "flood tide" ;
  a MIXS:TidalStageEnum .

MIXS:TidalStageEnum.HIGH_TIDE a owl:NamedIndividual ;
  skos:notation "high tide" ;
  a MIXS:TidalStageEnum .

MIXS:TidalStageEnum.LOW_TIDE a owl:NamedIndividual ;
  skos:notation "low tide" ;
  a MIXS:TidalStageEnum .

MIXS:TillageEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:TillageEnum.CHISEL MIXS:TillageEnum.CUTTING_DISC MIXS:TillageEnum.DISC_PLOUGH MIXS:TillageEnum.DRILL MIXS:TillageEnum.MOULDBOARD MIXS:TillageEnum.RIDGE_TILL MIXS:TillageEnum.STRIP_TILLAGE MIXS:TillageEnum.TINED MIXS:TillageEnum.ZONAL_TILLAGE )
  ] .

MIXS:TillageEnum.CHISEL a owl:NamedIndividual ;
  skos:notation "chisel" ;
  a MIXS:TillageEnum .

MIXS:TillageEnum.CUTTING_DISC a owl:NamedIndividual ;
  skos:notation "cutting disc" ;
  a MIXS:TillageEnum .

MIXS:TillageEnum.DISC_PLOUGH a owl:NamedIndividual ;
  skos:notation "disc plough" ;
  a MIXS:TillageEnum .

MIXS:TillageEnum.DRILL a owl:NamedIndividual ;
  skos:notation "drill" ;
  a MIXS:TillageEnum .

MIXS:TillageEnum.MOULDBOARD a owl:NamedIndividual ;
  skos:notation "mouldboard" ;
  a MIXS:TillageEnum .

MIXS:TillageEnum.RIDGE_TILL a owl:NamedIndividual ;
  skos:notation "ridge till" ;
  a MIXS:TillageEnum .

MIXS:TillageEnum.STRIP_TILLAGE a owl:NamedIndividual ;
  skos:notation "strip tillage" ;
  a MIXS:TillageEnum .

MIXS:TillageEnum.TINED a owl:NamedIndividual ;
  skos:notation "tined" ;
  a MIXS:TillageEnum .

MIXS:TillageEnum.ZONAL_TILLAGE a owl:NamedIndividual ;
  skos:notation "zonal tillage" ;
  a MIXS:TillageEnum .

MIXS:TrainLineEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:TrainLineEnum.GREEN MIXS:TrainLineEnum.ORANGE MIXS:TrainLineEnum.RED )
  ] .

MIXS:TrainLineEnum.GREEN a owl:NamedIndividual ;
  skos:notation "green" ;
  a MIXS:TrainLineEnum .

MIXS:TrainLineEnum.ORANGE a owl:NamedIndividual ;
  skos:notation "orange" ;
  a MIXS:TrainLineEnum .

MIXS:TrainLineEnum.RED a owl:NamedIndividual ;
  skos:notation "red" ;
  a MIXS:TrainLineEnum .

MIXS:TrainStatLocEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:TrainStatLocEnum.FOREST_HILLS MIXS:TrainStatLocEnum.RIVERSIDE MIXS:TrainStatLocEnum.SOUTH_STATION_ABOVE_GROUND MIXS:TrainStatLocEnum.SOUTH_STATION_AMTRAK MIXS:TrainStatLocEnum.SOUTH_STATION_UNDERGROUND )
  ] .

MIXS:TrainStatLocEnum.FOREST_HILLS a owl:NamedIndividual ;
  skos:notation "forest hills" ;
  a MIXS:TrainStatLocEnum .

MIXS:TrainStatLocEnum.RIVERSIDE a owl:NamedIndividual ;
  skos:notation "riverside" ;
  a MIXS:TrainStatLocEnum .

MIXS:TrainStatLocEnum.SOUTH_STATION_ABOVE_GROUND a owl:NamedIndividual ;
  skos:notation "south station above ground" ;
  a MIXS:TrainStatLocEnum .

MIXS:TrainStatLocEnum.SOUTH_STATION_AMTRAK a owl:NamedIndividual ;
  skos:notation "south station amtrak" ;
  a MIXS:TrainStatLocEnum .

MIXS:TrainStatLocEnum.SOUTH_STATION_UNDERGROUND a owl:NamedIndividual ;
  skos:notation "south station underground" ;
  a MIXS:TrainStatLocEnum .

MIXS:TrainStopLocEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:TrainStopLocEnum.DOWNTOWN MIXS:TrainStopLocEnum.END MIXS:TrainStopLocEnum.MID )
  ] .

MIXS:TrainStopLocEnum.DOWNTOWN a owl:NamedIndividual ;
  skos:notation "downtown" ;
  a MIXS:TrainStopLocEnum .

MIXS:TrainStopLocEnum.END a owl:NamedIndividual ;
  skos:notation "end" ;
  a MIXS:TrainStopLocEnum .

MIXS:TrainStopLocEnum.MID a owl:NamedIndividual ;
  skos:notation "mid" ;
  a MIXS:TrainStopLocEnum .

MIXS:TrophicLevelEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:TrophicLevelEnum.AUTOTROPH MIXS:TrophicLevelEnum.CARBOXYDOTROPH MIXS:TrophicLevelEnum.CHEMOAUTOLITHOTROPH MIXS:TrophicLevelEnum.CHEMOAUTOTROPH MIXS:TrophicLevelEnum.CHEMOHETEROTROPH MIXS:TrophicLevelEnum.CHEMOLITHOAUTOTROPH MIXS:TrophicLevelEnum.CHEMOLITHOTROPH MIXS:TrophicLevelEnum.CHEMOORGANOHETEROTROPH MIXS:TrophicLevelEnum.CHEMOORGANOTROPH MIXS:TrophicLevelEnum.CHEMOSYNTHETIC MIXS:TrophicLevelEnum.CHEMOTROPH MIXS:TrophicLevelEnum.COPIOTROPH MIXS:TrophicLevelEnum.DIAZOTROPH MIXS:TrophicLevelEnum.FACULTATIVE MIXS:TrophicLevelEnum.HETEROTROPH MIXS:TrophicLevelEnum.LITHOAUTOTROPH MIXS:TrophicLevelEnum.LITHOHETEROTROPH MIXS:TrophicLevelEnum.LITHOTROPH MIXS:TrophicLevelEnum.METHANOTROPH MIXS:TrophicLevelEnum.METHYLOTROPH MIXS:TrophicLevelEnum.MIXOTROPH MIXS:TrophicLevelEnum.OBLIGATE MIXS:TrophicLevelEnum.OLIGOTROPH MIXS:TrophicLevelEnum.ORGANOHETEROTROPH MIXS:TrophicLevelEnum.ORGANOTROPH MIXS:TrophicLevelEnum.PHOTOAUTOTROPH MIXS:TrophicLevelEnum.PHOTOHETEROTROPH MIXS:TrophicLevelEnum.PHOTOLITHOAUTOTROPH MIXS:TrophicLevelEnum.PHOTOLITHOTROPH MIXS:TrophicLevelEnum.PHOTOSYNTHETIC MIXS:TrophicLevelEnum.PHOTOTROPH )
  ] .

MIXS:TrophicLevelEnum.AUTOTROPH a owl:NamedIndividual ;
  skos:notation "autotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CARBOXYDOTROPH a owl:NamedIndividual ;
  skos:notation "carboxydotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOAUTOLITHOTROPH a owl:NamedIndividual ;
  skos:notation "chemoautolithotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOAUTOTROPH a owl:NamedIndividual ;
  skos:notation "chemoautotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOHETEROTROPH a owl:NamedIndividual ;
  skos:notation "chemoheterotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOLITHOAUTOTROPH a owl:NamedIndividual ;
  skos:notation "chemolithoautotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOLITHOTROPH a owl:NamedIndividual ;
  skos:notation "chemolithotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOORGANOHETEROTROPH a owl:NamedIndividual ;
  skos:notation "chemoorganoheterotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOORGANOTROPH a owl:NamedIndividual ;
  skos:notation "chemoorganotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOSYNTHETIC a owl:NamedIndividual ;
  skos:notation "chemosynthetic" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.CHEMOTROPH a owl:NamedIndividual ;
  skos:notation "chemotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.COPIOTROPH a owl:NamedIndividual ;
  skos:notation "copiotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.DIAZOTROPH a owl:NamedIndividual ;
  skos:notation "diazotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.FACULTATIVE a owl:NamedIndividual ;
  skos:notation "facultative" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.HETEROTROPH a owl:NamedIndividual ;
  skos:notation "heterotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.LITHOAUTOTROPH a owl:NamedIndividual ;
  skos:notation "lithoautotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.LITHOHETEROTROPH a owl:NamedIndividual ;
  skos:notation "lithoheterotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.LITHOTROPH a owl:NamedIndividual ;
  skos:notation "lithotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.METHANOTROPH a owl:NamedIndividual ;
  skos:notation "methanotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.METHYLOTROPH a owl:NamedIndividual ;
  skos:notation "methylotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.MIXOTROPH a owl:NamedIndividual ;
  skos:notation "mixotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.OBLIGATE a owl:NamedIndividual ;
  skos:notation "obligate" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.OLIGOTROPH a owl:NamedIndividual ;
  skos:notation "oligotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.ORGANOHETEROTROPH a owl:NamedIndividual ;
  skos:notation "organoheterotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.ORGANOTROPH a owl:NamedIndividual ;
  skos:notation "organotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.PHOTOAUTOTROPH a owl:NamedIndividual ;
  skos:notation "photoautotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.PHOTOHETEROTROPH a owl:NamedIndividual ;
  skos:notation "photoheterotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.PHOTOLITHOAUTOTROPH a owl:NamedIndividual ;
  skos:notation "photolithoautotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.PHOTOLITHOTROPH a owl:NamedIndividual ;
  skos:notation "photolithotroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.PHOTOSYNTHETIC a owl:NamedIndividual ;
  skos:notation "photosynthetic" ;
  a MIXS:TrophicLevelEnum .

MIXS:TrophicLevelEnum.PHOTOTROPH a owl:NamedIndividual ;
  skos:notation "phototroph" ;
  a MIXS:TrophicLevelEnum .

MIXS:TypeOfSymbiosisEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:TypeOfSymbiosisEnum.COMMENSALISTIC MIXS:TypeOfSymbiosisEnum.MUTUALISTIC MIXS:TypeOfSymbiosisEnum.PARASITIC )
  ] .

MIXS:TypeOfSymbiosisEnum.COMMENSALISTIC a owl:NamedIndividual ;
  skos:notation "commensalistic" ;
  a MIXS:TypeOfSymbiosisEnum .

MIXS:TypeOfSymbiosisEnum.MUTUALISTIC a owl:NamedIndividual ;
  skos:notation "mutualistic" ;
  a MIXS:TypeOfSymbiosisEnum .

MIXS:TypeOfSymbiosisEnum.PARASITIC a owl:NamedIndividual ;
  skos:notation "parasitic" ;
  a MIXS:TypeOfSymbiosisEnum .

MIXS:UrineCollectMethEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:UrineCollectMethEnum.CATHETER MIXS:UrineCollectMethEnum.CLEAN_CATCH )
  ] .

MIXS:UrineCollectMethEnum.CATHETER a owl:NamedIndividual ;
  skos:notation "catheter" ;
  a MIXS:UrineCollectMethEnum .

MIXS:UrineCollectMethEnum.CLEAN_CATCH a owl:NamedIndividual ;
  skos:notation "clean catch" ;
  a MIXS:UrineCollectMethEnum .

MIXS:UrobiomSexEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:UrobiomSexEnum.FEMALE MIXS:UrobiomSexEnum.HERMAPHRODITE MIXS:UrobiomSexEnum.MALE MIXS:UrobiomSexEnum.NEUTER )
  ] .

MIXS:UrobiomSexEnum.FEMALE a owl:NamedIndividual ;
  skos:notation "female" ;
  a MIXS:UrobiomSexEnum .

MIXS:UrobiomSexEnum.HERMAPHRODITE a owl:NamedIndividual ;
  skos:notation "hermaphrodite" ;
  a MIXS:UrobiomSexEnum .

MIXS:UrobiomSexEnum.MALE a owl:NamedIndividual ;
  skos:notation "male" ;
  a MIXS:UrobiomSexEnum .

MIXS:UrobiomSexEnum.NEUTER a owl:NamedIndividual ;
  skos:notation "neuter" ;
  a MIXS:UrobiomSexEnum .

MIXS:ViralGenomeTypeEnum a owl:Class ;
  rdfs:comment "Types of viral genomes based on Baltimore classification" ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( SO:0000352 SO:0000356 SO:0001198 SO:0001169 MIXS:ViralGenomeTypeEnum.MIXED MIXS:ViralGenomeTypeEnum.SS_DNA SO:0001199 SO:0001201 SO:0001200 MIXS:ViralGenomeTypeEnum.UNCHARACTERIZED )
  ] .

SO:0000352 a owl:NamedIndividual ;
  skos:notation "DNA" ;
  a MIXS:ViralGenomeTypeEnum .

SO:0000356 a owl:NamedIndividual ;
  skos:notation "RNA" ;
  a MIXS:ViralGenomeTypeEnum .

SO:0001198 a owl:NamedIndividual ;
  skos:notation "dsDNA" ;
  a MIXS:ViralGenomeTypeEnum .

SO:0001169 a owl:NamedIndividual ;
  skos:notation "dsRNA" ;
  a MIXS:ViralGenomeTypeEnum .

MIXS:ViralGenomeTypeEnum.MIXED a owl:NamedIndividual ;
  skos:notation "mixed" ;
  a MIXS:ViralGenomeTypeEnum .

MIXS:ViralGenomeTypeEnum.SS_DNA a owl:NamedIndividual ;
  skos:notation "ssDNA" ;
  a MIXS:ViralGenomeTypeEnum .

SO:0001199 a owl:NamedIndividual ;
  skos:notation "ssRNA" ;
  a MIXS:ViralGenomeTypeEnum .

SO:0001201 a owl:NamedIndividual ;
  skos:notation "ssRNA (+)" ;
  a MIXS:ViralGenomeTypeEnum .

SO:0001200 a owl:NamedIndividual ;
  skos:notation "ssRNA (-)" ;
  a MIXS:ViralGenomeTypeEnum .

MIXS:ViralGenomeTypeEnum.UNCHARACTERIZED a owl:NamedIndividual ;
  skos:notation "uncharacterized" ;
  a MIXS:ViralGenomeTypeEnum .

MIXS:VirusEnrichApprEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:VirusEnrichApprEnum.CS_CL_DENSITY_GRADIENT MIXS:VirusEnrichApprEnum.DN_ASE MIXS:VirusEnrichApprEnum.FE_CL_PRECIPITATION MIXS:VirusEnrichApprEnum.PEG_PRECIPITATION MIXS:VirusEnrichApprEnum.RN_ASE MIXS:VirusEnrichApprEnum.CENTRIFUGATION MIXS:VirusEnrichApprEnum.FILTRATION MIXS:VirusEnrichApprEnum.NONE MIXS:VirusEnrichApprEnum.OTHER MIXS:VirusEnrichApprEnum.TARGETED_SEQUENCE_CAPTURE MIXS:VirusEnrichApprEnum.ULTRACENTRIFUGATION MIXS:VirusEnrichApprEnum.ULTRAFILTRATION )
  ] .

MIXS:VirusEnrichApprEnum.CS_CL_DENSITY_GRADIENT a owl:NamedIndividual ;
  skos:notation "CsCl density gradient" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.DN_ASE a owl:NamedIndividual ;
  skos:notation "DNAse" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.FE_CL_PRECIPITATION a owl:NamedIndividual ;
  skos:notation "FeCl Precipitation" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.PEG_PRECIPITATION a owl:NamedIndividual ;
  skos:notation "PEG Precipitation" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.RN_ASE a owl:NamedIndividual ;
  skos:notation "RNAse" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.CENTRIFUGATION a owl:NamedIndividual ;
  skos:notation "centrifugation" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.FILTRATION a owl:NamedIndividual ;
  skos:notation "filtration" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.NONE a owl:NamedIndividual ;
  skos:notation "none" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.OTHER a owl:NamedIndividual ;
  skos:notation "other" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.TARGETED_SEQUENCE_CAPTURE a owl:NamedIndividual ;
  skos:notation "targeted sequence capture" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.ULTRACENTRIFUGATION a owl:NamedIndividual ;
  skos:notation "ultracentrifugation" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:VirusEnrichApprEnum.ULTRAFILTRATION a owl:NamedIndividual ;
  skos:notation "ultrafiltration" ;
  a MIXS:VirusEnrichApprEnum .

MIXS:WallConstTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WallConstTypeEnum.FIRE_RESISTIVE MIXS:WallConstTypeEnum.FRAME_CONSTRUCTION MIXS:WallConstTypeEnum.JOISTED_MASONRY MIXS:WallConstTypeEnum.LIGHT_NONCOMBUSTIBLE MIXS:WallConstTypeEnum.MASONRY_NONCOMBUSTIBLE MIXS:WallConstTypeEnum.MODIFIED_FIRE_RESISTIVE )
  ] .

MIXS:WallConstTypeEnum.FIRE_RESISTIVE a owl:NamedIndividual ;
  skos:notation "fire resistive" ;
  a MIXS:WallConstTypeEnum .

MIXS:WallConstTypeEnum.FRAME_CONSTRUCTION a owl:NamedIndividual ;
  skos:notation "frame construction" ;
  a MIXS:WallConstTypeEnum .

MIXS:WallConstTypeEnum.JOISTED_MASONRY a owl:NamedIndividual ;
  skos:notation "joisted masonry" ;
  a MIXS:WallConstTypeEnum .

MIXS:WallConstTypeEnum.LIGHT_NONCOMBUSTIBLE a owl:NamedIndividual ;
  skos:notation "light noncombustible" ;
  a MIXS:WallConstTypeEnum .

MIXS:WallConstTypeEnum.MASONRY_NONCOMBUSTIBLE a owl:NamedIndividual ;
  skos:notation "masonry noncombustible" ;
  a MIXS:WallConstTypeEnum .

MIXS:WallConstTypeEnum.MODIFIED_FIRE_RESISTIVE a owl:NamedIndividual ;
  skos:notation "modified fire resistive" ;
  a MIXS:WallConstTypeEnum .

MIXS:WallFinishMatEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WallFinishMatEnum.ACOUSTICAL_TREATMENT MIXS:WallFinishMatEnum.GYPSUM_BOARD MIXS:WallFinishMatEnum.GYPSUM_PLASTER MIXS:WallFinishMatEnum.MASONRY MIXS:WallFinishMatEnum.METAL MIXS:WallFinishMatEnum.PLASTER MIXS:WallFinishMatEnum.STONE_FACING MIXS:WallFinishMatEnum.TERRAZZO MIXS:WallFinishMatEnum.TILE MIXS:WallFinishMatEnum.VENEER_PLASTER MIXS:WallFinishMatEnum.WOOD )
  ] .

MIXS:WallFinishMatEnum.ACOUSTICAL_TREATMENT a owl:NamedIndividual ;
  skos:notation "acoustical treatment" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.GYPSUM_BOARD a owl:NamedIndividual ;
  skos:notation "gypsum board" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.GYPSUM_PLASTER a owl:NamedIndividual ;
  skos:notation "gypsum plaster" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.MASONRY a owl:NamedIndividual ;
  skos:notation "masonry" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.METAL a owl:NamedIndividual ;
  skos:notation "metal" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.PLASTER a owl:NamedIndividual ;
  skos:notation "plaster" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.STONE_FACING a owl:NamedIndividual ;
  skos:notation "stone facing" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.TERRAZZO a owl:NamedIndividual ;
  skos:notation "terrazzo" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.TILE a owl:NamedIndividual ;
  skos:notation "tile" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.VENEER_PLASTER a owl:NamedIndividual ;
  skos:notation "veneer plaster" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallFinishMatEnum.WOOD a owl:NamedIndividual ;
  skos:notation "wood" ;
  a MIXS:WallFinishMatEnum .

MIXS:WallSurfTreatmentEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WallSurfTreatmentEnum.FABRIC MIXS:WallSurfTreatmentEnum.NO_TREATMENT MIXS:WallSurfTreatmentEnum.PAINTED MIXS:WallSurfTreatmentEnum.PANELING MIXS:WallSurfTreatmentEnum.STUCCO MIXS:WallSurfTreatmentEnum.WALL_PAPER )
  ] .

MIXS:WallSurfTreatmentEnum.FABRIC a owl:NamedIndividual ;
  skos:notation "fabric" ;
  a MIXS:WallSurfTreatmentEnum .

MIXS:WallSurfTreatmentEnum.NO_TREATMENT a owl:NamedIndividual ;
  skos:notation "no treatment" ;
  a MIXS:WallSurfTreatmentEnum .

MIXS:WallSurfTreatmentEnum.PAINTED a owl:NamedIndividual ;
  skos:notation "painted" ;
  a MIXS:WallSurfTreatmentEnum .

MIXS:WallSurfTreatmentEnum.PANELING a owl:NamedIndividual ;
  skos:notation "paneling" ;
  a MIXS:WallSurfTreatmentEnum .

MIXS:WallSurfTreatmentEnum.STUCCO a owl:NamedIndividual ;
  skos:notation "stucco" ;
  a MIXS:WallSurfTreatmentEnum .

MIXS:WallSurfTreatmentEnum.WALL_PAPER a owl:NamedIndividual ;
  skos:notation "wall paper" ;
  a MIXS:WallSurfTreatmentEnum .

MIXS:WaterFeatTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WaterFeatTypeEnum.FOUNTAIN MIXS:WaterFeatTypeEnum.POOL MIXS:WaterFeatTypeEnum.STANDING_FEATURE MIXS:WaterFeatTypeEnum.STREAM MIXS:WaterFeatTypeEnum.WATERFALL )
  ] .

MIXS:WaterFeatTypeEnum.FOUNTAIN a owl:NamedIndividual ;
  skos:notation "fountain" ;
  a MIXS:WaterFeatTypeEnum .

MIXS:WaterFeatTypeEnum.POOL a owl:NamedIndividual ;
  skos:notation "pool" ;
  a MIXS:WaterFeatTypeEnum .

MIXS:WaterFeatTypeEnum.STANDING_FEATURE a owl:NamedIndividual ;
  skos:notation "standing feature" ;
  a MIXS:WaterFeatTypeEnum .

MIXS:WaterFeatTypeEnum.STREAM a owl:NamedIndividual ;
  skos:notation "stream" ;
  a MIXS:WaterFeatTypeEnum .

MIXS:WaterFeatTypeEnum.WATERFALL a owl:NamedIndividual ;
  skos:notation "waterfall" ;
  a MIXS:WaterFeatTypeEnum .

MIXS:WeekdayEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WeekdayEnum.FRIDAY MIXS:WeekdayEnum.MONDAY MIXS:WeekdayEnum.SATURDAY MIXS:WeekdayEnum.SUNDAY MIXS:WeekdayEnum.THURSDAY MIXS:WeekdayEnum.TUESDAY MIXS:WeekdayEnum.WEDNESDAY )
  ] .

MIXS:WeekdayEnum.FRIDAY a owl:NamedIndividual ;
  skos:notation "Friday" ;
  a MIXS:WeekdayEnum .

MIXS:WeekdayEnum.MONDAY a owl:NamedIndividual ;
  skos:notation "Monday" ;
  a MIXS:WeekdayEnum .

MIXS:WeekdayEnum.SATURDAY a owl:NamedIndividual ;
  skos:notation "Saturday" ;
  a MIXS:WeekdayEnum .

MIXS:WeekdayEnum.SUNDAY a owl:NamedIndividual ;
  skos:notation "Sunday" ;
  a MIXS:WeekdayEnum .

MIXS:WeekdayEnum.THURSDAY a owl:NamedIndividual ;
  skos:notation "Thursday" ;
  a MIXS:WeekdayEnum .

MIXS:WeekdayEnum.TUESDAY a owl:NamedIndividual ;
  skos:notation "Tuesday" ;
  a MIXS:WeekdayEnum .

MIXS:WeekdayEnum.WEDNESDAY a owl:NamedIndividual ;
  skos:notation "Wednesday" ;
  a MIXS:WeekdayEnum .

MIXS:WgaAmpApprEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WgaAmpApprEnum.MDA_BASED MIXS:WgaAmpApprEnum.PCR_BASED )
  ] .

MIXS:WgaAmpApprEnum.MDA_BASED a owl:NamedIndividual ;
  skos:notation "mda based" ;
  a MIXS:WgaAmpApprEnum .

MIXS:WgaAmpApprEnum.PCR_BASED a owl:NamedIndividual ;
  skos:notation "pcr based" ;
  a MIXS:WgaAmpApprEnum .

MIXS:WindowCoverEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WindowCoverEnum.BLINDS MIXS:WindowCoverEnum.CURTAINS MIXS:WindowCoverEnum.NONE )
  ] .

MIXS:WindowCoverEnum.BLINDS a owl:NamedIndividual ;
  skos:notation "blinds" ;
  a MIXS:WindowCoverEnum .

MIXS:WindowCoverEnum.CURTAINS a owl:NamedIndividual ;
  skos:notation "curtains" ;
  a MIXS:WindowCoverEnum .

MIXS:WindowCoverEnum.NONE a owl:NamedIndividual ;
  skos:notation "none" ;
  a MIXS:WindowCoverEnum .

MIXS:WindowHorizPosEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WindowHorizPosEnum.LEFT MIXS:WindowHorizPosEnum.MIDDLE MIXS:WindowHorizPosEnum.RIGHT )
  ] .

MIXS:WindowHorizPosEnum.LEFT a owl:NamedIndividual ;
  skos:notation "left" ;
  a MIXS:WindowHorizPosEnum .

MIXS:WindowHorizPosEnum.MIDDLE a owl:NamedIndividual ;
  skos:notation "middle" ;
  a MIXS:WindowHorizPosEnum .

MIXS:WindowHorizPosEnum.RIGHT a owl:NamedIndividual ;
  skos:notation "right" ;
  a MIXS:WindowHorizPosEnum .

MIXS:WindowMatEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WindowMatEnum.CLAD MIXS:WindowMatEnum.FIBERGLASS MIXS:WindowMatEnum.METAL MIXS:WindowMatEnum.VINYL MIXS:WindowMatEnum.WOOD )
  ] .

MIXS:WindowMatEnum.CLAD a owl:NamedIndividual ;
  skos:notation "clad" ;
  a MIXS:WindowMatEnum .

MIXS:WindowMatEnum.FIBERGLASS a owl:NamedIndividual ;
  skos:notation "fiberglass" ;
  a MIXS:WindowMatEnum .

MIXS:WindowMatEnum.METAL a owl:NamedIndividual ;
  skos:notation "metal" ;
  a MIXS:WindowMatEnum .

MIXS:WindowMatEnum.VINYL a owl:NamedIndividual ;
  skos:notation "vinyl" ;
  a MIXS:WindowMatEnum .

MIXS:WindowMatEnum.WOOD a owl:NamedIndividual ;
  skos:notation "wood" ;
  a MIXS:WindowMatEnum .

MIXS:WindowStatusEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WindowStatusEnum.CLOSED MIXS:WindowStatusEnum.OPEN )
  ] .

MIXS:WindowStatusEnum.CLOSED a owl:NamedIndividual ;
  skos:notation "closed" ;
  a MIXS:WindowStatusEnum .

MIXS:WindowStatusEnum.OPEN a owl:NamedIndividual ;
  skos:notation "open" ;
  a MIXS:WindowStatusEnum .

MIXS:WindowTypeEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WindowTypeEnum.FIXED_WINDOW MIXS:WindowTypeEnum.HORIZONTAL_SASH_WINDOW MIXS:WindowTypeEnum.SINGLE_HUNG_SASH_WINDOW )
  ] .

MIXS:WindowTypeEnum.FIXED_WINDOW a owl:NamedIndividual ;
  skos:notation "fixed window" ;
  a MIXS:WindowTypeEnum .

MIXS:WindowTypeEnum.HORIZONTAL_SASH_WINDOW a owl:NamedIndividual ;
  skos:notation "horizontal sash window" ;
  a MIXS:WindowTypeEnum .

MIXS:WindowTypeEnum.SINGLE_HUNG_SASH_WINDOW a owl:NamedIndividual ;
  skos:notation "single-hung sash window" ;
  a MIXS:WindowTypeEnum .

MIXS:WindowVertPosEnum a owl:Class ;
  owl:equivalentClass [
    a owl:Class ;
    owl:oneOf ( MIXS:WindowVertPosEnum.BOTTOM MIXS:WindowVertPosEnum.HIGH MIXS:WindowVertPosEnum.LOW MIXS:WindowVertPosEnum.MIDDLE MIXS:WindowVertPosEnum.TOP )
  ] .

MIXS:WindowVertPosEnum.BOTTOM a owl:NamedIndividual ;
  skos:notation "bottom" ;
  a MIXS:WindowVertPosEnum .

MIXS:WindowVertPosEnum.HIGH a owl:NamedIndividual ;
  skos:notation "high" ;
  a MIXS:WindowVertPosEnum .

MIXS:WindowVertPosEnum.LOW a owl:NamedIndividual ;
  skos:notation "low" ;
  a MIXS:WindowVertPosEnum .

MIXS:WindowVertPosEnum.MIDDLE a owl:NamedIndividual ;
  skos:notation "middle" ;
  a MIXS:WindowVertPosEnum .

MIXS:WindowVertPosEnum.TOP a owl:NamedIndividual ;
  skos:notation "top" ;
  a MIXS:WindowVertPosEnum .

skos:note a owl:AnnotationProperty .

pav:version a owl:AnnotationProperty .

vann:preferredNamespacePrefix a owl:AnnotationProperty .

vann:preferredNamespaceUri a owl:AnnotationProperty .

skos:altLabel a owl:AnnotationProperty .

MIXS:use_cases a owl:AnnotationProperty .

skos:example a owl:AnnotationProperty .

schema:keywords a owl:AnnotationProperty .

MIXS:Expected_value a owl:AnnotationProperty .

MIXS:Preferred_unit a owl:AnnotationProperty .

skos:broadMatch a owl:AnnotationProperty .

skos:closeMatch a owl:AnnotationProperty .

skos:notation a owl:AnnotationProperty .

sh:declare a owl:AnnotationProperty .

sh:prefix a owl:AnnotationProperty .

sh:namespace a owl:AnnotationProperty .